| Date | Panel | Item | Activity | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mendeliome v0.3990 | PAFAH1B1 | Zornitza Stark Publications for gene: PAFAH1B1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3989 | PAFAH1B1 | Zornitza Stark Mode of inheritance for gene: PAFAH1B1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3988 | PAFAH1B1 | Zornitza Stark reviewed gene: PAFAH1B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 11754098, 18285425; Phenotypes: Lissencephaly 1, MIM# 607432, Subcortical laminar heterotopia, MIM# 607432, MONDO:0011830; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.104 | PAFAH1B1 | Zornitza Stark changed review comment from: Lissencephaly due to PAFAH1B1 (prev known as LIS1) mutation is a cerebral malformation with epilepsy characterised predominantly by posterior isolated lissencephaly with developmental delay, intellectual disability and epilepsy that usually evolves from West syndrome to Lennox-Gastaut syndrome. Additional features include muscular hypotonia, acquired microcephaly, failure to thrive and poor control of airways leading to aspiration pneumonia.; to: Lissencephaly due to PAFAH1B1 (prev known as LIS1) mutation is a cerebral malformation with epilepsy characterised predominantly by posterior isolated lissencephaly with developmental delay, intellectual disability and epilepsy that usually evolves from West syndrome to Lennox-Gastaut syndrome. Additional features include muscular hypotonia, acquired microcephaly, failure to thrive and poor control of airways leading to aspiration pneumonia. Note deletions are common. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.104 | PAFAH1B1 | Zornitza Stark Marked gene: PAFAH1B1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.104 | PAFAH1B1 | Zornitza Stark Gene: pafah1b1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.104 | PAFAH1B1 | Zornitza Stark Tag SV/CNV tag was added to gene: PAFAH1B1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.104 | PAFAH1B1 | Zornitza Stark Phenotypes for gene: PAFAH1B1 were changed from to Lissencephaly 1, MIM# 607432; Subcortical laminar heterotopia, MIM# 607432; MONDO:0011830 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.103 | PAFAH1B1 | Zornitza Stark Publications for gene: PAFAH1B1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.102 | PAFAH1B1 | Zornitza Stark Mode of inheritance for gene: PAFAH1B1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.101 | PAFAH1B1 | Zornitza Stark reviewed gene: PAFAH1B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 11754098, 18285425; Phenotypes: Lissencephaly 1, MIM# 607432, Subcortical laminar heterotopia, MIM# 607432, MONDO:0011830; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.101 | LARGE1 | Zornitza Stark Marked gene: LARGE1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.101 | LARGE1 | Zornitza Stark Gene: large1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.101 | LARGE1 | Zornitza Stark Phenotypes for gene: LARGE1 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 6, MIM# 613154; Muscular dystrophy-dystroglycanopathy (congenital with mental retardation), type B, 6, MIM# 608840 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.100 | LARGE1 | Zornitza Stark Mode of inheritance for gene: LARGE1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.99 | LARGE1 | Zornitza Stark reviewed gene: LARGE1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 6, MIM# 613154, Muscular dystrophy-dystroglycanopathy (congenital with mental retardation), type B, 6, MIM# 608840; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3988 | LAMB1 | Zornitza Stark Marked gene: LAMB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3988 | LAMB1 | Zornitza Stark Gene: lamb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3988 | LAMB1 | Zornitza Stark Phenotypes for gene: LAMB1 were changed from to Lissencephaly 5, MIM# 615191; Cystic leukoencephalopathy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3987 | LAMB1 | Zornitza Stark Publications for gene: LAMB1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3986 | LAMB1 | Zornitza Stark Mode of inheritance for gene: LAMB1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3985 | LAMB1 | Zornitza Stark reviewed gene: LAMB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23472759, 25925986, 29888467, 25925986, 32548278; Phenotypes: Lissencephaly 5, MIM# 615191, Cystic leukoencephalopathy; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.99 | LAMB1 | Zornitza Stark Phenotypes for gene: LAMB1 were changed from to Lissencephaly 5, MIM# 615191 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.98 | LAMB1 | Zornitza Stark Publications for gene: LAMB1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.97 | LAMB1 | Zornitza Stark Mode of inheritance for gene: LAMB1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.96 | LAMB1 | Zornitza Stark reviewed gene: LAMB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23472759, 25925986, 29888467; Phenotypes: Lissencephaly 5, MIM# 615191; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.73 | TMEM5 | Zornitza Stark Marked gene: TMEM5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.73 | TMEM5 | Zornitza Stark Gene: tmem5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.73 | TMEM5 | Zornitza Stark Phenotypes for gene: TMEM5 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.72 | TMEM5 | Zornitza Stark Publications for gene: TMEM5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.71 | TMEM5 | Zornitza Stark Mode of inheritance for gene: TMEM5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.70 | TMEM5 | Zornitza Stark reviewed gene: TMEM5: Rating: GREEN; Mode of pathogenicity: None; Publications: 23217329, 23519211; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3985 | TMEM5 | Zornitza Stark Marked gene: TMEM5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3985 | TMEM5 | Zornitza Stark Gene: tmem5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3985 | TMEM5 | Zornitza Stark Phenotypes for gene: TMEM5 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3984 | TMEM5 | Zornitza Stark Publications for gene: TMEM5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3983 | TMEM5 | Zornitza Stark Mode of inheritance for gene: TMEM5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3982 | TMEM5 | Zornitza Stark reviewed gene: TMEM5: Rating: GREEN; Mode of pathogenicity: None; Publications: 23217329, 23519211; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cobblestone Malformations v0.12 | TMEM5 | Zornitza Stark Marked gene: TMEM5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cobblestone Malformations v0.12 | TMEM5 | Zornitza Stark Gene: tmem5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cobblestone Malformations v0.12 | TMEM5 | Zornitza Stark Phenotypes for gene: TMEM5 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cobblestone Malformations v0.11 | TMEM5 | Zornitza Stark Publications for gene: TMEM5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cobblestone Malformations v0.10 | TMEM5 | Zornitza Stark Mode of inheritance for gene: TMEM5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cobblestone Malformations v0.9 | TMEM5 | Zornitza Stark reviewed gene: TMEM5: Rating: GREEN; Mode of pathogenicity: None; Publications: 23217329, 23519211; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.96 | TMEM5 | Zornitza Stark Marked gene: TMEM5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.96 | TMEM5 | Zornitza Stark Gene: tmem5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.96 | TMEM5 | Zornitza Stark Phenotypes for gene: TMEM5 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.95 | TMEM5 | Zornitza Stark Publications for gene: TMEM5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.94 | TMEM5 | Zornitza Stark Mode of inheritance for gene: TMEM5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.93 | TMEM5 | Zornitza Stark edited their review of gene: TMEM5: Changed publications: 23217329, 23519211 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.93 | TMEM5 | Zornitza Stark reviewed gene: TMEM5: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.201 | KIF5C | Zornitza Stark Marked gene: KIF5C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.201 | KIF5C | Zornitza Stark Gene: kif5c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.201 | KIF5C | Zornitza Stark Phenotypes for gene: KIF5C were changed from to Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.200 | KIF5C | Zornitza Stark Publications for gene: KIF5C were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.199 | KIF5C | Zornitza Stark Mode of inheritance for gene: KIF5C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.198 | KIF5C | Zornitza Stark reviewed gene: KIF5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 23033978, 32562872; Phenotypes: Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2891 | KIF5C | Zornitza Stark Marked gene: KIF5C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2891 | KIF5C | Zornitza Stark Gene: kif5c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2891 | KIF5C | Zornitza Stark Phenotypes for gene: KIF5C were changed from to Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2890 | KIF5C | Zornitza Stark Publications for gene: KIF5C were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.816 | KIF5C | Zornitza Stark Marked gene: KIF5C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.816 | KIF5C | Zornitza Stark Gene: kif5c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2889 | KIF5C | Zornitza Stark Mode of inheritance for gene: KIF5C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.816 | KIF5C | Zornitza Stark Phenotypes for gene: KIF5C were changed from to Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2888 | KIF5C | Zornitza Stark reviewed gene: KIF5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 23033978, 32562872; Phenotypes: Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.815 | KIF5C | Zornitza Stark Publications for gene: KIF5C were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.814 | KIF5C | Zornitza Stark Mode of inheritance for gene: KIF5C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3982 | KIF5C | Zornitza Stark Marked gene: KIF5C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3982 | KIF5C | Zornitza Stark Gene: kif5c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.813 | KIF5C | Zornitza Stark reviewed gene: KIF5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 23033978, 32562872; Phenotypes: Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3982 | KIF5C | Zornitza Stark Phenotypes for gene: KIF5C were changed from to Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3981 | KIF5C | Zornitza Stark Publications for gene: KIF5C were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3980 | KIF5C | Zornitza Stark Mode of inheritance for gene: KIF5C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.142 | KIF5C | Zornitza Stark Marked gene: KIF5C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.142 | KIF5C | Zornitza Stark Gene: kif5c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.142 | KIF5C | Zornitza Stark Phenotypes for gene: KIF5C were changed from to Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3979 | KIF5C | Zornitza Stark reviewed gene: KIF5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 23033978, 32562872; Phenotypes: Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.141 | KIF5C | Zornitza Stark Publications for gene: KIF5C were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.140 | KIF5C | Zornitza Stark Mode of inheritance for gene: KIF5C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.139 | KIF5C | Zornitza Stark reviewed gene: KIF5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 23033978, 32562872; Phenotypes: Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.93 | KIF5C | Zornitza Stark Marked gene: KIF5C as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.93 | KIF5C | Zornitza Stark Gene: kif5c has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.93 | KIF5C | Zornitza Stark Phenotypes for gene: KIF5C were changed from to Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.92 | KIF5C | Zornitza Stark Publications for gene: KIF5C were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.91 | KIF5C | Zornitza Stark Mode of inheritance for gene: KIF5C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.90 | KIF5C | Zornitza Stark reviewed gene: KIF5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 23033978, 32562872; Phenotypes: Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.198 | KIF2A | Zornitza Stark Marked gene: KIF2A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.198 | KIF2A | Zornitza Stark Gene: kif2a has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.198 | KIF2A | Zornitza Stark Phenotypes for gene: KIF2A were changed from to Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.197 | KIF2A | Zornitza Stark Publications for gene: KIF2A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.196 | KIF2A | Zornitza Stark Mode of inheritance for gene: KIF2A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.195 | KIF2A | Zornitza Stark Classified gene: KIF2A as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.195 | KIF2A | Zornitza Stark Gene: kif2a has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.194 | KIF2A | Zornitza Stark reviewed gene: KIF2A: Rating: RED; Mode of pathogenicity: None; Publications: 23603762, 27896282, 27747449, 29077851, 31919497; Phenotypes: Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.153 | KIF2A | Zornitza Stark Marked gene: KIF2A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.153 | KIF2A | Zornitza Stark Gene: kif2a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.153 | KIF2A | Zornitza Stark Classified gene: KIF2A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.153 | KIF2A | Zornitza Stark Gene: kif2a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.152 | KIF2A |
Zornitza Stark gene: KIF2A was added gene: KIF2A was added to Microcephaly. Sources: Expert Review Mode of inheritance for gene: KIF2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: KIF2A were set to 23603762; 27896282; 27747449; 29077851; 31919497 Phenotypes for gene: KIF2A were set to Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411 Review for gene: KIF2A was set to GREEN Added comment: At least five unrelated families reported, with various malformations of cortical development including lissencephaly, agyria, posterior or frontal pachygyria, subcortical band heterotopia, and thin corpus callosum; microcephaly, intellectual disability and seizures. Microcephaly is in the range of -2SD -4.5SD, described as progressive in at least one individual. Some normocephalic but lower end of normal range. Some recurrent missense at p.Ser317 and p.His321. Functional data supports gene-disease association. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.813 | KIF2A | Zornitza Stark Marked gene: KIF2A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.813 | KIF2A | Zornitza Stark Gene: kif2a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.813 | KIF2A | Zornitza Stark Phenotypes for gene: KIF2A were changed from to Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.812 | KIF2A | Zornitza Stark Publications for gene: KIF2A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.811 | KIF2A | Zornitza Stark Mode of inheritance for gene: KIF2A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.810 | KIF2A | Zornitza Stark reviewed gene: KIF2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 27896282, 27747449, 29077851, 31919497; Phenotypes: Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.90 | KIF2A | Zornitza Stark Marked gene: KIF2A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.90 | KIF2A | Zornitza Stark Gene: kif2a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3979 | KIF2A | Zornitza Stark Marked gene: KIF2A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3979 | KIF2A | Zornitza Stark Gene: kif2a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3979 | KIF2A | Zornitza Stark Phenotypes for gene: KIF2A were changed from to Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3978 | KIF2A | Zornitza Stark Publications for gene: KIF2A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3977 | KIF2A | Zornitza Stark Mode of inheritance for gene: KIF2A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3976 | KIF2A | Zornitza Stark reviewed gene: KIF2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 27896282, 27747449, 29077851, 31919497; Phenotypes: Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.90 | KIF2A | Zornitza Stark Phenotypes for gene: KIF2A were changed from to Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.89 | KIF2A | Zornitza Stark Publications for gene: KIF2A were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.88 | KIF2A | Zornitza Stark Mode of inheritance for gene: KIF2A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.87 | KIF2A | Zornitza Stark reviewed gene: KIF2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 27896282, 27747449, 29077851, 31919497; Phenotypes: Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.87 | DCX | Zornitza Stark Marked gene: DCX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.87 | DCX | Zornitza Stark Gene: dcx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v0.53 | ISPD | Zornitza Stark Marked gene: ISPD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v0.53 | ISPD | Zornitza Stark Gene: ispd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v0.53 | ISPD | Zornitza Stark Publications for gene: ISPD were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Limb-Girdle Muscular Dystrophy and Distal Myopathy v0.52 | ISPD | Zornitza Stark reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 23390185, 30060766, 28688748, 26404900; Phenotypes: Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.70 | ISPD | Zornitza Stark Marked gene: ISPD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.70 | ISPD | Zornitza Stark Gene: ispd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.70 | ISPD | Zornitza Stark Phenotypes for gene: ISPD were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrocephalus_Ventriculomegaly v0.55 | ISPD | Zornitza Stark Phenotypes for gene: ISPD were changed from Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052 to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrocephalus_Ventriculomegaly v0.54 | ISPD | Zornitza Stark Phenotypes for gene: ISPD were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3976 | ISPD | Zornitza Stark Marked gene: ISPD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3976 | ISPD | Zornitza Stark Gene: ispd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3976 | ISPD | Zornitza Stark Phenotypes for gene: ISPD were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3975 | ISPD | Zornitza Stark Publications for gene: ISPD were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3974 | ISPD | Zornitza Stark Mode of inheritance for gene: ISPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.69 | ISPD | Zornitza Stark Publications for gene: ISPD were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.68 | ISPD | Zornitza Stark Mode of inheritance for gene: ISPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.67 | ISPD | Zornitza Stark reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 22522421, 23217329, 23390185, 30060766, 28688748, 26404900; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643, Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.67 | Zornitza Stark Panel name changed from Muscular dystrophy to Muscular dystrophy_Paediatric | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrocephalus_Ventriculomegaly v0.53 | ISPD | Zornitza Stark Marked gene: ISPD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrocephalus_Ventriculomegaly v0.53 | ISPD | Zornitza Stark Gene: ispd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3973 | ISPD | Zornitza Stark reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 22522421, 23217329, 23390185, 30060766, 28688748, 26404900; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643, Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.87 | ISPD | Zornitza Stark edited their review of gene: ISPD: Changed publications: 22522421, 23217329 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrocephalus_Ventriculomegaly v0.53 | ISPD | Zornitza Stark Publications for gene: ISPD were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrocephalus_Ventriculomegaly v0.52 | ISPD | Zornitza Stark Mode of inheritance for gene: ISPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrocephalus_Ventriculomegaly v0.51 | ISPD | Zornitza Stark reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 22522421, 23217329; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.87 | ISPD | Zornitza Stark Publications for gene: ISPD were set to 22522421 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.86 | ISPD | Zornitza Stark Marked gene: ISPD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.86 | ISPD | Zornitza Stark Gene: ispd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.86 | ISPD | Zornitza Stark Phenotypes for gene: ISPD were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.85 | ISPD | Zornitza Stark Publications for gene: ISPD were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.84 | ISPD | Zornitza Stark Mode of inheritance for gene: ISPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.83 | ISPD | Zornitza Stark reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 22522421; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.83 | DYNC1H1 | Zornitza Stark Marked gene: DYNC1H1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.83 | DYNC1H1 | Zornitza Stark Gene: dync1h1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.83 | DYNC1H1 | Zornitza Stark Phenotypes for gene: DYNC1H1 were changed from to Mental retardation, autosomal dominant 13, MIM# 614563 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.82 | DYNC1H1 | Zornitza Stark Publications for gene: DYNC1H1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.81 | DYNC1H1 | Zornitza Stark Mode of inheritance for gene: DYNC1H1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.80 | DYNC1H1 | Zornitza Stark changed review comment from: Variable neuronal migration defects resulting in cortical malformations, including pachygyria, nodular heterotopias, and PMG.; to: Variable neuronal migration defects resulting in cortical malformations, including pachygyria, lissencephaly, nodular heterotopias, and PMG. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.80 | DYNC1H1 | Zornitza Stark edited their review of gene: DYNC1H1: Changed publications: 23603762, 29671837, 32570172, 27331017 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.80 | DYNC1H1 | Zornitza Stark edited their review of gene: DYNC1H1: Changed publications: 23603762 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.80 | DYNC1H1 | Zornitza Stark reviewed gene: DYNC1H1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mental retardation, autosomal dominant 13, MIM# 614563; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3973 | DCX | Zornitza Stark Marked gene: DCX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3973 | DCX | Zornitza Stark Gene: dcx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3973 | DCX | Zornitza Stark Phenotypes for gene: DCX were changed from to Lissencephaly, X-linked, MIM# 300067; Subcortical laminal heterotopia, X-linked 300067 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3972 | DCX | Zornitza Stark Publications for gene: DCX were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3971 | DCX | Zornitza Stark Mode of inheritance for gene: DCX was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.80 | DCX | Zornitza Stark Phenotypes for gene: DCX were changed from to Lissencephaly, X-linked, MIM# 300067; Subcortical laminal heterotopia, X-linked 300067 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3970 | DCX | Zornitza Stark reviewed gene: DCX: Rating: GREEN; Mode of pathogenicity: None; Publications: 10915612, 9489699, 12552055; Phenotypes: Lissencephaly, X-linked, MIM# 300067, Subcortical laminal heterotopia, X-linked 300067; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.79 | DCX | Zornitza Stark Publications for gene: DCX were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.78 | DCX | Zornitza Stark Mode of inheritance for gene: DCX was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.77 | DCX | Zornitza Stark reviewed gene: DCX: Rating: GREEN; Mode of pathogenicity: None; Publications: 10915612, 9489699, 12552055; Phenotypes: Lissencephaly, X-linked, MIM# 300067, Subcortical laminal heterotopia, X-linked 300067; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.77 | B3GALNT2 | Zornitza Stark Marked gene: B3GALNT2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.77 | B3GALNT2 | Zornitza Stark Gene: b3galnt2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.77 | B3GALNT2 | Zornitza Stark Phenotypes for gene: B3GALNT2 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 11, MIM# 615181 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.76 | B3GALNT2 | Zornitza Stark Publications for gene: B3GALNT2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.75 | B3GALNT2 | Zornitza Stark Mode of inheritance for gene: B3GALNT2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.74 | B3GALNT2 | Zornitza Stark reviewed gene: B3GALNT2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23453667; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 11, MIM# 615181; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.74 | ARX | Zornitza Stark Marked gene: ARX as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.74 | ARX | Zornitza Stark Gene: arx has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.74 | ARX | Zornitza Stark Phenotypes for gene: ARX were changed from to Lissencephaly, X-linked 2, MIM# 300215 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.73 | ARX | Zornitza Stark Publications for gene: ARX were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.72 | ARX | Zornitza Stark Mode of inheritance for gene: ARX was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.71 | ARX | Zornitza Stark reviewed gene: ARX: Rating: GREEN; Mode of pathogenicity: None; Publications: 14722918; Phenotypes: Lissencephaly, X-linked 2, MIM# 300215; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2888 | DPM3 | Zornitza Stark edited their review of gene: DPM3: Changed phenotypes: Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 15 612937, Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 15 618992 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Susceptibility to Viral Infections v0.65 | TLR7 | Zornitza Stark Marked gene: TLR7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Susceptibility to Viral Infections v0.65 | TLR7 | Zornitza Stark Gene: tlr7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Susceptibility to Viral Infections v0.65 | TLR7 | Zornitza Stark Classified gene: TLR7 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Susceptibility to Viral Infections v0.65 | TLR7 | Zornitza Stark Gene: tlr7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Susceptibility to Viral Infections v0.64 | TLR7 |
Zornitza Stark gene: TLR7 was added gene: TLR7 was added to Susceptibility to Viral Infections. Sources: Expert list Mode of inheritance for gene: TLR7 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TLR7 were set to 32706371 Phenotypes for gene: TLR7 were set to Immunodeficiency 74, COVID19-related, X-linked, MIM# 301051 Review for gene: TLR7 was set to GREEN Added comment: Four affected individuals from two unrelated families and some functional data. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3970 | TLR7 | Zornitza Stark reviewed gene: TLR7: Rating: GREEN; Mode of pathogenicity: None; Publications: 32706371; Phenotypes: Immunodeficiency 74, COVID19-related, X-linked, MIM# 301051; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Palmoplantar Keratoderma and Erythrokeratoderma v0.94 | ASPRV1 | Zornitza Stark Phenotypes for gene: ASPRV1 were changed from palmoplantar keratoderma; lamellar ichthyosis to Ichthyosis, lamellar, autosomal dominant, MIM# 146750; palmoplantar keratoderma; lamellar ichthyosis | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Palmoplantar Keratoderma and Erythrokeratoderma v0.93 | ASPRV1 | Zornitza Stark reviewed gene: ASPRV1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ichthyosis, lamellar, autosomal dominant, MIM# 146750; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3970 | ASPRV1 | Zornitza Stark Phenotypes for gene: ASPRV1 were changed from palmoplantar keratoderma; lamellar ichthyosis to Ichthyosis, lamellar, autosomal dominant, MIM# 146750; palmoplantar keratoderma; lamellar ichthyosis | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3969 | ASPRV1 | Zornitza Stark reviewed gene: ASPRV1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ichthyosis, lamellar, autosomal dominant, MIM# 146750; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ichthyosis v0.97 | ASPRV1 | Zornitza Stark Phenotypes for gene: ASPRV1 were changed from palmoplantar keratoderma; lamellar ichthyosis to Ichthyosis, lamellar, autosomal dominant, MIM# 146750; palmoplantar keratoderma; lamellar ichthyosis | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ichthyosis v0.96 | ASPRV1 | Zornitza Stark edited their review of gene: ASPRV1: Changed rating: GREEN; Changed phenotypes: Ichthyosis, lamellar, autosomal dominant, MIM# 146750; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ichthyosis v0.96 | ASPRV1 | Zornitza Stark reviewed gene: ASPRV1: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Ichthyosis, lamellar, autosomal dominant, M 146750; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiomyopathy_Paediatric v0.7 | MRPL44 | Zornitza Stark Marked gene: MRPL44 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiomyopathy_Paediatric v0.7 | MRPL44 | Zornitza Stark Gene: mrpl44 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiomyopathy_Paediatric v0.7 | MRPL44 | Zornitza Stark Phenotypes for gene: MRPL44 were changed from Combined oxidative phosphorylation deficiency 16, 615395; Multiple respiratory chain complex deficiencies (disorders of protein synthesis) to Combined oxidative phosphorylation deficiency 16, 615395 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiomyopathy_Paediatric v0.6 | MRPL44 | Zornitza Stark Phenotypes for gene: MRPL44 were changed from ?Combined oxidative phosphorylation deficiency 16, 615395; Multiple respiratory chain complex deficiencies (disorders of protein synthesis) to Combined oxidative phosphorylation deficiency 16, 615395; Multiple respiratory chain complex deficiencies (disorders of protein synthesis) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiomyopathy_Paediatric v0.5 | MRPL44 | Zornitza Stark Publications for gene: MRPL44 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiomyopathy_Paediatric v0.4 | MRPL44 | Zornitza Stark reviewed gene: MRPL44: Rating: GREEN; Mode of pathogenicity: None; Publications: 23315540, 25797485; Phenotypes: Combined oxidative phosphorylation deficiency 16, MIM# 615395; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3969 | MRPL44 | Zornitza Stark Marked gene: MRPL44 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3969 | MRPL44 | Zornitza Stark Gene: mrpl44 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3969 | MRPL44 | Zornitza Stark Phenotypes for gene: MRPL44 were changed from to Combined oxidative phosphorylation deficiency 16, MIM# 615395 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3968 | MRPL44 | Zornitza Stark Publications for gene: MRPL44 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3967 | MRPL44 | Zornitza Stark Mode of inheritance for gene: MRPL44 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3966 | MRPL44 | Zornitza Stark reviewed gene: MRPL44: Rating: GREEN; Mode of pathogenicity: None; Publications: 23315540, 25797485; Phenotypes: Combined oxidative phosphorylation deficiency 16, MIM# 615395; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.468 | MRPL44 | Zornitza Stark Marked gene: MRPL44 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.468 | MRPL44 | Zornitza Stark Gene: mrpl44 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.468 | MRPL44 | Zornitza Stark Phenotypes for gene: MRPL44 were changed from to Combined oxidative phosphorylation deficiency 16, MIM# 615395 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.467 | MRPL44 | Zornitza Stark Publications for gene: MRPL44 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.466 | MRPL44 | Zornitza Stark Mode of inheritance for gene: MRPL44 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.465 | MRPL44 | Zornitza Stark edited their review of gene: MRPL44: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.465 | MRPL44 | Zornitza Stark reviewed gene: MRPL44: Rating: ; Mode of pathogenicity: None; Publications: 23315540, 25797485; Phenotypes: Combined oxidative phosphorylation deficiency 16, MIM# 615395; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.32 | FANCL | Bryony Thompson Marked gene: FANCL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.32 | FANCL | Bryony Thompson Gene: fancl has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Primary Ovarian Insufficiency_Premature Ovarian Failure v0.32 | FANCL |
Bryony Thompson gene: FANCL was added gene: FANCL was added to Amenorrhoea. Sources: Literature Mode of inheritance for gene: FANCL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: FANCL were set to 32048394; 32851770; 11823446 Phenotypes for gene: FANCL were set to Primary ovarian insufficiency Review for gene: FANCL was set to AMBER Added comment: 2 independent cases reported with heterozygous loss of function variants and primary ovarian insufficiency. However, there is no reported evidence of POI in female carriers of FANCL pathogenic variants for fanconi anemia. Null mouse model is less fertile and has defective proliferation of germ cells. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.103 | LMNB1 |
Bryony Thompson changed review comment from: Four unrelated families reported with adult onset cerebellar ataxia as a feature of the condition. Sources: Expert list; to: Four unrelated families reported with adult onset cerebellar ataxia as a feature of the condition. CNV is the only reported cause of the condition. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.103 | LMNB1 | Bryony Thompson Tag SV/CNV tag was added to gene: LMNB1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.72 | PRNP | Bryony Thompson Classified STR: PRNP as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.72 | PRNP | Bryony Thompson Str: prnp has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.71 | PRNP |
Bryony Thompson STR: PRNP was added STR: PRNP was added to Early-onset Dementia. Sources: Expert list STR tags were added to STR: PRNP. Mode of inheritance for STR: PRNP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: PRNP were set to 20301407 Phenotypes for STR: PRNP were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440 Review for STR: PRNP was set to GREEN STR: PRNP was marked as clinically relevant Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X] Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat. Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.103 | SCA31 | Bryony Thompson Classified STR: SCA31 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.103 | SCA31 | Bryony Thompson Str: sca31 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.102 | SCA31 |
Bryony Thompson STR: SCA31 was added STR: SCA31 was added to Ataxia - adult onset. Sources: Literature STR tags were added to STR: SCA31. Mode of inheritance for STR: SCA31 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA31 were set to 19878914; 31755042 Phenotypes for STR: SCA31 were set to Spinocerebellar ataxia 31 MIM#117210 Review for STR: SCA31 was set to GREEN Added comment: Complex repeat insertion (TGGAA)n, (TAGAA)n, (TAAAA)n, (TAAAATAGAA)n, TGGAA is present only in affected cases. Sequencing showed that the insertion consisted of a preceding TCAC sequence, and 3 pentanucleotide repeat components (TGGAA)n, (TAGAA)n, and (TAAAA)n in all patients tested. 2.5-3.8 KB insertion is associated with disease and RNA toxicity expected to be mechanism of disease Normal and pathogenic cut-offs are based on animal model experiments (PMID: 31755042) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3966 | KBTBD13 | Zornitza Stark Marked gene: KBTBD13 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3966 | KBTBD13 | Zornitza Stark Gene: kbtbd13 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3966 | KBTBD13 | Zornitza Stark Phenotypes for gene: KBTBD13 were changed from to Nemaline myopathy 6, autosomal dominant, MIM# 609273; Hereditary motor neuropathy; late-onset limb girdle muscular dystrophy | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3965 | KBTBD13 | Zornitza Stark Publications for gene: KBTBD13 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3964 | KBTBD13 | Zornitza Stark Mode of inheritance for gene: KBTBD13 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3963 | KBTBD13 | Zornitza Stark edited their review of gene: KBTBD13: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3963 | KBTBD13 | Zornitza Stark reviewed gene: KBTBD13: Rating: ; Mode of pathogenicity: None; Publications: 11731279, 21104864; Phenotypes: Nemaline myopathy 6, autosomal dominant, MIM# 609273, Hereditary motor neuropathy, late-onset limb girdle muscular dystrophy; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.465 | NDUFA13 | Zornitza Stark Publications for gene: NDUFA13 were set to 25901006 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3963 | NDUFA13 | Zornitza Stark Publications for gene: NDUFA13 were set to 25901006 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3962 | NDUFA13 | Zornitza Stark Classified gene: NDUFA13 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3962 | NDUFA13 | Zornitza Stark Gene: ndufa13 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3961 | NDUFA13 | Zornitza Stark edited their review of gene: NDUFA13: Added comment: Second family reported with some supportive functional data.; Changed rating: AMBER; Changed publications: 25901006, 32722639 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.464 | NDUFA13 | Zornitza Stark Classified gene: NDUFA13 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.464 | NDUFA13 | Zornitza Stark Gene: ndufa13 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mitochondrial disease v0.463 | NDUFA13 | Zornitza Stark edited their review of gene: NDUFA13: Added comment: Second family reported with some supportive functional data.; Changed rating: AMBER; Changed publications: 25901006, 32722639 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3961 | KBTBD13 | Elena Savva reviewed gene: KBTBD13: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID: 28403181, 31167812, 31671076, 30208948; Phenotypes: Nemaline myopathy 6, autosomal dominant, 609273, Hereditary motor neuropathy, late-onset limb girdle muscular dystrophy; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.101 | SCA37 | Bryony Thompson Classified STR: SCA37 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.101 | SCA37 | Bryony Thompson Str: sca37 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.100 | SCA37 |
Bryony Thompson STR: SCA37 was added STR: SCA37 was added to Ataxia - adult onset. Sources: Literature STR tags were added to STR: SCA37. Mode of inheritance for STR: SCA37 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA37 were set to 28686858; 31145571 Phenotypes for STR: SCA37 were set to Spinocerebellar ataxia 37 MIM#615945 Review for STR: SCA37 was set to GREEN STR: SCA37 was marked as clinically relevant Added comment: NC_000001.10:g.57832716_57832797ins[(ATTTT)60-79(ATTTC)31-75(ATTTT)58-90] Located in a 5'UTR intron, flanked by (ATTTT)n on both sides Non-pathogenic allele: (ATTTT)7–400 Pathogenic allele: [(ATTTT)60–79(ATTTC)31–75(ATTTT)58–90] Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.99 | CANVAS | Bryony Thompson Classified STR: CANVAS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.99 | CANVAS | Bryony Thompson Str: canvas has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.98 | CANVAS |
Bryony Thompson STR: CANVAS was added STR: CANVAS was added to Ataxia - adult onset. Sources: Expert list STR tags were added to STR: CANVAS. Mode of inheritance for STR: CANVAS was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: CANVAS were set to 30926972 Phenotypes for STR: CANVAS were set to Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575 Review for STR: CANVAS was set to GREEN STR: CANVAS was marked as clinically relevant Added comment: Simple tandem repeat (AAAAG)11 replaced with (AAGGG)n in intron 2 of RFC1. Loss of function is not the mechanism of disease. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.70 | C9orf72 | Bryony Thompson Classified STR: C9orf72 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.70 | C9orf72 | Bryony Thompson Str: c9orf72 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.69 | C9orf72 |
Bryony Thompson STR: C9orf72 was added STR: C9orf72 was added to Early-onset Dementia. Sources: Expert list STR tags were added to STR: C9orf72. Mode of inheritance for STR: C9orf72 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: C9orf72 were set to 25577942 Phenotypes for STR: C9orf72 were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550 Review for STR: C9orf72 was set to GREEN STR: C9orf72 was marked as clinically relevant Added comment: NG_031977.1:g.5321GGGGCC[X] Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.207 | LAMA2 | Zornitza Stark Marked gene: LAMA2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.207 | LAMA2 | Zornitza Stark Gene: lama2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.207 | LAMA2 | Zornitza Stark Phenotypes for gene: LAMA2 were changed from to Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855; Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.206 | LAMA2 | Zornitza Stark Publications for gene: LAMA2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.205 | LAMA2 | Zornitza Stark Mode of inheritance for gene: LAMA2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.204 | LAMA2 | Zornitza Stark reviewed gene: LAMA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30055037; Phenotypes: Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855, Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.66 | LAMA2 | Zornitza Stark Marked gene: LAMA2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.66 | LAMA2 | Zornitza Stark Gene: lama2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.66 | LAMA2 | Zornitza Stark Phenotypes for gene: LAMA2 were changed from to Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855; Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.65 | LAMA2 | Zornitza Stark Publications for gene: LAMA2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.64 | LAMA2 | Zornitza Stark Mode of inheritance for gene: LAMA2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Muscular dystrophy and myopathy_Paediatric v0.63 | LAMA2 | Zornitza Stark reviewed gene: LAMA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30055037; Phenotypes: Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855, Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3961 | LAMA2 | Zornitza Stark Marked gene: LAMA2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3961 | LAMA2 | Zornitza Stark Gene: lama2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3961 | LAMA2 | Zornitza Stark Phenotypes for gene: LAMA2 were changed from to Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855; Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3960 | LAMA2 | Zornitza Stark Publications for gene: LAMA2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3959 | LAMA2 | Zornitza Stark Mode of inheritance for gene: LAMA2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3958 | LAMA2 | Zornitza Stark reviewed gene: LAMA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30055037; Phenotypes: Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855, Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.71 | LAMA2 | Zornitza Stark Phenotypes for gene: LAMA2 were changed from LAMA2-related muscular dystrophy to LAMA2-related muscular dystrophy; Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.70 | LAMA2 | Zornitza Stark reviewed gene: LAMA2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.107 | GRIN2B | Zornitza Stark Marked gene: GRIN2B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.107 | GRIN2B | Zornitza Stark Gene: grin2b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.107 | GRIN2B | Zornitza Stark Phenotypes for gene: GRIN2B were changed from to Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.106 | GRIN2B | Zornitza Stark Publications for gene: GRIN2B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.105 | GRIN2B | Zornitza Stark Mode of inheritance for gene: GRIN2B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autism v0.104 | GRIN2B | Zornitza Stark reviewed gene: GRIN2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28377535; Phenotypes: Mental retardation, autosomal dominant 6, MIM# 613970, Epileptic encephalopathy, early infantile, 27, MIM# 616139; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.810 | GRIN2B | Zornitza Stark Marked gene: GRIN2B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.810 | GRIN2B | Zornitza Stark Gene: grin2b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.810 | GRIN2B | Zornitza Stark Phenotypes for gene: GRIN2B were changed from to Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.809 | GRIN2B | Zornitza Stark Publications for gene: GRIN2B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.808 | GRIN2B | Zornitza Stark Mode of inheritance for gene: GRIN2B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.807 | GRIN2B | Zornitza Stark reviewed gene: GRIN2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28377535; Phenotypes: Mental retardation, autosomal dominant 6, MIM# 613970, Epileptic encephalopathy, early infantile, 27, MIM# 616139; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3958 | GRIN2B | Zornitza Stark Marked gene: GRIN2B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3958 | GRIN2B | Zornitza Stark Gene: grin2b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3958 | GRIN2B | Zornitza Stark Phenotypes for gene: GRIN2B were changed from to Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3957 | GRIN2B | Zornitza Stark Publications for gene: GRIN2B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3956 | GRIN2B | Zornitza Stark Mode of inheritance for gene: GRIN2B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3955 | GRIN2B | Zornitza Stark reviewed gene: GRIN2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28377535; Phenotypes: Mental retardation, autosomal dominant 6, MIM# 613970, Epileptic encephalopathy, early infantile, 27, MIM# 616139; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2888 | GRIN2B | Zornitza Stark Marked gene: GRIN2B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2888 | GRIN2B | Zornitza Stark Gene: grin2b has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2888 | GRIN2B | Zornitza Stark Phenotypes for gene: GRIN2B were changed from Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139 to Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2888 | GRIN2B | Zornitza Stark Phenotypes for gene: GRIN2B were changed from to Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2887 | GRIN2B | Zornitza Stark Publications for gene: GRIN2B were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2886 | GRIN2B | Zornitza Stark Mode of inheritance for gene: GRIN2B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2885 | GRIN2B | Zornitza Stark reviewed gene: GRIN2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28377535; Phenotypes: Mental retardation, autosomal dominant 6, MIM# 613970, Epileptic encephalopathy, early infantile, 27, MIM# 616139; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.139 | GRIN2B | Zornitza Stark Phenotypes for gene: GRIN2B were changed from GRIN2B-related neurodevelopmental disorder to GRIN2B-related neurodevelopmental disorder; Mental retardation, autosomal dominant 6, MIM# 613970 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.138 | GRIN2B | Zornitza Stark reviewed gene: GRIN2B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mental retardation, autosomal dominant 6, MIM# 613970; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia - complex v0.72 | GRIN1 | Zornitza Stark Marked gene: GRIN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia - complex v0.72 | GRIN1 | Zornitza Stark Gene: grin1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia - complex v0.72 | GRIN1 | Zornitza Stark Classified gene: GRIN1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia - complex v0.72 | GRIN1 | Zornitza Stark Gene: grin1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Dystonia - complex v0.71 | GRIN1 |
Zornitza Stark gene: GRIN1 was added gene: GRIN1 was added to Dystonia - complex. Sources: Expert list Mode of inheritance for gene: GRIN1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal Publications for gene: GRIN1 were set to 29365063; 27164704; 27164704; 28051072 Phenotypes for gene: GRIN1 were set to Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254; Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820 Review for gene: GRIN1 was set to GREEN Added comment: Over 20 individuals reported with de novo missense variants in GRIN1 and severe neurodevelopmental phenotype, comprising ID, seizures, and a movement disorder, in particular dystonia. Two families reported with bi-allelic variants: different mechanism postulated (LOF vs affecting channel functioning or hypomorphic alleles), parents were carriers and unaffected. Movement disorder, in particular dystonia also reported in bi-allelic cases. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3955 | GRIN1 | Zornitza Stark Marked gene: GRIN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3955 | GRIN1 | Zornitza Stark Gene: grin1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3955 | GRIN1 | Zornitza Stark Phenotypes for gene: GRIN1 were changed from to Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254; Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3954 | GRIN1 | Zornitza Stark Publications for gene: GRIN1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3953 | GRIN1 | Zornitza Stark Mode of inheritance for gene: GRIN1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3952 | GRIN1 | Zornitza Stark reviewed gene: GRIN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 29365063, 27164704, 27164704, 28051072; Phenotypes: Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254, Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.807 | GRIN1 | Zornitza Stark Marked gene: GRIN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.807 | GRIN1 | Zornitza Stark Gene: grin1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.807 | GRIN1 | Zornitza Stark Phenotypes for gene: GRIN1 were changed from to Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.806 | GRIN1 | Zornitza Stark Publications for gene: GRIN1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.805 | GRIN1 | Zornitza Stark Mode of inheritance for gene: GRIN1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.804 | GRIN1 | Zornitza Stark reviewed gene: GRIN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 29365063, 27164704; Phenotypes: Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2885 | GRIN1 | Zornitza Stark Marked gene: GRIN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2885 | GRIN1 | Zornitza Stark Gene: grin1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2885 | GRIN1 | Zornitza Stark Phenotypes for gene: GRIN1 were changed from to Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254; Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2884 | GRIN1 | Zornitza Stark Publications for gene: GRIN1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2883 | GRIN1 | Zornitza Stark Mode of inheritance for gene: GRIN1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2882 | GRIN1 | Zornitza Stark reviewed gene: GRIN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 29365063, 27164704, 27164704, 28051072; Phenotypes: Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254, Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.138 | GRIN1 | Zornitza Stark Marked gene: GRIN1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.138 | GRIN1 | Zornitza Stark Added comment: Comment when marking as ready: All variants occurred between residues 559 and 828, and there may be an association between variant location and PMG. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.138 | GRIN1 | Zornitza Stark Gene: grin1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.138 | GRIN1 | Zornitza Stark Phenotypes for gene: GRIN1 were changed from GRIN1-related neurodevelopmental disorder to Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2882 | HARS | Zornitza Stark Publications for gene: HARS were set to 32296180 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2881 | HARS | Zornitza Stark commented on gene: HARS: Please note this is the correct PMID for this disease association | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2881 | HARS | Zornitza Stark reviewed gene: HARS: Rating: AMBER; Mode of pathogenicity: None; Publications: 32333447; Phenotypes: multisystem ataxic syndrome, mild-severe intellectual disability; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - paediatric v0.222 | HARS | Zornitza Stark Publications for gene: HARS were set to 32296180 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - paediatric v0.221 | HARS | Zornitza Stark reviewed gene: HARS: Rating: AMBER; Mode of pathogenicity: None; Publications: 32333447; Phenotypes: multisystem ataxic syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ZNF674 |
Zornitza Stark gene: ZNF674 was added gene: ZNF674 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ZNF674 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: ZNF674 were set to Mental retardation |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ZNF252P |
Zornitza Stark gene: ZNF252P was added gene: ZNF252P was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ZNF252P was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ZNF252P were set to Hypothyroidism |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ZFPM2 |
Zornitza Stark gene: ZFPM2 was added gene: ZFPM2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ZFPM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ZFPM2 were set to Tetralogy of Fallot |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | YARS2 |
Zornitza Stark gene: YARS2 was added gene: YARS2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: YARS2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: YARS2 were set to Myopathy, lactic acidosis, and sideroblastic anemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | WRAP53 |
Zornitza Stark gene: WRAP53 was added gene: WRAP53 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: WRAP53 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: WRAP53 were set to Dyskeratosis congenita |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | WNT7A |
Zornitza Stark gene: WNT7A was added gene: WNT7A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: WNT7A was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: WNT7A were set to Ulna and fibula absence of with severe limb deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | WNT5A |
Zornitza Stark gene: WNT5A was added gene: WNT5A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: WNT5A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: WNT5A were set to Robinow syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | WNT3 |
Zornitza Stark gene: WNT3 was added gene: WNT3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: WNT3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: WNT3 were set to Tetra-amelia, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | WNK1 |
Zornitza Stark gene: WNK1 was added gene: WNK1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: WNK1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: WNK1 were set to Neuropathy, hereditary sensory and autonomic, type I |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | WDR36 |
Zornitza Stark gene: WDR36 was added gene: WDR36 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: WDR36 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: WDR36 were set to Glaucoma |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | WDR35 |
Zornitza Stark gene: WDR35 was added gene: WDR35 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: WDR35 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: WDR35 were set to Cranioectodermal dysplasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | WDR19 |
Zornitza Stark gene: WDR19 was added gene: WDR19 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: WDR19 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: WDR19 were set to Nephronophthisis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | VSX1 |
Zornitza Stark gene: VSX1 was added gene: VSX1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: VSX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: VSX1 were set to Keratoconus |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | VPS53 |
Zornitza Stark gene: VPS53 was added gene: VPS53 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: VPS53 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: VPS53 were set to Progressive cerebello-cerebral atrophy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | VAMP1 |
Zornitza Stark gene: VAMP1 was added gene: VAMP1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: VAMP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: VAMP1 were set to Spastic ataxia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | UQCRQ |
Zornitza Stark gene: UQCRQ was added gene: UQCRQ was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: UQCRQ was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: UQCRQ were set to Mitochondrial complex III deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | UQCRB |
Zornitza Stark gene: UQCRB was added gene: UQCRB was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: UQCRB was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: UQCRB were set to Mitochondrial complex III deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | UGT1A5 |
Zornitza Stark gene: UGT1A5 was added gene: UGT1A5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: UGT1A5 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: UGT1A5 were set to UDP glucuronosyltransferase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | UGT1A4 |
Zornitza Stark gene: UGT1A4 was added gene: UGT1A4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: UGT1A4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: UGT1A4 were set to Crigler-Najjar syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | UCP2 |
Zornitza Stark gene: UCP2 was added gene: UCP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: UCP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: UCP2 were set to Hyperinsulinism |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | UBA1 |
Zornitza Stark gene: UBA1 was added gene: UBA1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: UBA1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: UBA1 were set to Spinal muscular atrophy, X-linked infantile |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TUBA8 |
Zornitza Stark gene: TUBA8 was added gene: TUBA8 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: TUBA8 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TUBA8 were set to Polymicrogyria with optic nerve hypoplasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TTC21B |
Zornitza Stark gene: TTC21B was added gene: TTC21B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: TTC21B was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TTC21B were set to Bardet-Biedl syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TSPYL1 |
Zornitza Stark gene: TSPYL1 was added gene: TSPYL1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: TSPYL1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TSPYL1 were set to Sudden infant death with dysgenesis of the testes syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TSPEAR |
Zornitza Stark gene: TSPEAR was added gene: TSPEAR was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: TSPEAR was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TSPEAR were set to Sensorineural deafness |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TSFM |
Zornitza Stark gene: TSFM was added gene: TSFM was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: TSFM was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TSFM were set to Combined oxidative phosphorylation deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TRPM2 |
Zornitza Stark gene: TRPM2 was added gene: TRPM2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: TRPM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TRPM2 were set to ALS and Parkinson's disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TRIP11 |
Zornitza Stark gene: TRIP11 was added gene: TRIP11 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: TRIP11 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TRIP11 were set to Achondrogenesis type 1A |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TRHR |
Zornitza Stark gene: TRHR was added gene: TRHR was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: TRHR was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TRHR were set to Thyrotropin-releasing hormone resistance, generalized |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TRH |
Zornitza Stark gene: TRH was added gene: TRH was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: TRH was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TRH were set to Thyrotropin-releasing hormone deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TRDN |
Zornitza Stark gene: TRDN was added gene: TRDN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: TRDN was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TRDN were set to Catecholaminergic polymorphic ventricular tachycardia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TPRN |
Zornitza Stark gene: TPRN was added gene: TPRN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: TPRN was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TPRN were set to Deafness, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TNXB |
Zornitza Stark gene: TNXB was added gene: TNXB was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: TNXB was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TNXB were set to Ehlers-Danlos syndrome due to tenascin X deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TMPO |
Zornitza Stark gene: TMPO was added gene: TMPO was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: TMPO was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TMPO were set to Cardiomyopathy, dilated |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TMEM237 |
Zornitza Stark gene: TMEM237 was added gene: TMEM237 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: TMEM237 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TMEM237 were set to Joubert syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TMEM216 | Zornitza Stark Added phenotypes Meckel syndrome for gene: TMEM216 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TMEM216 |
Zornitza Stark gene: TMEM216 was added gene: TMEM216 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: TMEM216 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TMEM216 were set to Joubert syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TMC8 |
Zornitza Stark gene: TMC8 was added gene: TMC8 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: TMC8 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TMC8 were set to Epidermodysplasia verruciformi |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TJP2 |
Zornitza Stark gene: TJP2 was added gene: TJP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: TJP2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TJP2 were set to Hypercholanemia, familial |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | THBS1 |
Zornitza Stark gene: THBS1 was added gene: THBS1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: THBS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: THBS1 were set to Pulmonary hypertension |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | THBD |
Zornitza Stark gene: THBD was added gene: THBD was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: THBD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: THBD were set to Haemolytic uraemic syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TGIF1 |
Zornitza Stark gene: TGIF1 was added gene: TGIF1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: TGIF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TGIF1 were set to Holoprosencephaly-4 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TGFBR3 |
Zornitza Stark gene: TGFBR3 was added gene: TGFBR3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: TGFBR3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TGFBR3 were set to Premature ovarian failure |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TGFB3 |
Zornitza Stark gene: TGFB3 was added gene: TGFB3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: TGFB3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TGFB3 were set to Arrhythmogenic right ventricular dysplasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TGFB1 |
Zornitza Stark gene: TGFB1 was added gene: TGFB1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: TGFB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TGFB1 were set to Camurati-Engelmann disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TFR2 |
Zornitza Stark gene: TFR2 was added gene: TFR2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: TFR2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TFR2 were set to Hemochromatosis type 3 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TCTN3 |
Zornitza Stark gene: TCTN3 was added gene: TCTN3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: TCTN3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TCTN3 were set to Joubert syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TCTN1 |
Zornitza Stark gene: TCTN1 was added gene: TCTN1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: TCTN1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TCTN1 were set to Joubert syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TCAP |
Zornitza Stark Source BabySeq Category C gene was added to TCAP. Source Expert Review Red was added to TCAP. Added phenotypes Cardiomyopathy, dilated for gene: TCAP Rating Changed from Green List (high evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TBX20 |
Zornitza Stark gene: TBX20 was added gene: TBX20 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: TBX20 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TBX20 were set to Congenital heart disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TBCE |
Zornitza Stark gene: TBCE was added gene: TBCE was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: TBCE was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TBCE were set to Hypoparathyroidism retardation dysmorphism syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TARDBP |
Zornitza Stark gene: TARDBP was added gene: TARDBP was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: TARDBP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TARDBP were set to Amyotrophic lateral sclerosis type 10 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TAB2 |
Zornitza Stark gene: TAB2 was added gene: TAB2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: TAB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TAB2 were set to Congenital heart disease, nonsyndromic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SYT14 |
Zornitza Stark gene: SYT14 was added gene: SYT14 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SYT14 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SYT14 were set to Spinocerebellar ataxia, autosomal recessive 11 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SYNE4 |
Zornitza Stark gene: SYNE4 was added gene: SYNE4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SYNE4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SYNE4 were set to Hearing loss |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | STAC3 |
Zornitza Stark gene: STAC3 was added gene: STAC3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: STAC3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: STAC3 were set to Myopathy, Native American |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ST3GAL5 |
Zornitza Stark gene: ST3GAL5 was added gene: ST3GAL5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ST3GAL5 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ST3GAL5 were set to Amish infantile epilepsy syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ST14 |
Zornitza Stark gene: ST14 was added gene: ST14 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ST14 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ST14 were set to Ichthyosis hypotrichosis syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SPTLC2 |
Zornitza Stark gene: SPTLC2 was added gene: SPTLC2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SPTLC2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SPTLC2 were set to Neuropathy, hereditary sensory and autonomic, type IC |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SPEG |
Zornitza Stark gene: SPEG was added gene: SPEG was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SPEG was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SPEG were set to Centronuclear myopathy with dilated cardiomyopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SP7 |
Zornitza Stark gene: SP7 was added gene: SP7 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SP7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SP7 were set to Osteogenesis imperfecta, type XII |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SOX18 |
Zornitza Stark gene: SOX18 was added gene: SOX18 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SOX18 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SOX18 were set to Hypotrichosis-lymphedema-telangiectasia syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SOD1 |
Zornitza Stark gene: SOD1 was added gene: SOD1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SOD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SOD1 were set to Amyotrophic lateral sclerosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SNAP29 |
Zornitza Stark gene: SNAP29 was added gene: SNAP29 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SNAP29 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SNAP29 were set to Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SMO |
Zornitza Stark gene: SMO was added gene: SMO was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SMO was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SMO were set to Medulloblastoma |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SMAD9 |
Zornitza Stark gene: SMAD9 was added gene: SMAD9 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SMAD9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SMAD9 were set to Pulmonary arterial hypertension |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SMAD6 |
Zornitza Stark gene: SMAD6 was added gene: SMAD6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SMAD6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SMAD6 were set to Cardiovascular malformation, congenital |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SMAD1 |
Zornitza Stark gene: SMAD1 was added gene: SMAD1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SMAD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SMAD1 were set to Pulmonary arterial hypertension |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLCO1B3 |
Zornitza Stark gene: SLCO1B3 was added gene: SLCO1B3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SLCO1B3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLCO1B3 were set to Hyperbilirubinemia, Rotor type, digenic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLCO1B1 |
Zornitza Stark gene: SLCO1B1 was added gene: SLCO1B1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SLCO1B1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLCO1B1 were set to Hyperbilirubinemia, Rotor type, digenic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC9A3R1 |
Zornitza Stark gene: SLC9A3R1 was added gene: SLC9A3R1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SLC9A3R1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SLC9A3R1 were set to Nephrolithiasis/osteoporosis, hypophosphatemic, 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC6A2 |
Zornitza Stark gene: SLC6A2 was added gene: SLC6A2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SLC6A2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SLC6A2 were set to Orthostatic intolerance |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC6A19 |
Zornitza Stark gene: SLC6A19 was added gene: SLC6A19 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SLC6A19 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC6A19 were set to Hartnup disorder |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC4A4 |
Zornitza Stark gene: SLC4A4 was added gene: SLC4A4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SLC4A4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC4A4 were set to Renal tubular acidosis, proximal, with ocular abnormalities |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC4A10 |
Zornitza Stark gene: SLC4A10 was added gene: SLC4A10 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SLC4A10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SLC4A10 were set to Epilepsy & mental retardation |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC41A1 |
Zornitza Stark gene: SLC41A1 was added gene: SLC41A1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SLC41A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SLC41A1 were set to Parkinson disease, idiopathic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC35C1 |
Zornitza Stark gene: SLC35C1 was added gene: SLC35C1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SLC35C1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC35C1 were set to Congenital disorder of glycosylation 2c |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC35A2 |
Zornitza Stark gene: SLC35A2 was added gene: SLC35A2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SLC35A2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: SLC35A2 were set to Early-onset epileptic encephalopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC35A1 |
Zornitza Stark gene: SLC35A1 was added gene: SLC35A1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SLC35A1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC35A1 were set to CDG syndrome type IIf |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC33A1 |
Zornitza Stark Mode of inheritance for gene SLC33A1 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Added phenotypes Spastic paraplegia, autosomal dominant for gene: SLC33A1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC33A1 |
Zornitza Stark gene: SLC33A1 was added gene: SLC33A1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SLC33A1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC33A1 were set to Congenital cataracts, hearing loss and low serum copper and ceruloplasmin |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC27A5 |
Zornitza Stark gene: SLC27A5 was added gene: SLC27A5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SLC27A5 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC27A5 were set to Bile acid amidation defect |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC25A22 |
Zornitza Stark gene: SLC25A22 was added gene: SLC25A22 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SLC25A22 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC25A22 were set to Early myoclonic encephalopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC25A12 |
Zornitza Stark gene: SLC25A12 was added gene: SLC25A12 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SLC25A12 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC25A12 were set to Hypomyelination, global cerebral |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC16A12 |
Zornitza Stark gene: SLC16A12 was added gene: SLC16A12 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SLC16A12 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SLC16A12 were set to Cataract, juvenile with microcornea and renal glucosuria |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC16A1 |
Zornitza Stark gene: SLC16A1 was added gene: SLC16A1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SLC16A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SLC16A1 were set to Monocarboxylate transporter 1 deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC12A5 |
Zornitza Stark gene: SLC12A5 was added gene: SLC12A5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SLC12A5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SLC12A5 were set to Febrile seizures |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC11A2 |
Zornitza Stark gene: SLC11A2 was added gene: SLC11A2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SLC11A2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC11A2 were set to Anemia, hypochromic microcytic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SIX5 |
Zornitza Stark gene: SIX5 was added gene: SIX5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SIX5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SIX5 were set to Branchiootorenal syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SIX2 |
Zornitza Stark gene: SIX2 was added gene: SIX2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SIX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SIX2 were set to Renal hypodysplasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SHOC2 |
Zornitza Stark gene: SHOC2 was added gene: SHOC2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SHOC2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SHOC2 were set to Noonan-like syndrome with loose anagen hair |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SH3BP2 |
Zornitza Stark gene: SH3BP2 was added gene: SH3BP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SH3BP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SH3BP2 were set to Cherubism |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SGCD |
Zornitza Stark Source BabySeq Category C gene was added to SGCD. Source Expert Review Red was added to SGCD. Added phenotypes Cardiomyopathy, dilated for gene: SGCD Rating Changed from Green List (high evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SFTPC |
Zornitza Stark gene: SFTPC was added gene: SFTPC was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SFTPC was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SFTPC were set to Interstitial lung disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SFTPA2 |
Zornitza Stark gene: SFTPA2 was added gene: SFTPA2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SFTPA2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SFTPA2 were set to Pulmonary fibrosis, idiopathic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SERPIND1 |
Zornitza Stark gene: SERPIND1 was added gene: SERPIND1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SERPIND1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SERPIND1 were set to Heparin cofactor 2 deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SERPINC1 |
Zornitza Stark gene: SERPINC1 was added gene: SERPINC1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SERPINC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SERPINC1 were set to Thrombophilia due to antithrombin III deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SERPINB6 |
Zornitza Stark gene: SERPINB6 was added gene: SERPINB6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SERPINB6 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SERPINB6 were set to Deafness, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SERPINA1 |
Zornitza Stark gene: SERPINA1 was added gene: SERPINA1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SERPINA1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SERPINA1 were set to Antitrypsin alpha 1 deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SEMA3A |
Zornitza Stark gene: SEMA3A was added gene: SEMA3A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SEMA3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SEMA3A were set to Kallmann syndrome 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SEC63 |
Zornitza Stark gene: SEC63 was added gene: SEC63 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SEC63 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SEC63 were set to Polycystic liver disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SCP2 |
Zornitza Stark gene: SCP2 was added gene: SCP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SCP2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SCP2 were set to Leukoencephalopathy - dystonia - motor neuropathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SCO1 |
Zornitza Stark gene: SCO1 was added gene: SCO1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SCO1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SCO1 were set to Hepatic failure, early onset, and neurologic disorder |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SCNN1G |
Zornitza Stark gene: SCNN1G was added gene: SCNN1G was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SCNN1G was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SCNN1G were set to Pseudohypoaldosteronism |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SCNN1B |
Zornitza Stark Source BabySeq Category C gene was added to SCNN1B. Source Expert Review Red was added to SCNN1B. Mode of inheritance for gene SCNN1B was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Added phenotypes Liddle syndrome for gene: SCNN1B Rating Changed from Green List (high evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SCN4B |
Zornitza Stark gene: SCN4B was added gene: SCN4B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SCN4B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SCN4B were set to Long QT syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SCN4A |
Zornitza Stark Source BabySeq Category C gene was added to SCN4A. Source Expert Review Red was added to SCN4A. Added phenotypes Hypokalemic periodic paralysis, type 2 for gene: SCN4A Rating Changed from Green List (high evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SCN3B |
Zornitza Stark gene: SCN3B was added gene: SCN3B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SCN3B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SCN3B were set to Brugada syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SCN2B |
Zornitza Stark gene: SCN2B was added gene: SCN2B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SCN2B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SCN2B were set to Atrial fibrillation |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SCN1B |
Zornitza Stark gene: SCN1B was added gene: SCN1B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SCN1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SCN1B were set to Brugada syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SC5D |
Zornitza Stark gene: SC5D was added gene: SC5D was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: SC5D was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SC5D were set to Lathosterolosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RYR1 |
Zornitza Stark Source BabySeq Category C gene was added to RYR1. Source Expert Review Red was added to RYR1. Mode of inheritance for gene RYR1 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BIALLELIC, autosomal or pseudoautosomal Added phenotypes Congenital fiber type disproportion for gene: RYR1 Rating Changed from Amber List (moderate evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RPS7 |
Zornitza Stark gene: RPS7 was added gene: RPS7 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: RPS7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: RPS7 were set to Diamond-Blackfan anemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RPS10 |
Zornitza Stark gene: RPS10 was added gene: RPS10 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: RPS10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: RPS10 were set to Diamond-Blackfan anemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RPL35A |
Zornitza Stark gene: RPL35A was added gene: RPL35A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: RPL35A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: RPL35A were set to Diamond-Blackfan anemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RHAG |
Zornitza Stark gene: RHAG was added gene: RHAG was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: RHAG was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: RHAG were set to Rh-deficiency syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RFX6 |
Zornitza Stark gene: RFX6 was added gene: RFX6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: RFX6 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: RFX6 were set to Diabetes, neonatal, with intestinal atresia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RELN |
Zornitza Stark gene: RELN was added gene: RELN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: RELN was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: RELN were set to Lissencephaly syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RDX |
Zornitza Stark gene: RDX was added gene: RDX was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: RDX was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: RDX were set to Deafness, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RANGRF |
Zornitza Stark gene: RANGRF was added gene: RANGRF was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: RANGRF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: RANGRF were set to Brugada syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RAD51B |
Zornitza Stark gene: RAD51B was added gene: RAD51B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: RAD51B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: RAD51B were set to Breast and/or ovarian cancer |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RAB3GAP2 |
Zornitza Stark gene: RAB3GAP2 was added gene: RAB3GAP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: RAB3GAP2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: RAB3GAP2 were set to Warburg micro syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RAB10 |
Zornitza Stark gene: RAB10 was added gene: RAB10 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: RAB10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: RAB10 were set to Congenital heart disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NECTIN1 |
Zornitza Stark gene: NECTIN1 was added gene: NECTIN1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: NECTIN1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NECTIN1 were set to Cleft lip / palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PSEN2 |
Zornitza Stark gene: PSEN2 was added gene: PSEN2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: PSEN2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PSEN2 were set to Alzheimer disease, type 4 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PSEN1 |
Zornitza Stark gene: PSEN1 was added gene: PSEN1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: PSEN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PSEN1 were set to Alzheimer disease, type 3 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PSAT1 |
Zornitza Stark gene: PSAT1 was added gene: PSAT1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: PSAT1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PSAT1 were set to Phosphoserine aminotransferase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PRRX1 |
Zornitza Stark gene: PRRX1 was added gene: PRRX1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: PRRX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PRRX1 were set to Agnathia-otocephaly complex |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PRPS1 | Zornitza Stark Added phenotypes Charcot-Marie-Tooth disease for gene: PRPS1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PRPS1 |
Zornitza Stark gene: PRPS1 was added gene: PRPS1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: PRPS1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: PRPS1 were set to Arts syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PRODH |
Zornitza Stark gene: PRODH was added gene: PRODH was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: PRODH was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PRODH were set to Hyperprolinemia, type I |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PRKCSH |
Zornitza Stark gene: PRKCSH was added gene: PRKCSH was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: PRKCSH was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PRKCSH were set to Polycystic liver disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PRKAG2 |
Zornitza Stark Source BabySeq Category C gene was added to PRKAG2. Source Expert Review Red was added to PRKAG2. Added phenotypes Glycogen storage disease of heart, lethal congenital for gene: PRKAG2 Rating Changed from Amber List (moderate evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PRICKLE1 |
Zornitza Stark gene: PRICKLE1 was added gene: PRICKLE1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: PRICKLE1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PRICKLE1 were set to Epilepsy, progressive myoclonic 1B |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PREPL |
Zornitza Stark gene: PREPL was added gene: PREPL was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: PREPL was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PREPL were set to Hypotonia - cystinuria syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PRDM16 |
Zornitza Stark gene: PRDM16 was added gene: PRDM16 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: PRDM16 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PRDM16 were set to Left ventricular noncompaction |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PPOX |
Zornitza Stark gene: PPOX was added gene: PPOX was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: PPOX was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PPOX were set to Porphyria variegata |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | POMC |
Zornitza Stark gene: POMC was added gene: POMC was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: POMC was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: POMC were set to Proopiomelanocortin deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PODXL |
Zornitza Stark gene: PODXL was added gene: PODXL was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: PODXL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PODXL were set to Focal and segmental glomerulosclerosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PNPLA1 |
Zornitza Stark gene: PNPLA1 was added gene: PNPLA1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: PNPLA1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PNPLA1 were set to Ichthyosis, autosomal recessive congenital |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PMS2 |
Zornitza Stark gene: PMS2 was added gene: PMS2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: PMS2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PMS2 were set to Lynch syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PLOD2 |
Zornitza Stark gene: PLOD2 was added gene: PLOD2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: PLOD2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PLOD2 were set to Bruck syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PLN |
Zornitza Stark Source BabySeq Category C gene was added to PLN. Source Expert Review Red was added to PLN. Added phenotypes Cardiomyopathy, familial hypertrophic for gene: PLN Rating Changed from Amber List (moderate evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PIGA |
Zornitza Stark gene: PIGA was added gene: PIGA was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: PIGA was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: PIGA were set to Epileptic encephalopathy, early-onset |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PHOX2A |
Zornitza Stark gene: PHOX2A was added gene: PHOX2A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: PHOX2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PHOX2A were set to Fibrosis of extraocular muscles, congenital |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PHKA1 |
Zornitza Stark gene: PHKA1 was added gene: PHKA1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: PHKA1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: PHKA1 were set to Phosphorylase kinase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PEX19 |
Zornitza Stark gene: PEX19 was added gene: PEX19 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: PEX19 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PEX19 were set to Zellweger syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PEX16 |
Zornitza Stark gene: PEX16 was added gene: PEX16 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: PEX16 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PEX16 were set to Zellweger syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PEX14 |
Zornitza Stark gene: PEX14 was added gene: PEX14 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: PEX14 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PEX14 were set to Zellweger syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PEX11B |
Zornitza Stark gene: PEX11B was added gene: PEX11B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: PEX11B was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PEX11B were set to Peroxisome biogenesis disorder |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PDSS2 |
Zornitza Stark gene: PDSS2 was added gene: PDSS2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: PDSS2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PDSS2 were set to Leigh syndrome with nephropathy and COQ10 deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PDSS1 |
Zornitza Stark gene: PDSS1 was added gene: PDSS1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: PDSS1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PDSS1 were set to Deafness - encephaloneuropathy - obesity - valvulopathy Neonatal |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PDP1 |
Zornitza Stark gene: PDP1 was added gene: PDP1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: PDP1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PDP1 were set to Pyruvate dehydrogenase phosphatase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PDLIM3 |
Zornitza Stark gene: PDLIM3 was added gene: PDLIM3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: PDLIM3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PDLIM3 were set to Cardiomyopathy, dilated |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PDE11A |
Zornitza Stark gene: PDE11A was added gene: PDE11A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: PDE11A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PDE11A were set to Adrenocortical hyperplasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PALB2 |
Zornitza Stark gene: PALB2 was added gene: PALB2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: PALB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PALB2 were set to Breast cancer |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PABPN1 |
Zornitza Stark gene: PABPN1 was added gene: PABPN1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: PABPN1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PABPN1 were set to Oculopharyngeal muscular dystrophy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | P2RX2 |
Zornitza Stark gene: P2RX2 was added gene: P2RX2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: P2RX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: P2RX2 were set to Hearing loss |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | OTUD4 |
Zornitza Stark gene: OTUD4 was added gene: OTUD4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: OTUD4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: OTUD4 were set to Hypogonadotropic hypogonadism, ataxia & dementia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | OTOG |
Zornitza Stark gene: OTOG was added gene: OTOG was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: OTOG was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: OTOG were set to Deafness, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ORC6 |
Zornitza Stark gene: ORC6 was added gene: ORC6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ORC6 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ORC6 were set to Meier-Gorlin syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ORC4 |
Zornitza Stark gene: ORC4 was added gene: ORC4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ORC4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ORC4 were set to Meier-Gorlin syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | OPA3 |
Zornitza Stark Source BabySeq Category C gene was added to OPA3. Source Expert Review Red was added to OPA3. Mode of inheritance for gene OPA3 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Added phenotypes Optic atrophy 3 with cataract for gene: OPA3 Rating Changed from Green List (high evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NUP62 |
Zornitza Stark gene: NUP62 was added gene: NUP62 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: NUP62 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NUP62 were set to Striatonigral degeneration, infantile |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NUP155 |
Zornitza Stark gene: NUP155 was added gene: NUP155 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: NUP155 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NUP155 were set to Atrial fibrillation |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NUB1 |
Zornitza Stark gene: NUB1 was added gene: NUB1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: NUB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: NUB1 were set to Congenital heart disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NTRK1 |
Zornitza Stark Source BabySeq Category C gene was added to NTRK1. Source Expert Review Red was added to NTRK1. Mode of inheritance for gene NTRK1 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Added phenotypes Medullary thyroid carcinoma, familial for gene: NTRK1 Rating Changed from Green List (high evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NSDHL |
Zornitza Stark Source BabySeq Category C gene was added to NSDHL. Source Expert Review Red was added to NSDHL. Added phenotypes CK syndrome for gene: NSDHL Rating Changed from Green List (high evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NRXN1 |
Zornitza Stark gene: NRXN1 was added gene: NRXN1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: NRXN1 was set to Unknown Phenotypes for gene: NRXN1 were set to Autism |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NRG1 |
Zornitza Stark gene: NRG1 was added gene: NRG1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: NRG1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: NRG1 were set to Hirschsprung disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NR1H4 |
Zornitza Stark gene: NR1H4 was added gene: NR1H4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: NR1H4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NR1H4 were set to Cholestasis, infantile |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NPPA |
Zornitza Stark gene: NPPA was added gene: NPPA was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: NPPA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: NPPA were set to Atrial fibrillation |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NOTCH1 |
Zornitza Stark gene: NOTCH1 was added gene: NOTCH1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: NOTCH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: NOTCH1 were set to Aortic valve disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NOP10 |
Zornitza Stark gene: NOP10 was added gene: NOP10 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: NOP10 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NOP10 were set to Dyskeratosis congenita |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NME8 |
Zornitza Stark gene: NME8 was added gene: NME8 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: NME8 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NME8 were set to Ciliary dyskinesia, primary |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NLRP7 |
Zornitza Stark gene: NLRP7 was added gene: NLRP7 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: NLRP7 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NLRP7 were set to Hydatidiform mole |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NLGN4X |
Zornitza Stark gene: NLGN4X was added gene: NLGN4X was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: NLGN4X was set to Unknown Phenotypes for gene: NLGN4X were set to Autism |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NLGN3 |
Zornitza Stark gene: NLGN3 was added gene: NLGN3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: NLGN3 was set to Unknown Phenotypes for gene: NLGN3 were set to Autism |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NKX3-2 |
Zornitza Stark gene: NKX3-2 was added gene: NKX3-2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: NKX3-2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NKX3-2 were set to Spondylo-megaepiphyseal-metaphyseal dysplasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NIN |
Zornitza Stark gene: NIN was added gene: NIN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: NIN was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NIN were set to Seckel syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NHP2 |
Zornitza Stark gene: NHP2 was added gene: NHP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: NHP2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NHP2 were set to Dyskeratosis congenita |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NFATC1 |
Zornitza Stark gene: NFATC1 was added gene: NFATC1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: NFATC1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NFATC1 were set to Congenital heart disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NEXN | Zornitza Stark Added phenotypes Cardiomyopathy, familial hypertrophic for gene: NEXN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NEXN |
Zornitza Stark gene: NEXN was added gene: NEXN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: NEXN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: NEXN were set to Cardiomyopathy, dilated |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NEUROG3 |
Zornitza Stark gene: NEUROG3 was added gene: NEUROG3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: NEUROG3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NEUROG3 were set to Diarrhea 4, malabsorptive, congenital |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NEK8 |
Zornitza Stark gene: NEK8 was added gene: NEK8 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: NEK8 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NEK8 were set to Nephronophthisis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NEK1 |
Zornitza Stark gene: NEK1 was added gene: NEK1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: NEK1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NEK1 were set to Short rib-polydactyly syndorme, type II |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NEDD4L |
Zornitza Stark gene: NEDD4L was added gene: NEDD4L was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: NEDD4L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: NEDD4L were set to Epilepsy, photosensitive generalised |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NEBL |
Zornitza Stark gene: NEBL was added gene: NEBL was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: NEBL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: NEBL were set to Cardiomyopathy, dilated |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NCF4 |
Zornitza Stark gene: NCF4 was added gene: NCF4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: NCF4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NCF4 were set to Chronic granulomatous disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NAA15 |
Zornitza Stark gene: NAA15 was added gene: NAA15 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: NAA15 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: NAA15 were set to Congenital heart disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NAA10 |
Zornitza Stark gene: NAA10 was added gene: NAA10 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: NAA10 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: NAA10 were set to N-terminal acetyltransferase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYPN | Zornitza Stark Added phenotypes Cardiomyopathy, hypertrophic for gene: MYPN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYPN |
Zornitza Stark gene: MYPN was added gene: MYPN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MYPN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MYPN were set to Cardiomyopathy, dilated |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYOZ2 |
Zornitza Stark gene: MYOZ2 was added gene: MYOZ2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MYOZ2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MYOZ2 were set to Cardiomyopathy, hypertrophic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYOT |
Zornitza Stark gene: MYOT was added gene: MYOT was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MYOT was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MYOT were set to Myofibrillar myopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYOM1 |
Zornitza Stark gene: MYOM1 was added gene: MYOM1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MYOM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MYOM1 were set to Cardiomyopathy, hypertrophic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYO5A |
Zornitza Stark gene: MYO5A was added gene: MYO5A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MYO5A was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MYO5A were set to Griscelli syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYO1F |
Zornitza Stark gene: MYO1F was added gene: MYO1F was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MYO1F was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MYO1F were set to Sensorineural hearing loss |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYO1E |
Zornitza Stark gene: MYO1E was added gene: MYO1E was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MYO1E was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MYO1E were set to Focal segmental glomerulosclerosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYO1C |
Zornitza Stark gene: MYO1C was added gene: MYO1C was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MYO1C was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MYO1C were set to Sensorineural hearing loss |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYLK2 |
Zornitza Stark gene: MYLK2 was added gene: MYLK2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MYLK2 was set to Unknown Phenotypes for gene: MYLK2 were set to Cardiomyopathy, hypertrophic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYH7 | Zornitza Stark Added phenotypes Congenital fiber type disproportion for gene: MYH7 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYH7 |
Zornitza Stark Source BabySeq Category C gene was added to MYH7. Source Expert Review Red was added to MYH7. Added phenotypes Scapuloperoneal syndrome, myopathic type for gene: MYH7 Rating Changed from Amber List (moderate evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYH6 | Zornitza Stark Added phenotypes Cardiomyopathy, familial hypertrophic for gene: MYH6 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYH6 | Zornitza Stark Added phenotypes Cardiomyopathy, dilated for gene: MYH6 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYH6 |
Zornitza Stark gene: MYH6 was added gene: MYH6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MYH6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MYH6 were set to Atrial septal defect |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYBPC3 |
Zornitza Stark Source BabySeq Category C gene was added to MYBPC3. Source Expert Review Red was added to MYBPC3. Added phenotypes Cardiomyopathy, dilated for gene: MYBPC3 Rating Changed from Amber List (moderate evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYBPC1 |
Zornitza Stark gene: MYBPC1 was added gene: MYBPC1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MYBPC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MYBPC1 were set to Distal arthrogryposis type I |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CAVIN4 |
Zornitza Stark gene: CAVIN4 was added gene: CAVIN4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CAVIN4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CAVIN4 were set to Cardiomyopathy, dilated |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MUC5B |
Zornitza Stark gene: MUC5B was added gene: MUC5B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MUC5B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MUC5B were set to Pulmonary fibrosis, idiopathic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MTO1 |
Zornitza Stark gene: MTO1 was added gene: MTO1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MTO1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MTO1 were set to Hypertrophic cardiomyopathy & lactic acidosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MT-ND6 |
Zornitza Stark gene: MT-ND6 was added gene: MT-ND6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene gene: MT-ND6 was set to MITOCHONDRIAL Phenotypes for gene: MT-ND6 were set to Leber hereditary optic neuropathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MT-ND4 |
Zornitza Stark gene: MT-ND4 was added gene: MT-ND4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene gene: MT-ND4 was set to MITOCHONDRIAL Phenotypes for gene: MT-ND4 were set to Leber hereditary optic neuropathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MT-ND1 |
Zornitza Stark gene: MT-ND1 was added gene: MT-ND1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene gene: MT-ND1 was set to MITOCHONDRIAL Phenotypes for gene: MT-ND1 were set to Leber hereditary optic neuropathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MSRB3 |
Zornitza Stark gene: MSRB3 was added gene: MSRB3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MSRB3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MSRB3 were set to Deafness, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MSH6 |
Zornitza Stark gene: MSH6 was added gene: MSH6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MSH6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MSH6 were set to Lynch syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MSH2 |
Zornitza Stark gene: MSH2 was added gene: MSH2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MSH2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MSH2 were set to Lynch syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MRPS22 |
Zornitza Stark gene: MRPS22 was added gene: MRPS22 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MRPS22 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MRPS22 were set to Mitochondrial respiratory chain disorder |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MRPS16 |
Zornitza Stark gene: MRPS16 was added gene: MRPS16 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MRPS16 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MRPS16 were set to Mitochondrial respiratory chain disorder |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MPDU1 |
Zornitza Stark gene: MPDU1 was added gene: MPDU1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MPDU1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MPDU1 were set to Congenital disorder of glycosylation, type If |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MOGS |
Zornitza Stark gene: MOGS was added gene: MOGS was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MOGS was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MOGS were set to Glucosidase 1 deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MLPH |
Zornitza Stark gene: MLPH was added gene: MLPH was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MLPH was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MLPH were set to Griscelli syndrome type 3 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MLH1 |
Zornitza Stark gene: MLH1 was added gene: MLH1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MLH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MLH1 were set to Lynch syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MIR96 |
Zornitza Stark gene: MIR96 was added gene: MIR96 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MIR96 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MIR96 were set to Hearing loss |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MIB1 |
Zornitza Stark gene: MIB1 was added gene: MIB1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MIB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MIB1 were set to Left ventricular noncompaction |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MGAT2 |
Zornitza Stark gene: MGAT2 was added gene: MGAT2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MGAT2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MGAT2 were set to CDG syndrome type IIa |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MESP2 |
Zornitza Stark gene: MESP2 was added gene: MESP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MESP2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MESP2 were set to Spondylocostal dysostosis, autosomal recessive 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MED25 |
Zornitza Stark gene: MED25 was added gene: MED25 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MED25 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MED25 were set to Charcot-Marie-Tooth disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MED20 |
Zornitza Stark gene: MED20 was added gene: MED20 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MED20 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MED20 were set to Congenital heart disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MED13L |
Zornitza Stark gene: MED13L was added gene: MED13L was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MED13L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MED13L were set to Transposition of great arteries |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MCEE |
Zornitza Stark gene: MCEE was added gene: MCEE was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MCEE was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MCEE were set to Methylmalonyl-CoA epimerase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MATN4 |
Zornitza Stark gene: MATN4 was added gene: MATN4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MATN4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MATN4 were set to Multiple anomalies |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MAT1A |
Zornitza Stark gene: MAT1A was added gene: MAT1A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MAT1A was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MAT1A were set to Methionine adenosyltransferase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MAPT |
Zornitza Stark gene: MAPT was added gene: MAPT was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MAPT was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MAPT were set to Dementia, frontotemporal, with or without parkinsonism |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MAPK10 |
Zornitza Stark gene: MAPK10 was added gene: MAPK10 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: MAPK10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MAPK10 were set to Epileptic encephalopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LYZ |
Zornitza Stark gene: LYZ was added gene: LYZ was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: LYZ was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: LYZ were set to Amyloidosis, systemic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LUM |
Zornitza Stark gene: LUM was added gene: LUM was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: LUM was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: LUM were set to Amyotrophic lateral sclerosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LRRK2 |
Zornitza Stark gene: LRRK2 was added gene: LRRK2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: LRRK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: LRRK2 were set to Parkinson disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LPP |
Zornitza Stark gene: LPP was added gene: LPP was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: LPP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: LPP were set to Tetralogy of Fallot |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LPIN2 |
Zornitza Stark gene: LPIN2 was added gene: LPIN2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: LPIN2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: LPIN2 were set to Majeed syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LMNB2 |
Zornitza Stark gene: LMNB2 was added gene: LMNB2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: LMNB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: LMNB2 were set to Lipodystrophy, partial |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LHB |
Zornitza Stark gene: LHB was added gene: LHB was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: LHB was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: LHB were set to Hypogonadism |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LGI1 |
Zornitza Stark gene: LGI1 was added gene: LGI1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: LGI1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: LGI1 were set to Epilepsy, familial temporal lobe, 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LDB3 |
Zornitza Stark gene: LDB3 was added gene: LDB3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: LDB3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: LDB3 were set to Myofibrillar myopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LBR |
Zornitza Stark Source BabySeq Category C gene was added to LBR. Source Expert Review Red was added to LBR. Mode of inheritance for gene LBR was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Added phenotypes Reynolds syndrome for gene: LBR Rating Changed from Green List (high evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LARS2 |
Zornitza Stark gene: LARS2 was added gene: LARS2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: LARS2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: LARS2 were set to Perrault syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LARS |
Zornitza Stark gene: LARS was added gene: LARS was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: LARS was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: LARS were set to Infantile liver failure syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LAMA4 |
Zornitza Stark gene: LAMA4 was added gene: LAMA4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: LAMA4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: LAMA4 were set to Cardiomyopathy, dilated |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KRT8 |
Zornitza Stark gene: KRT8 was added gene: KRT8 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: KRT8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KRT8 were set to Cirrhosis, cryptogenic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KRT6B |
Zornitza Stark gene: KRT6B was added gene: KRT6B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: KRT6B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KRT6B were set to Pachyonychia congenita |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KRT18 |
Zornitza Stark gene: KRT18 was added gene: KRT18 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: KRT18 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KRT18 were set to Cirrhosis, cryptogenic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KPTN |
Zornitza Stark gene: KPTN was added gene: KPTN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: KPTN was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: KPTN were set to Macrocephaly, neurodevelopmental delay, and seizures |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KLF1 |
Zornitza Stark gene: KLF1 was added gene: KLF1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: KLF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KLF1 were set to Anemia, dyserythropoietic congenital, type IV |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KIF22 |
Zornitza Stark gene: KIF22 was added gene: KIF22 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: KIF22 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KIF22 were set to Spondyloepimetaphyseal dysplasia with joint laxity, type 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KIF1B |
Zornitza Stark gene: KIF1B was added gene: KIF1B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: KIF1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KIF1B were set to Charcot-Marie-Tooth disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KIF1BP |
Zornitza Stark gene: KIF1BP was added gene: KIF1BP was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: KIF1BP was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: KIF1BP were set to Goldberg-Shprintzen megacolon syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KDM5B |
Zornitza Stark gene: KDM5B was added gene: KDM5B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: KDM5B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KDM5B were set to Congenital heart disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KCNQ3 |
Zornitza Stark gene: KCNQ3 was added gene: KCNQ3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: KCNQ3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KCNQ3 were set to Epilepsy, benign neonatal |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KCNQ2 |
Zornitza Stark gene: KCNQ2 was added gene: KCNQ2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: KCNQ2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KCNQ2 were set to Epilepsy, benign neonatal |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KCNQ1OT1 |
Zornitza Stark gene: KCNQ1OT1 was added gene: KCNQ1OT1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: KCNQ1OT1 was set to Unknown Phenotypes for gene: KCNQ1OT1 were set to Beckwith-Wiedemann syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KCNJ8 |
Zornitza Stark gene: KCNJ8 was added gene: KCNJ8 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: KCNJ8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KCNJ8 were set to Sudden infant death syndrom |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KCNJ5 |
Zornitza Stark gene: KCNJ5 was added gene: KCNJ5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: KCNJ5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KCNJ5 were set to Long QT syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KCNJ18 |
Zornitza Stark gene: KCNJ18 was added gene: KCNJ18 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: KCNJ18 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KCNJ18 were set to Hypokalaemic periodic paralysis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KCNE3 |
Zornitza Stark gene: KCNE3 was added gene: KCNE3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: KCNE3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KCNE3 were set to Brugada syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KCNE5 |
Zornitza Stark gene: KCNE5 was added gene: KCNE5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: KCNE5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KCNE5 were set to Atrial fibrillation |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KCND3 |
Zornitza Stark gene: KCND3 was added gene: KCND3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: KCND3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KCND3 were set to Brugada syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KARS | Zornitza Stark Added phenotypes Hearing loss for gene: KARS | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KARS |
Zornitza Stark gene: KARS was added gene: KARS was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: KARS was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: KARS were set to Charcot-Marie-Tooth disease, recessive intermediate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | JPH2 |
Zornitza Stark gene: JPH2 was added gene: JPH2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: JPH2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: JPH2 were set to Cardiomyopathy, hypertrophic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | IYD |
Zornitza Stark gene: IYD was added gene: IYD was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: IYD was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: IYD were set to Thyroid dyshormonogenesis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ITGA7 |
Zornitza Stark gene: ITGA7 was added gene: ITGA7 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ITGA7 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ITGA7 were set to Congenital muscular dystrophy with integrin deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ITGA6 |
Zornitza Stark gene: ITGA6 was added gene: ITGA6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ITGA6 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ITGA6 were set to Epidermolysis bullosa, junctional, with pyloric stenosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ITGA3 |
Zornitza Stark gene: ITGA3 was added gene: ITGA3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ITGA3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ITGA3 were set to Interstitial lung disease, nephrotic syndrome, and epidermolysis bullosa, congenital |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ISL1 |
Zornitza Stark gene: ISL1 was added gene: ISL1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ISL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ISL1 were set to Diabetes, type 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ISCU |
Zornitza Stark gene: ISCU was added gene: ISCU was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ISCU was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ISCU were set to Myopathy with defiency of succinate dehydrogenase |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | IRS1 |
Zornitza Stark gene: IRS1 was added gene: IRS1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: IRS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: IRS1 were set to Diabetes mellitus, noninsulin dependent |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | IRF6 |
Zornitza Stark Source BabySeq Category C gene was added to IRF6. Source Expert Review Red was added to IRF6. Added phenotypes Popliteal pterygium syndrome for gene: IRF6 Rating Changed from Green List (high evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ILK |
Zornitza Stark gene: ILK was added gene: ILK was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ILK was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ILK were set to Cardiomyopathy, dilated |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | IL10RB |
Zornitza Stark gene: IL10RB was added gene: IL10RB was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: IL10RB was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: IL10RB were set to Inflammatory bowel disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | IGF1 |
Zornitza Stark gene: IGF1 was added gene: IGF1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: IGF1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: IGF1 were set to Insulin-like growth factor deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | IGBP1 |
Zornitza Stark gene: IGBP1 was added gene: IGBP1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: IGBP1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: IGBP1 were set to Agenesis of the corpus callosum - intellectual deficit - coloboma - micrognathia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | IFT80 |
Zornitza Stark gene: IFT80 was added gene: IFT80 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: IFT80 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: IFT80 were set to Asphyxiating thoracic dystrophy 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | IFT43 |
Zornitza Stark gene: IFT43 was added gene: IFT43 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: IFT43 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: IFT43 were set to Cranioectodermal dysplasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | IFT122 |
Zornitza Stark gene: IFT122 was added gene: IFT122 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: IFT122 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: IFT122 were set to Cranioectodermal dysplasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HYLS1 |
Zornitza Stark gene: HYLS1 was added gene: HYLS1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: HYLS1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HYLS1 were set to Hydrolethalus syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HYDIN |
Zornitza Stark gene: HYDIN was added gene: HYDIN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: HYDIN was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HYDIN were set to Primary ciliary dyskinesia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HPS6 |
Zornitza Stark gene: HPS6 was added gene: HPS6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: HPS6 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HPS6 were set to Hermansky-Pudlak syndrome 6 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HPD |
Zornitza Stark gene: HPD was added gene: HPD was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: HPD was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HPD were set to Tyrosinemia, type III |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HOXA1 |
Zornitza Stark gene: HOXA1 was added gene: HOXA1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: HOXA1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HOXA1 were set to Athabaskan brainstem dysgenesis syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HOMEZ |
Zornitza Stark gene: HOMEZ was added gene: HOMEZ was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: HOMEZ was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: HOMEZ were set to Congenital heart disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HNF4A |
Zornitza Stark gene: HNF4A was added gene: HNF4A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: HNF4A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: HNF4A were set to Hypoglycaemia, hyperinsulinaemic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HNF1B |
Zornitza Stark gene: HNF1B was added gene: HNF1B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: HNF1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: HNF1B were set to Renal cysts and diabetes syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HMBS |
Zornitza Stark gene: HMBS was added gene: HMBS was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: HMBS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: HMBS were set to Porphyria, acute intermittent |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HK1 |
Zornitza Stark gene: HK1 was added gene: HK1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: HK1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HK1 were set to Hemolytic anemia due to hexokinase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HIBCH |
Zornitza Stark gene: HIBCH was added gene: HIBCH was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: HIBCH was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HIBCH were set to Neurodegeneration, progressive infantile |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HGF |
Zornitza Stark gene: HGF was added gene: HGF was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: HGF was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HGF were set to Deafness, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HFE2 |
Zornitza Stark gene: HFE2 was added gene: HFE2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: HFE2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HFE2 were set to Haemochromatosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HFE |
Zornitza Stark gene: HFE was added gene: HFE was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: HFE was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HFE were set to Hemochromatosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HESX1 |
Zornitza Stark gene: HESX1 was added gene: HESX1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: HESX1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HESX1 were set to Pituitary hypoplasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HERC2 |
Zornitza Stark gene: HERC2 was added gene: HERC2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: HERC2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HERC2 were set to Autism spectrum disorder |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DNAAF5 |
Zornitza Stark gene: DNAAF5 was added gene: DNAAF5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: DNAAF5 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DNAAF5 were set to Primary ciliary dyskinesia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HCN4 |
Zornitza Stark gene: HCN4 was added gene: HCN4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: HCN4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: HCN4 were set to Brugada syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HCCS |
Zornitza Stark gene: HCCS was added gene: HCCS was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: HCCS was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: HCCS were set to Microphthalmia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HAS2 |
Zornitza Stark gene: HAS2 was added gene: HAS2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: HAS2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: HAS2 were set to Congenital heart disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HARS2 |
Zornitza Stark gene: HARS2 was added gene: HARS2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: HARS2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HARS2 were set to Perrault syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HARS |
Zornitza Stark gene: HARS was added gene: HARS was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: HARS was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HARS were set to Usher syndrome type 3B |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HAMP |
Zornitza Stark gene: HAMP was added gene: HAMP was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: HAMP was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HAMP were set to Haemochromatosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HADH |
Zornitza Stark Source BabySeq Category C gene was added to HADH. Source Expert Review Red was added to HADH. Added phenotypes 3-hydroxyacyl-CoA dehydrogenase deficiency for gene: HADH Rating Changed from Green List (high evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GYG1 |
Zornitza Stark gene: GYG1 was added gene: GYG1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: GYG1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GYG1 were set to Glycogen storage disease XV |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GUCY2C |
Zornitza Stark gene: GUCY2C was added gene: GUCY2C was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: GUCY2C was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GUCY2C were set to Meconium ileus |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GTF2H5 |
Zornitza Stark gene: GTF2H5 was added gene: GTF2H5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: GTF2H5 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GTF2H5 were set to Trichothiodystrophy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GRXCR1 |
Zornitza Stark gene: GRXCR1 was added gene: GRXCR1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: GRXCR1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GRXCR1 were set to Deafness, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GRIN2A |
Zornitza Stark gene: GRIN2A was added gene: GRIN2A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: GRIN2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: GRIN2A were set to Epilepsy with neurodevelopmental defects |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GRHL2 |
Zornitza Stark gene: GRHL2 was added gene: GRHL2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: GRHL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: GRHL2 were set to Hearing loss |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GPX1 |
Zornitza Stark gene: GPX1 was added gene: GPX1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: GPX1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GPX1 were set to Hemolytic anemia due to glutathione peroxidase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GPHN |
Zornitza Stark gene: GPHN was added gene: GPHN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: GPHN was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GPHN were set to Hyperekplexia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GPC6 |
Zornitza Stark gene: GPC6 was added gene: GPC6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: GPC6 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GPC6 were set to Omodysplasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GPC4 |
Zornitza Stark gene: GPC4 was added gene: GPC4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: GPC4 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: GPC4 were set to Simpson-Golabi-Behmel syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GMPPA |
Zornitza Stark gene: GMPPA was added gene: GMPPA was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: GMPPA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GMPPA were set to Congenital disorder of glycosylation |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GLUL |
Zornitza Stark gene: GLUL was added gene: GLUL was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: GLUL was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GLUL were set to Congenital brain dysgenesis due to glutamine synthetase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GLRB |
Zornitza Stark gene: GLRB was added gene: GLRB was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: GLRB was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GLRB were set to Hyperekplexia 2, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GLIS3 |
Zornitza Stark gene: GLIS3 was added gene: GLIS3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: GLIS3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GLIS3 were set to Diabetes mellitus, neonatal, with congenital hypothyroidism |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GLI2 |
Zornitza Stark gene: GLI2 was added gene: GLI2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: GLI2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: GLI2 were set to Holoprosencephaly-9 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GLE1 |
Zornitza Stark gene: GLE1 was added gene: GLE1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: GLE1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GLE1 were set to Lethal arthrogryposis with anterior horn cell disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GFER |
Zornitza Stark gene: GFER was added gene: GFER was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: GFER was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GFER were set to Myopathy, mitochondrial progressive, with congenital cataract, hearing loss, and developmental delay |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GDNF | Zornitza Stark Added phenotypes Central hypoventilation syndrome for gene: GDNF | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GDNF |
Zornitza Stark gene: GDNF was added gene: GDNF was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: GDNF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: GDNF were set to Hirschsprung disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GDF1 |
Zornitza Stark gene: GDF1 was added gene: GDF1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: GDF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: GDF1 were set to Congenital heart defects |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GCSH |
Zornitza Stark gene: GCSH was added gene: GCSH was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: GCSH was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GCSH were set to Glycine encephalopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GCLC |
Zornitza Stark gene: GCLC was added gene: GCLC was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: GCLC was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GCLC were set to Hemolytic anemia due to gamma-glutamylcysteine synthetase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GBE1 |
Zornitza Stark Source BabySeq Category C gene was added to GBE1. Source Expert Review Red was added to GBE1. Added phenotypes Polyglucosan body disease, adult form for gene: GBE1 Rating Changed from Green List (high evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GATAD1 |
Zornitza Stark gene: GATAD1 was added gene: GATAD1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: GATAD1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GATAD1 were set to Cardiomyopathy, dilated, 2B |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GATA6 |
Zornitza Stark gene: GATA6 was added gene: GATA6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: GATA6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: GATA6 were set to Atrial fibrillation |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GATA5 |
Zornitza Stark gene: GATA5 was added gene: GATA5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: GATA5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: GATA5 were set to Familial atrial fibrillation |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GATA1 |
Zornitza Stark Source BabySeq Category C gene was added to GATA1. Source Expert Review Red was added to GATA1. Added phenotypes Porphyria, congenital erythropoietic for gene: GATA1 Rating Changed from Green List (high evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GABRG2 |
Zornitza Stark gene: GABRG2 was added gene: GABRG2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: GABRG2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: GABRG2 were set to Epilepsy, childhood absence with febrile seizure |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GABRA1 |
Zornitza Stark gene: GABRA1 was added gene: GABRA1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: GABRA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: GABRA1 were set to Epilepsy, idiopathic generalised |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FTCD |
Zornitza Stark gene: FTCD was added gene: FTCD was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: FTCD was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FTCD were set to Glutamate formiminotransferase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FSCN2 |
Zornitza Stark gene: FSCN2 was added gene: FSCN2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: FSCN2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: FSCN2 were set to Retinitis pigmentosa |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FREM2 |
Zornitza Stark gene: FREM2 was added gene: FREM2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: FREM2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FREM2 were set to Fraser syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FREM1 |
Zornitza Stark gene: FREM1 was added gene: FREM1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: FREM1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FREM1 were set to Manitoba oculotrichoanal syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FOXN1 |
Zornitza Stark gene: FOXN1 was added gene: FOXN1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: FOXN1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FOXN1 were set to Congenital alopecia with T-cell immunodeficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FOXH1 |
Zornitza Stark gene: FOXH1 was added gene: FOXH1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: FOXH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: FOXH1 were set to Congenital heart defects |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FOXF2 |
Zornitza Stark gene: FOXF2 was added gene: FOXF2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: FOXF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: FOXF2 were set to Disorders of sex development with cleft palate |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FOXE1 |
Zornitza Stark gene: FOXE1 was added gene: FOXE1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: FOXE1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FOXE1 were set to Bamforth-Lazarus syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FMO3 |
Zornitza Stark gene: FMO3 was added gene: FMO3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: FMO3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FMO3 were set to Trimethylaminuria |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FLNC |
Zornitza Stark gene: FLNC was added gene: FLNC was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: FLNC was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: FLNC were set to Myofibrillar myopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FLG |
Zornitza Stark gene: FLG was added gene: FLG was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: FLG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: FLG were set to Ichthyosis vulgaris |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FKBPL |
Zornitza Stark gene: FKBPL was added gene: FKBPL was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: FKBPL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: FKBPL were set to Infertility |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FHL2 |
Zornitza Stark gene: FHL2 was added gene: FHL2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: FHL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: FHL2 were set to Cardiomyopathy, hypertrophic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FHL1 |
Zornitza Stark Source BabySeq Category C gene was added to FHL1. Source Expert Review Red was added to FHL1. Added phenotypes Myofibrillar myopathy for gene: FHL1 Rating Changed from Green List (high evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FH |
Zornitza Stark Source BabySeq Category C gene was added to FH. Source Expert Review Red was added to FH. Mode of inheritance for gene FH was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Added phenotypes Leiomyomatosis and renal cell cancer for gene: FH Rating Changed from Green List (high evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FGFR3 | Zornitza Stark Added phenotypes LADD syndrome for gene: FGFR3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FGFR3 |
Zornitza Stark Source BabySeq Category C gene was added to FGFR3. Source Expert Review Red was added to FGFR3. Added phenotypes CATSHL syndrome for gene: FGFR3 Rating Changed from Green List (high evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FBN1 | Zornitza Stark Added phenotypes Shprintzen-Goldberg syndrome for gene: FBN1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FBN1 |
Zornitza Stark Source BabySeq Category C gene was added to FBN1. Source Expert Review Red was added to FBN1. Added phenotypes Weill-Marchesani syndrome 2, dominant for gene: FBN1 Rating Changed from Green List (high evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FBLN5 |
Zornitza Stark Source BabySeq Category C gene was added to FBLN5. Source Expert Review Red was added to FBLN5. Mode of inheritance for gene FBLN5 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Added phenotypes Age-related macular degeneration for gene: FBLN5 Rating Changed from Green List (high evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FANCM |
Zornitza Stark gene: FANCM was added gene: FANCM was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: FANCM was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FANCM were set to Fanconi anaemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FANCL |
Zornitza Stark gene: FANCL was added gene: FANCL was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: FANCL was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FANCL were set to Fanconi anaemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FANCF |
Zornitza Stark gene: FANCF was added gene: FANCF was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: FANCF was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FANCF were set to Fanconi anaemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FANCE |
Zornitza Stark gene: FANCE was added gene: FANCE was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: FANCE was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FANCE were set to Fanconi anaemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RETREG1 |
Zornitza Stark gene: RETREG1 was added gene: RETREG1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: RETREG1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: RETREG1 were set to Neuropathy, hereditary sensory and autonomic, type IIB |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FAM111B |
Zornitza Stark gene: FAM111B was added gene: FAM111B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: FAM111B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: FAM111B were set to Hereditary fibrosing poikiloderma with tendon contracture, myopathy, and pulmonary fibrosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FAAH2 |
Zornitza Stark gene: FAAH2 was added gene: FAAH2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: FAAH2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: FAAH2 were set to Autism spectrum disorder |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | F5 |
Zornitza Stark gene: F5 was added gene: F5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: F5 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: F5 were set to Risk for deep vein thrombosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ESPN |
Zornitza Stark gene: ESPN was added gene: ESPN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ESPN was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ESPN were set to Hearing loss |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ERCC4 |
Zornitza Stark gene: ERCC4 was added gene: ERCC4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ERCC4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ERCC4 were set to Xeroderma pigmentosum |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ERCC3 |
Zornitza Stark gene: ERCC3 was added gene: ERCC3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ERCC3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ERCC3 were set to Xeroderma pigmentosum |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ERCC1 |
Zornitza Stark gene: ERCC1 was added gene: ERCC1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ERCC1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ERCC1 were set to Xeroderma pigmentosum |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ERBB3 |
Zornitza Stark gene: ERBB3 was added gene: ERBB3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ERBB3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ERBB3 were set to Lethal congenital contractural syndrome 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | EPHX1 |
Zornitza Stark gene: EPHX1 was added gene: EPHX1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: EPHX1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: EPHX1 were set to Hypercholanemia, familial |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | EPCAM |
Zornitza Stark gene: EPCAM was added gene: EPCAM was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: EPCAM was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: EPCAM were set to Lynch syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | EPB42 |
Zornitza Stark gene: EPB42 was added gene: EPB42 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: EPB42 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: EPB42 were set to Spherocytosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | EIF2B1 |
Zornitza Stark gene: EIF2B1 was added gene: EIF2B1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: EIF2B1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: EIF2B1 were set to Leukoencephalopathy with vanishing white matter |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | EFEMP2 |
Zornitza Stark gene: EFEMP2 was added gene: EFEMP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: EFEMP2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: EFEMP2 were set to Cutis laxa, autosomal recessive, type IB |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | EDNRB | Zornitza Stark Added phenotypes Waardenburg syndrome for gene: EDNRB | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | EDNRB |
Zornitza Stark gene: EDNRB was added gene: EDNRB was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: EDNRB was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: EDNRB were set to Hirschsprung disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | EDN3 | Zornitza Stark Added phenotypes Waardenburg syndrome for gene: EDN3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | EDN3 |
Zornitza Stark gene: EDN3 was added gene: EDN3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: EDN3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: EDN3 were set to Hirschsprung disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ECE1 |
Zornitza Stark gene: ECE1 was added gene: ECE1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ECE1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ECE1 were set to Hirschsprung disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DUOXA2 |
Zornitza Stark gene: DUOXA2 was added gene: DUOXA2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: DUOXA2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DUOXA2 were set to Thyroid dyshormonogenesis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DTNBP1 |
Zornitza Stark gene: DTNBP1 was added gene: DTNBP1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: DTNBP1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DTNBP1 were set to Hermansky-Pudlak syndrome 7 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DTNA |
Zornitza Stark gene: DTNA was added gene: DTNA was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: DTNA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: DTNA were set to Left ventricular noncompaction 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DTHD1 |
Zornitza Stark gene: DTHD1 was added gene: DTHD1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: DTHD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: DTHD1 were set to Leber congenital amaurosis with myopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DPYD |
Zornitza Stark gene: DPYD was added gene: DPYD was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: DPYD was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DPYD were set to Dihydropyrimidine dehydrogenase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DPP6 |
Zornitza Stark gene: DPP6 was added gene: DPP6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: DPP6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: DPP6 were set to Ventricular fibrillation, paroxysmal familial, 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DPM1 |
Zornitza Stark gene: DPM1 was added gene: DPM1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: DPM1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DPM1 were set to Congenital disorder of glycosylation, type Ie |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DOLK |
Zornitza Stark gene: DOLK was added gene: DOLK was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: DOLK was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DOLK were set to Congenital disorder of glycosylation, type Im |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DNAL1 |
Zornitza Stark gene: DNAL1 was added gene: DNAL1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: DNAL1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DNAL1 were set to Primary ciliary dyskinesia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DNAJC5 |
Zornitza Stark gene: DNAJC5 was added gene: DNAJC5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: DNAJC5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: DNAJC5 were set to Neuronal ceroid lipofuscinosis, adult-onset |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DNAJC19 |
Zornitza Stark gene: DNAJC19 was added gene: DNAJC19 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: DNAJC19 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DNAJC19 were set to 3-methylglutaconic aciduria, type V |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DNAI2 |
Zornitza Stark gene: DNAI2 was added gene: DNAI2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: DNAI2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DNAI2 were set to Primary ciliary dyskinesia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DNAAF3 |
Zornitza Stark gene: DNAAF3 was added gene: DNAAF3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: DNAAF3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DNAAF3 were set to Primary ciliary dyskinesia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DNAAF2 |
Zornitza Stark gene: DNAAF2 was added gene: DNAAF2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: DNAAF2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DNAAF2 were set to Primary ciliary dyskinesia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DLC1 |
Zornitza Stark gene: DLC1 was added gene: DLC1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: DLC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: DLC1 were set to Congenital heart disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DIAPH1 |
Zornitza Stark gene: DIAPH1 was added gene: DIAPH1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: DIAPH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: DIAPH1 were set to Hearing loss |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DIABLO |
Zornitza Stark gene: DIABLO was added gene: DIABLO was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: DIABLO was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: DIABLO were set to Deafness, autosomal dominant |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DHCR24 |
Zornitza Stark gene: DHCR24 was added gene: DHCR24 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: DHCR24 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DHCR24 were set to Desmosterolosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DGKE |
Zornitza Stark gene: DGKE was added gene: DGKE was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: DGKE was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DGKE were set to Haemolytic uraemic syndrome, atypical |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | WHRN |
Zornitza Stark gene: WHRN was added gene: WHRN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: WHRN was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: WHRN were set to Hearing loss |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DECR1 |
Zornitza Stark gene: DECR1 was added gene: DECR1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: DECR1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DECR1 were set to 2,4-Dienoyl-CoA reductase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DDR2 |
Zornitza Stark gene: DDR2 was added gene: DDR2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: DDR2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DDR2 were set to Spondylometaepiphyseal dysplasia, short limb-hand type |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DDOST |
Zornitza Stark gene: DDOST was added gene: DDOST was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: DDOST was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DDOST were set to Congenital disorder of glycosylation, type Ir |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DDHD1 |
Zornitza Stark gene: DDHD1 was added gene: DDHD1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: DDHD1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DDHD1 were set to Spastic paraplegia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DCX |
Zornitza Stark Source BabySeq Category C gene was added to DCX. Source Expert Review Red was added to DCX. Added phenotypes Lennox-Gastaut syndrome for gene: DCX Rating Changed from Green List (high evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DCTN1 |
Zornitza Stark gene: DCTN1 was added gene: DCTN1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: DCTN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: DCTN1 were set to Amyotrophic lateral sclerosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DBH |
Zornitza Stark gene: DBH was added gene: DBH was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: DBH was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DBH were set to Dopamine beta-hydroxylase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DAPK3 |
Zornitza Stark gene: DAPK3 was added gene: DAPK3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: DAPK3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: DAPK3 were set to Congenital heart disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DAG1 |
Zornitza Stark gene: DAG1 was added gene: DAG1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: DAG1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DAG1 were set to Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 9 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CYP7B1 |
Zornitza Stark gene: CYP7B1 was added gene: CYP7B1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CYP7B1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CYP7B1 were set to Cholestasis, severe |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CYP7A1 |
Zornitza Stark gene: CYP7A1 was added gene: CYP7A1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CYP7A1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CYP7A1 were set to Hypercholesterolemia due to cholesterol 7alpha-hydroxylase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CYCS |
Zornitza Stark gene: CYCS was added gene: CYCS was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CYCS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CYCS were set to Thrombocytopenia 4 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CTF1 |
Zornitza Stark gene: CTF1 was added gene: CTF1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CTF1 was set to Unknown Phenotypes for gene: CTF1 were set to Cardiomyopathy, dilated |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CTDP1 |
Zornitza Stark gene: CTDP1 was added gene: CTDP1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CTDP1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CTDP1 were set to Congenital cataracts - facial dysmorphism - neuropathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CSTA |
Zornitza Stark gene: CSTA was added gene: CSTA was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CSTA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CSTA were set to Exfoliative ichthyosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CSRP3 |
Zornitza Stark Source BabySeq Category C gene was added to CSRP3. Source Expert Review Red was added to CSRP3. Added phenotypes Cardiomyopathy, dilated, 1M for gene: CSRP3 Rating Changed from Amber List (moderate evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CSF2RB |
Zornitza Stark gene: CSF2RB was added gene: CSF2RB was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CSF2RB was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CSF2RB were set to Pulmonary alveolar proteinosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CSF1R |
Zornitza Stark gene: CSF1R was added gene: CSF1R was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CSF1R was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CSF1R were set to Leukoencephalopathy, diffuse hereditary, with spheroids |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CRELD1 |
Zornitza Stark gene: CRELD1 was added gene: CRELD1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CRELD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CRELD1 were set to Cardiac atrioventricular septal defect |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CR2 |
Zornitza Stark gene: CR2 was added gene: CR2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CR2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CR2 were set to Hypogammaglobulinaemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CPZ |
Zornitza Stark gene: CPZ was added gene: CPZ was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CPZ was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CPZ were set to Autism |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CPOX |
Zornitza Stark gene: CPOX was added gene: CPOX was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CPOX was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CPOX were set to Coproporphyria |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | COX4I2 |
Zornitza Stark gene: COX4I2 was added gene: COX4I2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: COX4I2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: COX4I2 were set to Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | COQ6 |
Zornitza Stark gene: COQ6 was added gene: COQ6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: COQ6 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: COQ6 were set to Nephrotic syndrome with sensorineural deafness |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | COQ2 |
Zornitza Stark gene: COQ2 was added gene: COQ2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: COQ2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: COQ2 were set to Coenzyme Q10 deficiency, primary, 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | COL9A2 |
Zornitza Stark gene: COL9A2 was added gene: COL9A2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: COL9A2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: COL9A2 were set to Stickler syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | COL9A1 |
Zornitza Stark gene: COL9A1 was added gene: COL9A1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: COL9A1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: COL9A1 were set to Stickler syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | COL1A1 |
Zornitza Stark Source BabySeq Category C gene was added to COL1A1. Source Expert Review Red was added to COL1A1. Added phenotypes Caffey disease for gene: COL1A1 Rating Changed from Green List (high evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | COG7 |
Zornitza Stark gene: COG7 was added gene: COG7 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: COG7 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: COG7 were set to Congenital disorder of glycosylation, type IIe |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | COG5 |
Zornitza Stark gene: COG5 was added gene: COG5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: COG5 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: COG5 were set to Congenital disorder of glycosylation, type IIi |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | COG4 |
Zornitza Stark gene: COG4 was added gene: COG4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: COG4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: COG4 were set to Congenital disorder of glycosylation, type IIj |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CNTNAP2 |
Zornitza Stark gene: CNTNAP2 was added gene: CNTNAP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CNTNAP2 was set to Unknown Phenotypes for gene: CNTNAP2 were set to Autism spectrum disorder |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CLPP |
Zornitza Stark gene: CLPP was added gene: CLPP was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CLPP was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CLPP were set to Perrault syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CLMP |
Zornitza Stark gene: CLMP was added gene: CLMP was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CLMP was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CLMP were set to Congenital short-bowel syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CLDN1 |
Zornitza Stark gene: CLDN1 was added gene: CLDN1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CLDN1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CLDN1 were set to Ichthyosis, leukocyte vacuoles, alopecia, and sclerosing cholangitis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CLCN7 |
Zornitza Stark gene: CLCN7 was added gene: CLCN7 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CLCN7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CLCN7 were set to Osteopetrosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CLCN1 |
Zornitza Stark gene: CLCN1 was added gene: CLCN1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CLCN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CLCN1 were set to Myotonia congenita |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CITED2 |
Zornitza Stark gene: CITED2 was added gene: CITED2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CITED2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CITED2 were set to Congenital heart defects |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CISD2 |
Zornitza Stark gene: CISD2 was added gene: CISD2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CISD2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CISD2 were set to Wolfram syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | UTP4 |
Zornitza Stark gene: UTP4 was added gene: UTP4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: UTP4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: UTP4 were set to North American Indian childhood cirrhosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CHSY1 |
Zornitza Stark gene: CHSY1 was added gene: CHSY1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CHSY1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CHSY1 were set to Temtamy preaxial brachydactyly syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CHST3 |
Zornitza Stark gene: CHST3 was added gene: CHST3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CHST3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CHST3 were set to Larsen syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CHRNB1 |
Zornitza Stark gene: CHRNB1 was added gene: CHRNB1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CHRNB1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CHRNB1 were set to Congenital myasthenic syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CHRNA2 |
Zornitza Stark gene: CHRNA2 was added gene: CHRNA2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CHRNA2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CHRNA2 were set to Epilepsy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CHRM2 |
Zornitza Stark gene: CHRM2 was added gene: CHRM2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CHRM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CHRM2 were set to Cardiomyopathy, dilated |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CHEK2 |
Zornitza Stark gene: CHEK2 was added gene: CHEK2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CHEK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CHEK2 were set to Breast cancer, susceptibility to |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CFI |
Zornitza Stark gene: CFI was added gene: CFI was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CFI was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CFI were set to Haemolytic uraemic syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CFHR5 |
Zornitza Stark gene: CFHR5 was added gene: CFHR5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CFHR5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CFHR5 were set to Haemolytic uraemic syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CFHR4 |
Zornitza Stark gene: CFHR4 was added gene: CFHR4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CFHR4 was set to Unknown Phenotypes for gene: CFHR4 were set to Hemolytic-uremic syndrome, atypical, susceptibility to |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CFHR3 |
Zornitza Stark gene: CFHR3 was added gene: CFHR3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CFHR3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CFHR3 were set to Haemolytic uraemic syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CFHR1 |
Zornitza Stark gene: CFHR1 was added gene: CFHR1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CFHR1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CFHR1 were set to Haemolytic uraemic syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CFH |
Zornitza Stark gene: CFH was added gene: CFH was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CFH was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CFH were set to Haemolytic uraemic syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CFD |
Zornitza Stark gene: CFD was added gene: CFD was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CFD was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CFD were set to Complement factor D deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CFB |
Zornitza Stark gene: CFB was added gene: CFB was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CFB was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CFB were set to Haemolytic uraemic syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CEP41 |
Zornitza Stark gene: CEP41 was added gene: CEP41 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CEP41 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CEP41 were set to Joubert syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CENPJ |
Zornitza Stark gene: CENPJ was added gene: CENPJ was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CENPJ was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CENPJ were set to Primary microcephaly |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CEACAM16 |
Zornitza Stark gene: CEACAM16 was added gene: CEACAM16 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CEACAM16 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CEACAM16 were set to Hearing loss, autosomal dominant |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CDT1 |
Zornitza Stark gene: CDT1 was added gene: CDT1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CDT1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CDT1 were set to Meier-Gorlin syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CDON |
Zornitza Stark gene: CDON was added gene: CDON was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CDON was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CDON were set to Holoprosencephaly |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CDK5RAP2 |
Zornitza Stark gene: CDK5RAP2 was added gene: CDK5RAP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CDK5RAP2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CDK5RAP2 were set to Microcephaly 3, primary, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CDH1 |
Zornitza Stark Source BabySeq Category C gene was added to CDH1. Source Expert Review Red was added to CDH1. Added phenotypes Orofacial clefts for gene: CDH1 Rating Changed from Amber List (moderate evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CD96 |
Zornitza Stark gene: CD96 was added gene: CD96 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CD96 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CD96 were set to C syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CD46 |
Zornitza Stark gene: CD46 was added gene: CD46 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CD46 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CD46 were set to Haemolytic uraemic syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CD36 |
Zornitza Stark gene: CD36 was added gene: CD36 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CD36 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CD36 were set to Platelet glycoprotein IV deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CD2AP |
Zornitza Stark gene: CD2AP was added gene: CD2AP was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CD2AP was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CD2AP were set to Glomerulosclerosis, focal segmental, 3 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CCDC88C |
Zornitza Stark gene: CCDC88C was added gene: CCDC88C was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CCDC88C was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CCDC88C were set to Hydrocephalus |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CCDC78 |
Zornitza Stark gene: CCDC78 was added gene: CCDC78 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CCDC78 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CCDC78 were set to Congenital myopathy with prominent internal nuclei and atypical cores |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CCDC50 |
Zornitza Stark gene: CCDC50 was added gene: CCDC50 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CCDC50 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CCDC50 were set to Hearing loss |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CCDC103 |
Zornitza Stark gene: CCDC103 was added gene: CCDC103 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CCDC103 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CCDC103 were set to Primary ciliary dyskinesia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CAV3 |
Zornitza Stark Mode of inheritance for gene CAV3 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BIALLELIC, autosomal or pseudoautosomal Added phenotypes Rippling muscle disease for gene: CAV3 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CAV3 | Zornitza Stark Added phenotypes Long QT syndrome-9 for gene: CAV3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CAV3 |
Zornitza Stark Source BabySeq Category C gene was added to CAV3. Source Expert Review Red was added to CAV3. Added phenotypes Cardiomyopathy, familial hypertrophic for gene: CAV3 Rating Changed from Green List (high evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CASP10 |
Zornitza Stark gene: CASP10 was added gene: CASP10 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CASP10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CASP10 were set to Autoimmune lymphoproliferative syndrome II |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CARS2 |
Zornitza Stark gene: CARS2 was added gene: CARS2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CARS2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CARS2 were set to Epileptic encephalopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CACNB2 |
Zornitza Stark gene: CACNB2 was added gene: CACNB2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CACNB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CACNB2 were set to Brugada syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CACNA2D1 |
Zornitza Stark gene: CACNA2D1 was added gene: CACNA2D1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CACNA2D1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CACNA2D1 were set to Brugada syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CACNA1S |
Zornitza Stark gene: CACNA1S was added gene: CACNA1S was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CACNA1S was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CACNA1S were set to Malignant hyperthermia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CACNA1D |
Zornitza Stark gene: CACNA1D was added gene: CACNA1D was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: CACNA1D was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CACNA1D were set to Sinoatrial node dysfunction and deafness |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | C3 |
Zornitza Stark gene: C3 was added gene: C3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: C3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: C3 were set to Haemolytic uraemic syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BVES |
Zornitza Stark gene: BVES was added gene: BVES was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: BVES was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: BVES were set to Congenital heart disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BSCL2 |
Zornitza Stark Source BabySeq Category C gene was added to BSCL2. Source Expert Review Red was added to BSCL2. Mode of inheritance for gene BSCL2 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Added phenotypes Silver spastic paraplegia syndrome for gene: BSCL2 Rating Changed from Green List (high evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BRCA2 |
Zornitza Stark Source BabySeq Category C gene was added to BRCA2. Source Expert Review Red was added to BRCA2. Mode of inheritance for gene BRCA2 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Added phenotypes Breast-ovarian cancer, familial, 2 for gene: BRCA2 Rating Changed from Green List (high evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BRCA1 |
Zornitza Stark gene: BRCA1 was added gene: BRCA1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: BRCA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: BRCA1 were set to Breast-ovarian cancer, familial, 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BRAF |
Zornitza Stark Source BabySeq Category C gene was added to BRAF. Source Expert Review Red was added to BRAF. Added phenotypes LEOPARD syndrome for gene: BRAF Rating Changed from Green List (high evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BPGM |
Zornitza Stark gene: BPGM was added gene: BPGM was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: BPGM was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: BPGM were set to Erythrocytosis due to bisphosphoglycerate mutase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BNC2 |
Zornitza Stark gene: BNC2 was added gene: BNC2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: BNC2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: BNC2 were set to Total anomalous pulmonary venous return |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BMPR1A |
Zornitza Stark Source BabySeq Category C gene was added to BMPR1A. Source Expert Review Red was added to BMPR1A. Added phenotypes Tetralogy of Fallot for gene: BMPR1A Rating Changed from Green List (high evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BLOC1S6 |
Zornitza Stark gene: BLOC1S6 was added gene: BLOC1S6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: BLOC1S6 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: BLOC1S6 were set to Hermansky-pudlak syndrome 9 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BLOC1S3 |
Zornitza Stark gene: BLOC1S3 was added gene: BLOC1S3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: BLOC1S3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: BLOC1S3 were set to Hermansky-Pudlak syndrome 8 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BDNF |
Zornitza Stark gene: BDNF was added gene: BDNF was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: BDNF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: BDNF were set to Central hypoventilation syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BCL9 |
Zornitza Stark gene: BCL9 was added gene: BCL9 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: BCL9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: BCL9 were set to Congenital heart disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BARD1 |
Zornitza Stark gene: BARD1 was added gene: BARD1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: BARD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: BARD1 were set to Tetralogy of Fallot |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BANF1 |
Zornitza Stark gene: BANF1 was added gene: BANF1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: BANF1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: BANF1 were set to Progeroid syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BAG3 |
Zornitza Stark Source BabySeq Category C gene was added to BAG3. Source Expert Review Red was added to BAG3. Added phenotypes Myopathy, myofibrillar for gene: BAG3 Rating Changed from Amber List (moderate evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | B9D2 |
Zornitza Stark gene: B9D2 was added gene: B9D2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: B9D2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: B9D2 were set to Meckel syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | B4GALT1 |
Zornitza Stark gene: B4GALT1 was added gene: B4GALT1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: B4GALT1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: B4GALT1 were set to CDG syndrome type IId |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | B3GAT3 |
Zornitza Stark gene: B3GAT3 was added gene: B3GAT3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: B3GAT3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: B3GAT3 were set to Multiple joint dislocations, short stature, craniofacial dysmorphism, and congenital heart defects |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AXL |
Zornitza Stark gene: AXL was added gene: AXL was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: AXL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: AXL were set to Hypogonadotropic hypogonadism |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ATR |
Zornitza Stark gene: ATR was added gene: ATR was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ATR was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ATR were set to Seckel syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ATP7A |
Zornitza Stark Source BabySeq Category C gene was added to ATP7A. Source Expert Review Red was added to ATP7A. Added phenotypes Spinal muscular atrophy, distal, X-linked 3 for gene: ATP7A Rating Changed from Green List (high evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ATP6AP2 |
Zornitza Stark gene: ATP6AP2 was added gene: ATP6AP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ATP6AP2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: ATP6AP2 were set to X-linked recessive intellectual deficit - epilepsy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ATP1A3 |
Zornitza Stark gene: ATP1A3 was added gene: ATP1A3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ATP1A3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ATP1A3 were set to Rapid-onset dystonia-parkinsonism |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ATN1 |
Zornitza Stark gene: ATN1 was added gene: ATN1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ATN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ATN1 were set to Dentatorubral-pallidoluysian atrophy 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ATIC |
Zornitza Stark gene: ATIC was added gene: ATIC was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ATIC was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ATIC were set to AICA-Ribosiduria |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ASNS |
Zornitza Stark gene: ASNS was added gene: ASNS was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ASNS was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ASNS were set to Microcephaly, intellectual disability, cerebral atrophy & intractable seizures |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ASCL1 |
Zornitza Stark gene: ASCL1 was added gene: ASCL1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ASCL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ASCL1 were set to Congenital central hypoventilation |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ARSE |
Zornitza Stark gene: ARSE was added gene: ARSE was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ARSE was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: ARSE were set to Chondrodysplasia punctata, X-linked recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ARL13B |
Zornitza Stark gene: ARL13B was added gene: ARL13B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ARL13B was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ARL13B were set to Joubert syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ARID1A |
Zornitza Stark gene: ARID1A was added gene: ARID1A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ARID1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ARID1A were set to Coffin-Siris syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ARHGEF9 |
Zornitza Stark gene: ARHGEF9 was added gene: ARHGEF9 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ARHGEF9 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: ARHGEF9 were set to Hyperekplexia and epilepsy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ARHGAP31 |
Zornitza Stark gene: ARHGAP31 was added gene: ARHGAP31 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ARHGAP31 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ARHGAP31 were set to Syndromic cutis aplasia & limb anomalies |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AR |
Zornitza Stark Source BabySeq Category C gene was added to AR. Source Expert Review Red was added to AR. Added phenotypes Spinal and bulbar muscular atrophy of Kennedy for gene: AR Rating Changed from Green List (high evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | APRT |
Zornitza Stark gene: APRT was added gene: APRT was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: APRT was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: APRT were set to Adenine phosphoribosyltransferase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | APP |
Zornitza Stark gene: APP was added gene: APP was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: APP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: APP were set to Alzheimer disease 1, familial |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | APOE |
Zornitza Stark gene: APOE was added gene: APOE was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: APOE was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: APOE were set to Sea-blue histiocyte disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AP4M1 |
Zornitza Stark gene: AP4M1 was added gene: AP4M1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: AP4M1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: AP4M1 were set to Spastic paraplegia 50, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AP1S3 |
Zornitza Stark gene: AP1S3 was added gene: AP1S3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: AP1S3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: AP1S3 were set to Pustular psoriasis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ANO5 |
Zornitza Stark Source BabySeq Category C gene was added to ANO5. Source Expert Review Red was added to ANO5. Mode of inheritance for gene ANO5 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Added phenotypes Gnathodiaphyseal dysplasia for gene: ANO5 Rating Changed from Green List (high evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ANKRD1 |
Zornitza Stark Source BabySeq Category C gene was added to ANKRD1. Source Expert Review Red was added to ANKRD1. Added phenotypes Cardiomyopathy, hypertrophic for gene: ANKRD1 Rating Changed from Amber List (moderate evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AMPD1 |
Zornitza Stark gene: AMPD1 was added gene: AMPD1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: AMPD1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: AMPD1 were set to Adenosine monophosphate deaminase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AMACR | Zornitza Stark Added phenotypes Alpha-methylacyl-CoA racemase deficiency for gene: AMACR | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AMACR |
Zornitza Stark gene: AMACR was added gene: AMACR was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: AMACR was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: AMACR were set to Bile acid synthesis defect, congenital, 4 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ALG9 |
Zornitza Stark gene: ALG9 was added gene: ALG9 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ALG9 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ALG9 were set to Congenital disorder of glycosylation, type Il |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ALG2 |
Zornitza Stark gene: ALG2 was added gene: ALG2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ALG2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ALG2 were set to Congenital disorder of glycosylation, type Ii |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ALG11 |
Zornitza Stark gene: ALG11 was added gene: ALG11 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ALG11 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ALG11 were set to Congenital disorder of glycosylation type 1P |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ALDOA |
Zornitza Stark gene: ALDOA was added gene: ALDOA was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ALDOA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ALDOA were set to Aldolase A deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ALDH4A1 |
Zornitza Stark gene: ALDH4A1 was added gene: ALDH4A1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ALDH4A1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ALDH4A1 were set to Hyperprolinemia, type II |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ALDH1A2 |
Zornitza Stark gene: ALDH1A2 was added gene: ALDH1A2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ALDH1A2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ALDH1A2 were set to Tetralogy of Fallot |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AKT3 |
Zornitza Stark gene: AKT3 was added gene: AKT3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: AKT3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: AKT3 were set to Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AKT2 |
Zornitza Stark gene: AKT2 was added gene: AKT2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: AKT2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: AKT2 were set to Severe insulin resistance and diabetes mellitus |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AKAP9 |
Zornitza Stark gene: AKAP9 was added gene: AKAP9 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: AKAP9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: AKAP9 were set to Long QT syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AK1 |
Zornitza Stark gene: AK1 was added gene: AK1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: AK1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: AK1 were set to Hemolytic anemia due to adenylate kinase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AHSP |
Zornitza Stark gene: AHSP was added gene: AHSP was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: AHSP was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: AHSP were set to Thalassaemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AGTR1 |
Zornitza Stark gene: AGTR1 was added gene: AGTR1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: AGTR1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: AGTR1 were set to Renal tubular dysgenesis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AGT |
Zornitza Stark gene: AGT was added gene: AGT was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: AGT was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: AGT were set to Renal tubular dysgenesis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AGPS |
Zornitza Stark gene: AGPS was added gene: AGPS was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: AGPS was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: AGPS were set to Rhizomelic chondrodysplasia punctata, type 3 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ADAMTS2 |
Zornitza Stark gene: ADAMTS2 was added gene: ADAMTS2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ADAMTS2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ADAMTS2 were set to Ehlers-Danlos syndrome VIIc |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ADAM17 |
Zornitza Stark gene: ADAM17 was added gene: ADAM17 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ADAM17 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ADAM17 were set to Neonatal inflammatory skin and bowel disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACVR2B |
Zornitza Stark gene: ACVR2B was added gene: ACVR2B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ACVR2B was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ACVR2B were set to Left-right axis malformation |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACTN2 |
Zornitza Stark Source BabySeq Category C gene was added to ACTN2. Source Expert Review Red was added to ACTN2. Added phenotypes Cardiomyopathy, dilated for gene: ACTN2 Rating Changed from Amber List (moderate evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACTC1 | Zornitza Stark Added phenotypes Left ventricular noncompaction for gene: ACTC1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACTC1 |
Zornitza Stark Source BabySeq Category C gene was added to ACTC1. Source Expert Review Red was added to ACTC1. Added phenotypes Atrial septal defect for gene: ACTC1 Rating Changed from Amber List (moderate evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACTB |
Zornitza Stark Source BabySeq Category C gene was added to ACTB. Source Expert Review Red was added to ACTB. Added phenotypes Neutrophil dysfunction and recurrent infection for gene: ACTB Rating Changed from Green List (high evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACTA1 |
Zornitza Stark Source BabySeq Category C gene was added to ACTA1. Source Expert Review Red was added to ACTA1. Added phenotypes Congenital myopathy with fiber type disproportion for gene: ACTA1 Rating Changed from Green List (high evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACO2 |
Zornitza Stark gene: ACO2 was added gene: ACO2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ACO2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ACO2 were set to Cerebellar-retinal degeneration, infantile |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACBD5 |
Zornitza Stark gene: ACBD5 was added gene: ACBD5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ACBD5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ACBD5 were set to Thrombocytopaenia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACADSB |
Zornitza Stark gene: ACADSB was added gene: ACADSB was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ACADSB was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ACADSB were set to 2-Methylbutyryl-CoA dehydrogenase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACADS |
Zornitza Stark gene: ACADS was added gene: ACADS was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ACADS was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ACADS were set to Acyl-CoA dehydrogenase, short-chain, deficiency of |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACADL |
Zornitza Stark gene: ACADL was added gene: ACADL was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ACADL was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ACADL were set to Sudden infant death |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ABCD4 |
Zornitza Stark gene: ABCD4 was added gene: ABCD4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ABCD4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ABCD4 were set to Methylmalonic aciduria and homocystinuria, cblJ type |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ABCC9 |
Zornitza Stark Source BabySeq Category C gene was added to ABCC9. Source Expert Review Red was added to ABCC9. Added phenotypes Atrial fibrillation, familial for gene: ABCC9 Rating Changed from Amber List (moderate evidence) to Red List (low evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ABCC2 |
Zornitza Stark gene: ABCC2 was added gene: ABCC2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ABCC2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ABCC2 were set to Dubin-Johnson syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ABCB7 |
Zornitza Stark gene: ABCB7 was added gene: ABCB7 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ABCB7 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: ABCB7 were set to Sideroblastic anaemia and ataxia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ABAT |
Zornitza Stark gene: ABAT was added gene: ABAT was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: ABAT was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ABAT were set to GABA-transaminase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AARS2 |
Zornitza Stark gene: AARS2 was added gene: AARS2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red Mode of inheritance for gene: AARS2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: AARS2 were set to Leukoencephalopathy, and ovarian failure in females |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | WT1 |
Zornitza Stark Source BabySeq Category B gene was added to WT1. Source Expert Review Amber was added to WT1. Added phenotypes Wilms tumor, type 1 for gene: WT1 Rating Changed from Green List (high evidence) to Amber List (moderate evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | VWF |
Zornitza Stark gene: VWF was added gene: VWF was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: VWF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: VWF were set to von Willebrand disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | VCL |
Zornitza Stark gene: VCL was added gene: VCL was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: VCL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: VCL were set to Cardiomyopathy, dilated |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TTN |
Zornitza Stark Source BabySeq Category B gene was added to TTN. Source Expert Review Amber was added to TTN. Mode of inheritance for gene TTN was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Added phenotypes Cardiomyopathy, dilated for gene: TTN Rating Changed from Green List (high evidence) to Amber List (moderate evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TPM1 |
Zornitza Stark gene: TPM1 was added gene: TPM1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: TPM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TPM1 were set to Cardiomyopathy, hypertrophic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TNNT2 | Zornitza Stark Added phenotypes Familial hypertrophic cardiomyopathy for gene: TNNT2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TNNT2 |
Zornitza Stark gene: TNNT2 was added gene: TNNT2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: TNNT2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TNNT2 were set to Cardiomyopathy, dilated |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TNNI3 | Zornitza Stark Added phenotypes Familial hypertrophic cardiomyopathy for gene: TNNI3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TNNI3 |
Zornitza Stark gene: TNNI3 was added gene: TNNI3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: TNNI3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TNNI3 were set to Cardiomyopathy, dilated |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TNNC1 |
Zornitza Stark gene: TNNC1 was added gene: TNNC1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: TNNC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TNNC1 were set to Cardiomyopathy, dilated |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TINF2 |
Zornitza Stark gene: TINF2 was added gene: TINF2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: TINF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TINF2 were set to Dyskeratosis congenita |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TERT |
Zornitza Stark gene: TERT was added gene: TERT was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: TERT was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TERT were set to Dyskeratosis congenita |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TERC |
Zornitza Stark gene: TERC was added gene: TERC was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: TERC was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TERC were set to Dyskeratosis congenita |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SNTA1 |
Zornitza Stark gene: SNTA1 was added gene: SNTA1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: SNTA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SNTA1 were set to Long QT syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SDHC |
Zornitza Stark gene: SDHC was added gene: SDHC was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: SDHC was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SDHC were set to Hereditary Paraganglioma-Pheochromocytoma Syndromes |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SDHB |
Zornitza Stark gene: SDHB was added gene: SDHB was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: SDHB was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SDHB were set to Hereditary Paraganglioma-Pheochromocytoma Syndromes |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SDHAF2 |
Zornitza Stark gene: SDHAF2 was added gene: SDHAF2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: SDHAF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SDHAF2 were set to Hereditary Paraganglioma-Pheochromocytoma Syndromes |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SCN5A | Zornitza Stark Added phenotypes Brugada syndrome for gene: SCN5A | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SCN5A |
Zornitza Stark gene: SCN5A was added gene: SCN5A was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: SCN5A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SCN5A were set to Long QT syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RYR1 |
Zornitza Stark Source BabySeq Category B gene was added to RYR1. Source Expert Review Amber was added to RYR1. Mode of inheritance for gene RYR1 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Added phenotypes Malignant hyperthermia for gene: RYR1 Rating Changed from Green List (high evidence) to Amber List (moderate evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RBM20 |
Zornitza Stark gene: RBM20 was added gene: RBM20 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: RBM20 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: RBM20 were set to Cardiomyopathy, dilated, 1DD |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PRKAG2 |
Zornitza Stark Source BabySeq Category B gene was added to PRKAG2. Source Expert Review Amber was added to PRKAG2. Added phenotypes Cardiomyopathy, hypertrophic for gene: PRKAG2 Rating Changed from Green List (high evidence) to Amber List (moderate evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PLN |
Zornitza Stark gene: PLN was added gene: PLN was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: PLN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PLN were set to Cardiomyopathy, dilated |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PKP2 |
Zornitza Stark gene: PKP2 was added gene: PKP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: PKP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PKP2 were set to Arrhythmogenic right ventricular dysplasia 9 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PHOX2B |
Zornitza Stark gene: PHOX2B was added gene: PHOX2B was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: PHOX2B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PHOX2B were set to Central hypoventilation syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PCSK9 |
Zornitza Stark gene: PCSK9 was added gene: PCSK9 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: PCSK9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PCSK9 were set to Hypercholesterolemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NKX2-5 |
Zornitza Stark gene: NKX2-5 was added gene: NKX2-5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: NKX2-5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: NKX2-5 were set to Congenital heart disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYLK |
Zornitza Stark gene: MYLK was added gene: MYLK was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: MYLK was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MYLK were set to Aortic aneurysm, familial thoracic 7 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYL3 |
Zornitza Stark gene: MYL3 was added gene: MYL3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: MYL3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MYL3 were set to Cardiomyopathy, familial hypertrophic, 8 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYL2 |
Zornitza Stark gene: MYL2 was added gene: MYL2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: MYL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MYL2 were set to Cardiomyopathy, familial hypertrophic, 10 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYH7 | Zornitza Stark Added phenotypes Left ventricular noncompaction for gene: MYH7 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYH7 | Zornitza Stark Added phenotypes Cardiomyopathy, dilated for gene: MYH7 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYH7 |
Zornitza Stark Source BabySeq Category B gene was added to MYH7. Source Expert Review Amber was added to MYH7. Added phenotypes Cardiomyopathy, familial hypertrophic for gene: MYH7 Rating Changed from Green List (high evidence) to Amber List (moderate evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYH11 |
Zornitza Stark gene: MYH11 was added gene: MYH11 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: MYH11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MYH11 were set to Aortic aneurysm, familial thoracic 4 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYBPC3 |
Zornitza Stark gene: MYBPC3 was added gene: MYBPC3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: MYBPC3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MYBPC3 were set to Cardiomyopathy, familial hypertrophic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MTHFR |
Zornitza Stark gene: MTHFR was added gene: MTHFR was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: MTHFR was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MTHFR were set to Homocystinuria due to MTHFR deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MCCC2 |
Zornitza Stark gene: MCCC2 was added gene: MCCC2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: MCCC2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MCCC2 were set to 3-Methylcrotonyl-CoA carboxylase 2 deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MCCC1 |
Zornitza Stark gene: MCCC1 was added gene: MCCC1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: MCCC1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MCCC1 were set to 3-Methylcrotonyl-CoA carboxylase 1 deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LMNA |
Zornitza Stark Source BabySeq Category B gene was added to LMNA. Source Expert Review Amber was added to LMNA. Mode of inheritance for gene LMNA was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Added phenotypes Dilated cardiomyopathy for gene: LMNA Rating Changed from Green List (high evidence) to Amber List (moderate evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KCNQ1 |
Zornitza Stark Source BabySeq Category B gene was added to KCNQ1. Source Expert Review Amber was added to KCNQ1. Mode of inheritance for gene KCNQ1 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Added phenotypes Long QT syndrome-1 for gene: KCNQ1 Rating Changed from Green List (high evidence) to Amber List (moderate evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KCNH2 |
Zornitza Stark gene: KCNH2 was added gene: KCNH2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: KCNH2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KCNH2 were set to Long QT syndrome-2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KCNE2 |
Zornitza Stark gene: KCNE2 was added gene: KCNE2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: KCNE2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KCNE2 were set to Long QT syndrome-6 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KCNE1 |
Zornitza Stark Source BabySeq Category B gene was added to KCNE1. Source Expert Review Amber was added to KCNE1. Mode of inheritance for gene KCNE1 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Added phenotypes Long QT syndrome-5 for gene: KCNE1 Rating Changed from Green List (high evidence) to Amber List (moderate evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KCNA5 |
Zornitza Stark gene: KCNA5 was added gene: KCNA5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: KCNA5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KCNA5 were set to Atrial fibrillation |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | JUP |
Zornitza Stark Source BabySeq Category B gene was added to JUP. Source Expert Review Amber was added to JUP. Mode of inheritance for gene JUP was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Added phenotypes Arrhythmogenic right ventricular dysplasia 12 for gene: JUP Rating Changed from Green List (high evidence) to Amber List (moderate evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GPD1L |
Zornitza Stark gene: GPD1L was added gene: GPD1L was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: GPD1L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: GPD1L were set to Brugada syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GJA5 |
Zornitza Stark gene: GJA5 was added gene: GJA5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: GJA5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: GJA5 were set to Atrial fibrillation |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GCH1 |
Zornitza Stark gene: GCH1 was added gene: GCH1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: GCH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: GCH1 were set to Dystonia, dopa-responsive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DSP |
Zornitza Stark Source BabySeq Category B gene was added to DSP. Source Expert Review Amber was added to DSP. Added phenotypes Arrhythmogenic right ventricular dysplasia/cardiomyopathy for gene: DSP Rating Changed from Green List (high evidence) to Amber List (moderate evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DSG2 |
Zornitza Stark gene: DSG2 was added gene: DSG2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: DSG2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: DSG2 were set to Arrhythmogenic right ventricular cardiomyopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DSC2 |
Zornitza Stark gene: DSC2 was added gene: DSC2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: DSC2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: DSC2 were set to Arrhythmogenic right ventricular cardiomyopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DMD |
Zornitza Stark Source BabySeq Category B gene was added to DMD. Source Expert Review Amber was added to DMD. Added phenotypes Cardiomyopathy, dilated for gene: DMD Rating Changed from Green List (high evidence) to Amber List (moderate evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DKC1 |
Zornitza Stark gene: DKC1 was added gene: DKC1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: DKC1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: DKC1 were set to Dyskeratosis congenita |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DES |
Zornitza Stark Source BabySeq Category B gene was added to DES. Source Expert Review Amber was added to DES. Added phenotypes Cardiomyopathy, dilated for gene: DES Rating Changed from Green List (high evidence) to Amber List (moderate evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CSRP3 |
Zornitza Stark gene: CSRP3 was added gene: CSRP3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: CSRP3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CSRP3 were set to Cardiomyopathy, familial hypertrophic, 12 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CRYAB |
Zornitza Stark Source BabySeq Category B gene was added to CRYAB. Source Expert Review Amber was added to CRYAB. Added phenotypes Cardiomyopathy, dilated for gene: CRYAB Rating Changed from Green List (high evidence) to Amber List (moderate evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CP |
Zornitza Stark gene: CP was added gene: CP was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: CP was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CP were set to Aceruloplasminaemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CDKN2A |
Zornitza Stark gene: CDKN2A was added gene: CDKN2A was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: CDKN2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CDKN2A were set to Melanoma |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CDH1 |
Zornitza Stark gene: CDH1 was added gene: CDH1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: CDH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CDH1 were set to Gastric cancer |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CACNA1C |
Zornitza Stark gene: CACNA1C was added gene: CACNA1C was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: CACNA1C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CACNA1C were set to Brugada syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BMPR2 |
Zornitza Stark gene: BMPR2 was added gene: BMPR2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: BMPR2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: BMPR2 were set to Pulmonary hypertension, familial primary |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BAG3 |
Zornitza Stark gene: BAG3 was added gene: BAG3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: BAG3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: BAG3 were set to Cardiomyopathy, dilated |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ANKRD1 |
Zornitza Stark gene: ANKRD1 was added gene: ANKRD1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: ANKRD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ANKRD1 were set to Cardiomyopathy, dilated |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ANK2 |
Zornitza Stark gene: ANK2 was added gene: ANK2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: ANK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ANK2 were set to Long QT syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AIP |
Zornitza Stark gene: AIP was added gene: AIP was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: AIP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: AIP were set to Pituitary adenoma |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACTN2 |
Zornitza Stark gene: ACTN2 was added gene: ACTN2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: ACTN2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ACTN2 were set to Cardiomyopathy, familial hypertrophic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACTC1 | Zornitza Stark Added phenotypes Cardiomyopathy, familial hypertrophic for gene: ACTC1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACTC1 |
Zornitza Stark gene: ACTC1 was added gene: ACTC1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: ACTC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ACTC1 were set to Cardiomyopathy, dilated |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACTA2 |
Zornitza Stark gene: ACTA2 was added gene: ACTA2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber Mode of inheritance for gene: ACTA2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ACTA2 were set to Aortic aneurysm, familial thoracic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ABCC9 |
Zornitza Stark Source BabySeq Category B gene was added to ABCC9. Source Expert Review Amber was added to ABCC9. Added phenotypes Cardiomyopathy, dilated for gene: ABCC9 Rating Changed from Green List (high evidence) to Amber List (moderate evidence) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ZNF469 |
Zornitza Stark gene: ZNF469 was added gene: ZNF469 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ZNF469 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ZNF469 were set to Brittle cornea syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ZMPSTE24 |
Zornitza Stark gene: ZMPSTE24 was added gene: ZMPSTE24 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ZMPSTE24 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ZMPSTE24 were set to Restrictive dermopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ZIC3 |
Zornitza Stark gene: ZIC3 was added gene: ZIC3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ZIC3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: ZIC3 were set to Heterotaxy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ZIC2 |
Zornitza Stark gene: ZIC2 was added gene: ZIC2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ZIC2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ZIC2 were set to Holoprosencephaly-5 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ZEB2 |
Zornitza Stark gene: ZEB2 was added gene: ZEB2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ZEB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ZEB2 were set to Mowat-Wilson syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ZAP70 |
Zornitza Stark gene: ZAP70 was added gene: ZAP70 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ZAP70 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ZAP70 were set to ZAP70-related severe combined immunodeficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | XPC |
Zornitza Stark gene: XPC was added gene: XPC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: XPC was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: XPC were set to Xeroderma pigmentosum |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | XPA |
Zornitza Stark gene: XPA was added gene: XPA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: XPA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: XPA were set to Xeroderma pigmentosum |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | WT1 | Zornitza Stark Added phenotypes Frasier syndrome for gene: WT1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | WT1 |
Zornitza Stark gene: WT1 was added gene: WT1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: WT1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: WT1 were set to Denys-Drash syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | WRN |
Zornitza Stark gene: WRN was added gene: WRN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: WRN was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: WRN were set to Werner syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | WNT10A |
Zornitza Stark gene: WNT10A was added gene: WNT10A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: WNT10A was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: WNT10A were set to Ectodermal dysplasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | WFS1 |
Zornitza Stark gene: WFS1 was added gene: WFS1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: WFS1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: WFS1 were set to Wolfram syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | WDR62 |
Zornitza Stark gene: WDR62 was added gene: WDR62 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: WDR62 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: WDR62 were set to Microcephaly 2, primary, autosomal recessive, with or without cortical malformations |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | WAS |
Zornitza Stark gene: WAS was added gene: WAS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: WAS was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: WAS were set to Wiskott-Aldrich syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | VPS33B |
Zornitza Stark gene: VPS33B was added gene: VPS33B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: VPS33B was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: VPS33B were set to Arthrogryposis renal dysfunction cholestasis syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | VPS13B |
Zornitza Stark gene: VPS13B was added gene: VPS13B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: VPS13B was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: VPS13B were set to Cohen syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | VPS13A |
Zornitza Stark gene: VPS13A was added gene: VPS13A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: VPS13A was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: VPS13A were set to Choreoacanthocytosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | VLDLR |
Zornitza Stark gene: VLDLR was added gene: VLDLR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: VLDLR was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: VLDLR were set to Cerebellar hypoplasia and mental retardation with or without quadrupedal locomotion 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | VIPAS39 |
Zornitza Stark gene: VIPAS39 was added gene: VIPAS39 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: VIPAS39 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: VIPAS39 were set to Arthrogryposis, renal dysfunction and cholestasis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | VHL |
Zornitza Stark gene: VHL was added gene: VHL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: VHL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: VHL were set to von Hippel-Lindau syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | VDR |
Zornitza Stark gene: VDR was added gene: VDR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: VDR was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: VDR were set to Vitamin D-dependent rickets |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | VCP |
Zornitza Stark gene: VCP was added gene: VCP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: VCP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: VCP were set to Inclusion body myopathy with early-onset paget disease and frontotemporal dementia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | VCAN |
Zornitza Stark gene: VCAN was added gene: VCAN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: VCAN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: VCAN were set to Wagner syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | USH2A |
Zornitza Stark gene: USH2A was added gene: USH2A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: USH2A was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: USH2A were set to Usher syndrome 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | USH1G |
Zornitza Stark gene: USH1G was added gene: USH1G was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: USH1G was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: USH1G were set to Usher syndrome 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | USH1C |
Zornitza Stark gene: USH1C was added gene: USH1C was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: USH1C was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: USH1C were set to Usher syndrome 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | UROS |
Zornitza Stark gene: UROS was added gene: UROS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: UROS was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: UROS were set to Porphyria, congenital erythropoietic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | UROD |
Zornitza Stark gene: UROD was added gene: UROD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: UROD was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: UROD were set to Porphyria, hepatoerythropoietic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | UNC13D |
Zornitza Stark gene: UNC13D was added gene: UNC13D was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: UNC13D was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: UNC13D were set to Hemophagocytic lymphohistiocytosis, familial, 3 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | UMOD |
Zornitza Stark gene: UMOD was added gene: UMOD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: UMOD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: UMOD were set to Nephropathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | UGT1A1 |
Zornitza Stark gene: UGT1A1 was added gene: UGT1A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: UGT1A1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: UGT1A1 were set to Crigler-Najjar syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | UBR1 |
Zornitza Stark gene: UBR1 was added gene: UBR1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: UBR1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: UBR1 were set to Johanson-Blizzard syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TYR |
Zornitza Stark gene: TYR was added gene: TYR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TYR was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TYR were set to Albinism, oculocutaneous 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TYMP |
Zornitza Stark gene: TYMP was added gene: TYMP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TYMP was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TYMP were set to Mitochondrial DNA depletion syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TWIST1 |
Zornitza Stark gene: TWIST1 was added gene: TWIST1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TWIST1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TWIST1 were set to Saethre-Chotzen syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TTR |
Zornitza Stark gene: TTR was added gene: TTR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TTR was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TTR were set to Amyloidosis, hereditary, transthyretin-related |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TTPA |
Zornitza Stark gene: TTPA was added gene: TTPA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TTPA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TTPA were set to Ataxia with isolated vitamin E deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TTN |
Zornitza Stark gene: TTN was added gene: TTN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TTN was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TTN were set to Centronuclear myopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TTC7A |
Zornitza Stark gene: TTC7A was added gene: TTC7A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TTC7A was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TTC7A were set to Immunodeficiency, combined, with intestinal atresias |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TTC37 |
Zornitza Stark gene: TTC37 was added gene: TTC37 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TTC37 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TTC37 were set to Trichohepatoenteric syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TSHR |
Zornitza Stark gene: TSHR was added gene: TSHR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TSHR was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TSHR were set to Hypothyroidism |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TSHB |
Zornitza Stark gene: TSHB was added gene: TSHB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TSHB was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TSHB were set to Hypothryoidism, congenital, nongoitrous 4 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TSEN54 |
Zornitza Stark gene: TSEN54 was added gene: TSEN54 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TSEN54 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TSEN54 were set to Pontocerebellar hypoplasia type 4 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TSC2 |
Zornitza Stark gene: TSC2 was added gene: TSC2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TSC2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TSC2 were set to Tuberous sclerosis 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TSC1 |
Zornitza Stark gene: TSC1 was added gene: TSC1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TSC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TSC1 were set to Tuberous sclerosis 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TRPM4 |
Zornitza Stark gene: TRPM4 was added gene: TRPM4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TRPM4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TRPM4 were set to Cardiac conduction disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TRMU |
Zornitza Stark gene: TRMU was added gene: TRMU was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TRMU was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TRMU were set to Liver failure, transient infantile |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TRIOBP |
Zornitza Stark gene: TRIOBP was added gene: TRIOBP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TRIOBP was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TRIOBP were set to Deafness, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TRIM37 |
Zornitza Stark gene: TRIM37 was added gene: TRIM37 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TRIM37 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TRIM37 were set to Mulibrey nanism syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TRIM32 |
Zornitza Stark gene: TRIM32 was added gene: TRIM32 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TRIM32 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TRIM32 were set to Muscular dystrophy, limb-girdle, type 2H |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TREX1 |
Zornitza Stark gene: TREX1 was added gene: TREX1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TREX1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TREX1 were set to Aicardi-Goutieres syndrome 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TRAPPC2 |
Zornitza Stark gene: TRAPPC2 was added gene: TRAPPC2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TRAPPC2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: TRAPPC2 were set to Spondyloepiphyseal dysplasia tarda |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TPP1 |
Zornitza Stark gene: TPP1 was added gene: TPP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TPP1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TPP1 were set to Neuronal ceroid lipofuscinosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TPO |
Zornitza Stark gene: TPO was added gene: TPO was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TPO was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TPO were set to Thyroid dyshormonogenesis 2A |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TPM3 | Zornitza Stark Added phenotypes Congenital fiber-type disproportion myopathy for gene: TPM3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TPM3 |
Zornitza Stark gene: TPM3 was added gene: TPM3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TPM3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TPM3 were set to Nemaline myopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TPM2 | Zornitza Stark Added phenotypes Arthrogryposis multiplex congenita, distal for gene: TPM2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TPM2 |
Zornitza Stark gene: TPM2 was added gene: TPM2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TPM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TPM2 were set to Nemaline myopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TP53 |
Zornitza Stark gene: TP53 was added gene: TP53 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TP53 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TP53 were set to Li-Fraumeni syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TNNT3 |
Zornitza Stark gene: TNNT3 was added gene: TNNT3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TNNT3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TNNT3 were set to Arthyrgryposis, distal |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TNNT1 |
Zornitza Stark gene: TNNT1 was added gene: TNNT1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TNNT1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TNNT1 were set to Nemaline myopathy, Amish type |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TNNI2 |
Zornitza Stark gene: TNNI2 was added gene: TNNI2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TNNI2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TNNI2 were set to Distal arthrogryposis syndrome 2b |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TNFSF11 |
Zornitza Stark gene: TNFSF11 was added gene: TNFSF11 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TNFSF11 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TNFSF11 were set to Osteopetrosis, autosomal recessive 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TNFRSF11B |
Zornitza Stark gene: TNFRSF11B was added gene: TNFRSF11B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TNFRSF11B was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TNFRSF11B were set to Paget disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TMPRSS3 |
Zornitza Stark gene: TMPRSS3 was added gene: TMPRSS3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TMPRSS3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TMPRSS3 were set to Deafness, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TMIE |
Zornitza Stark gene: TMIE was added gene: TMIE was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TMIE was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TMIE were set to Deafness, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TMEM67 | Zornitza Stark Added phenotypes Meckel syndrome for gene: TMEM67 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TMEM67 |
Zornitza Stark gene: TMEM67 was added gene: TMEM67 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TMEM67 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TMEM67 were set to Joubert syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TMEM43 |
Zornitza Stark gene: TMEM43 was added gene: TMEM43 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TMEM43 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TMEM43 were set to Arrhythmogenic right ventricular dysplasia 5 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TMC1 |
Zornitza Stark gene: TMC1 was added gene: TMC1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TMC1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TMC1 were set to Deafness |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TK2 |
Zornitza Stark gene: TK2 was added gene: TK2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TK2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TK2 were set to Mitochondrial DNA depletion syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TIMM8A |
Zornitza Stark gene: TIMM8A was added gene: TIMM8A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TIMM8A was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: TIMM8A were set to Mohr-Tranebjaerg syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | THRB |
Zornitza Stark gene: THRB was added gene: THRB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: THRB was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: THRB were set to Thyroid hormone resistance |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | THRA |
Zornitza Stark gene: THRA was added gene: THRA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: THRA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: THRA were set to Hypothyroidism, congenital, nongoitrous, 6 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TH |
Zornitza Stark gene: TH was added gene: TH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TH was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TH were set to Tyrosine hydroxylase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TGM5 |
Zornitza Stark gene: TGM5 was added gene: TGM5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TGM5 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TGM5 were set to Peeling skin syndrome, acral type |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TGM1 |
Zornitza Stark gene: TGM1 was added gene: TGM1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TGM1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TGM1 were set to Ichthyosis, congenital, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TGFBR2 |
Zornitza Stark gene: TGFBR2 was added gene: TGFBR2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TGFBR2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TGFBR2 were set to Loeys-Dietz syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TGFBR1 |
Zornitza Stark gene: TGFBR1 was added gene: TGFBR1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TGFBR1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TGFBR1 were set to Loeys-Dietz syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TG |
Zornitza Stark gene: TG was added gene: TG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TG was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TG were set to Thyroid dyshormonogenesis 3 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TFG |
Zornitza Stark gene: TFG was added gene: TFG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TFG was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TFG were set to Hereditary motor and sensory neuropathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TFAP2B |
Zornitza Stark gene: TFAP2B was added gene: TFAP2B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TFAP2B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TFAP2B were set to Char syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TFAP2A |
Zornitza Stark gene: TFAP2A was added gene: TFAP2A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TFAP2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TFAP2A were set to Branchiooculofacial syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TECTA |
Zornitza Stark gene: TECTA was added gene: TECTA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TECTA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TECTA were set to Deafness |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TCOF1 |
Zornitza Stark gene: TCOF1 was added gene: TCOF1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TCOF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TCOF1 were set to Treacher Collins syndrome 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TCIRG1 |
Zornitza Stark gene: TCIRG1 was added gene: TCIRG1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TCIRG1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TCIRG1 were set to Osteopetrosis, infantile malignant |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TCAP |
Zornitza Stark gene: TCAP was added gene: TCAP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TCAP was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TCAP were set to Muscular dystrophy, limb-girdle, type 2G |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TBX5 |
Zornitza Stark gene: TBX5 was added gene: TBX5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TBX5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TBX5 were set to Holt-Oram syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TBX1 |
Zornitza Stark gene: TBX1 was added gene: TBX1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TBX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: TBX1 were set to DiGeorge syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TBC1D24 |
Zornitza Stark gene: TBC1D24 was added gene: TBC1D24 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TBC1D24 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TBC1D24 were set to Deafness, onychodystrophy, osteodystrophy, mental retardation, and seizures syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TAZ |
Zornitza Stark gene: TAZ was added gene: TAZ was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TAZ was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: TAZ were set to Barth syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TAT |
Zornitza Stark gene: TAT was added gene: TAT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TAT was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TAT were set to Tyrosinemia, type II |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SURF1 |
Zornitza Stark gene: SURF1 was added gene: SURF1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SURF1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SURF1 were set to Leigh syndrome, due to COX deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SUOX |
Zornitza Stark gene: SUOX was added gene: SUOX was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SUOX was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SUOX were set to Sulphite oxidase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SUCLG1 |
Zornitza Stark gene: SUCLG1 was added gene: SUCLG1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SUCLG1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SUCLG1 were set to Mitochondrial DNA depletion syndrome 9 (encephalomyopathic type with methylmalonic aciduria) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SUCLA2 |
Zornitza Stark gene: SUCLA2 was added gene: SUCLA2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SUCLA2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SUCLA2 were set to Mitochondrial DNA depletion syndrome 5 (encephalomyopathic with methylmalonic aciduria) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | STXBP2 |
Zornitza Stark gene: STXBP2 was added gene: STXBP2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: STXBP2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: STXBP2 were set to Hemophagocytic lymphohistiocytosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | STXBP1 |
Zornitza Stark gene: STXBP1 was added gene: STXBP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: STXBP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: STXBP1 were set to Epileptic encephalopathy, early infantile |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | STX11 |
Zornitza Stark gene: STX11 was added gene: STX11 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: STX11 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: STX11 were set to Hemophagocytic lymphohistiocytosis, familial, 4 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | STS |
Zornitza Stark gene: STS was added gene: STS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: STS was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: STS were set to Ichthyosis, X-linked |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | STRC |
Zornitza Stark gene: STRC was added gene: STRC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: STRC was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: STRC were set to Deafness, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | STRA6 |
Zornitza Stark gene: STRA6 was added gene: STRA6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: STRA6 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: STRA6 were set to Microphthalmia, syndromic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | STK11 |
Zornitza Stark gene: STK11 was added gene: STK11 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: STK11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: STK11 were set to Peutz-Jeghers syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | STAT3 |
Zornitza Stark gene: STAT3 was added gene: STAT3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: STAT3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: STAT3 were set to Hyper-IgE recurrent infection syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | STAR |
Zornitza Stark gene: STAR was added gene: STAR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: STAR was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: STAR were set to Congenital lipoid adrenal hyperplasia, |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SRCAP |
Zornitza Stark gene: SRCAP was added gene: SRCAP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SRCAP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SRCAP were set to Floating-Harbor syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SPTLC1 |
Zornitza Stark gene: SPTLC1 was added gene: SPTLC1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SPTLC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SPTLC1 were set to Neuropathy, hereditary sensory and autonomic, type IA |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SPTB |
Zornitza Stark gene: SPTB was added gene: SPTB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SPTB was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SPTB were set to Spherocytosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SPTA1 |
Zornitza Stark gene: SPTA1 was added gene: SPTA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SPTA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SPTA1 were set to Elliptocytosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SPRED1 |
Zornitza Stark gene: SPRED1 was added gene: SPRED1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SPRED1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SPRED1 were set to Legius syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SPR |
Zornitza Stark gene: SPR was added gene: SPR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SPR was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SPR were set to Sepiapterin reductase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SPINK5 |
Zornitza Stark gene: SPINK5 was added gene: SPINK5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SPINK5 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SPINK5 were set to Netherton syndrome 1; Netherton syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SP110 |
Zornitza Stark gene: SP110 was added gene: SP110 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SP110 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SP110 were set to Hepatic venoocclusive disease with immunodeficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SOX9 |
Zornitza Stark gene: SOX9 was added gene: SOX9 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SOX9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SOX9 were set to Campomelic dysplasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SOX10 |
Zornitza Stark gene: SOX10 was added gene: SOX10 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SOX10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SOX10 were set to Shah-Waardenburg syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SMPX |
Zornitza Stark gene: SMPX was added gene: SMPX was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SMPX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: SMPX were set to Deafness, X-linked |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SMPD1 | Zornitza Stark Added phenotypes Niemann-Pick disease, type B for gene: SMPD1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SMPD1 |
Zornitza Stark gene: SMPD1 was added gene: SMPD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SMPD1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SMPD1 were set to Niemann-Pick disease, type A |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SMN1 |
Zornitza Stark gene: SMN1 was added gene: SMN1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SMN1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SMN1 were set to Spinal muscular atrophy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SMC1A |
Zornitza Stark gene: SMC1A was added gene: SMC1A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SMC1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SMC1A were set to Cornelia de Lange syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SMARCAL1 |
Zornitza Stark gene: SMARCAL1 was added gene: SMARCAL1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SMARCAL1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SMARCAL1 were set to Schimke immunoosseous dysplasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SMAD4 |
Zornitza Stark gene: SMAD4 was added gene: SMAD4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SMAD4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SMAD4 were set to Juvenile polyposis syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SMAD3 |
Zornitza Stark gene: SMAD3 was added gene: SMAD3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SMAD3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SMAD3 were set to Loeys-Dietz syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLCO2A1 |
Zornitza Stark gene: SLCO2A1 was added gene: SLCO2A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLCO2A1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLCO2A1 were set to Hypertrophic osteoarthropathy, primary, autosomal recessive 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC9A6 |
Zornitza Stark gene: SLC9A6 was added gene: SLC9A6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC9A6 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: SLC9A6 were set to Christianson syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC7A9 |
Zornitza Stark gene: SLC7A9 was added gene: SLC7A9 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC7A9 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC7A9 were set to Cystinuria |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC7A7 |
Zornitza Stark gene: SLC7A7 was added gene: SLC7A7 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC7A7 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC7A7 were set to Lysinuric protein intolerance |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC6A8 |
Zornitza Stark gene: SLC6A8 was added gene: SLC6A8 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC6A8 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: SLC6A8 were set to Creatine deficiency syndrome, X-linked |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC6A5 |
Zornitza Stark gene: SLC6A5 was added gene: SLC6A5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC6A5 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC6A5 were set to Hyperekplexia 3 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC5A5 |
Zornitza Stark gene: SLC5A5 was added gene: SLC5A5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC5A5 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC5A5 were set to Thyroid dyshormonogenesis 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC5A2 |
Zornitza Stark gene: SLC5A2 was added gene: SLC5A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC5A2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC5A2 were set to Renal glucosuria |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC4A11 |
Zornitza Stark gene: SLC4A11 was added gene: SLC4A11 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC4A11 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC4A11 were set to Corneal endothelial dystrophy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC4A1 |
Zornitza Stark gene: SLC4A1 was added gene: SLC4A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC4A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SLC4A1 were set to Spherocytosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC46A1 |
Zornitza Stark gene: SLC46A1 was added gene: SLC46A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC46A1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC46A1 were set to Folate malabsorption, hereditary |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC45A2 |
Zornitza Stark gene: SLC45A2 was added gene: SLC45A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC45A2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC45A2 were set to Oculocutaneous albinism, type IV |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC3A1 |
Zornitza Stark gene: SLC3A1 was added gene: SLC3A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC3A1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC3A1 were set to Cystinuria |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC39A4 |
Zornitza Stark gene: SLC39A4 was added gene: SLC39A4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC39A4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC39A4 were set to Acrodermatitis enteropathica |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC37A4 |
Zornitza Stark gene: SLC37A4 was added gene: SLC37A4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC37A4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC37A4 were set to Glycogen storage disease Ib |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC35D1 |
Zornitza Stark gene: SLC35D1 was added gene: SLC35D1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC35D1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC35D1 were set to Schneckenbecken dysplasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC34A3 |
Zornitza Stark gene: SLC34A3 was added gene: SLC34A3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC34A3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC34A3 were set to Hypophosphatemic rickets with hypercalciuria |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC34A2 |
Zornitza Stark gene: SLC34A2 was added gene: SLC34A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC34A2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC34A2 were set to Pulmonary alveolar microlithiasis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC2A10 |
Zornitza Stark gene: SLC2A10 was added gene: SLC2A10 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC2A10 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC2A10 were set to Arterial tortuosity syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC2A1 |
Zornitza Stark gene: SLC2A1 was added gene: SLC2A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC2A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SLC2A1 were set to GLUT1 deficiency syndrome 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC27A4 |
Zornitza Stark gene: SLC27A4 was added gene: SLC27A4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC27A4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC27A4 were set to Ichthyosis prematurity syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC26A4 |
Zornitza Stark gene: SLC26A4 was added gene: SLC26A4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC26A4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC26A4 were set to Pendred syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC26A3 |
Zornitza Stark gene: SLC26A3 was added gene: SLC26A3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC26A3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC26A3 were set to Chloride diarrhea, congenital, Finnish type |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC26A2 |
Zornitza Stark gene: SLC26A2 was added gene: SLC26A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC26A2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC26A2 were set to Achondrogenesis 1B |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC25A4 |
Zornitza Stark gene: SLC25A4 was added gene: SLC25A4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC25A4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SLC25A4 were set to Progressive external ophthalmoplegia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC25A38 |
Zornitza Stark gene: SLC25A38 was added gene: SLC25A38 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC25A38 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC25A38 were set to Anemia, sideroblastic, pyridoxine-refractory, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC25A20 |
Zornitza Stark gene: SLC25A20 was added gene: SLC25A20 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC25A20 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC25A20 were set to Carnitine-acylcarnitine translocase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC25A15 |
Zornitza Stark gene: SLC25A15 was added gene: SLC25A15 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC25A15 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC25A15 were set to Hyperornithinemia-hyperammonemia-homocitrullinemia syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC25A13 |
Zornitza Stark gene: SLC25A13 was added gene: SLC25A13 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC25A13 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC25A13 were set to Citrullinemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC22A5 |
Zornitza Stark gene: SLC22A5 was added gene: SLC22A5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC22A5 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC22A5 were set to Carnitine deficiency, systemic primary |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC19A3 |
Zornitza Stark gene: SLC19A3 was added gene: SLC19A3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC19A3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC19A3 were set to Basal ganglia disease, biotin-responsive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC19A2 |
Zornitza Stark gene: SLC19A2 was added gene: SLC19A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC19A2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC19A2 were set to Thiamine-responsive megaloblastic anemia syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC17A5 |
Zornitza Stark gene: SLC17A5 was added gene: SLC17A5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC17A5 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC17A5 were set to Sialic acid storage disorder, infantile |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC16A2 |
Zornitza Stark gene: SLC16A2 was added gene: SLC16A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC16A2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: SLC16A2 were set to Allan-Herndon-Dudley syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC12A6 |
Zornitza Stark gene: SLC12A6 was added gene: SLC12A6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC12A6 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC12A6 were set to Agenesis of the corpus callosum with peripheral neuropathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC12A3 |
Zornitza Stark gene: SLC12A3 was added gene: SLC12A3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC12A3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC12A3 were set to Gitelman syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SLC12A1 |
Zornitza Stark gene: SLC12A1 was added gene: SLC12A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SLC12A1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SLC12A1 were set to Bartter syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SKI |
Zornitza Stark gene: SKI was added gene: SKI was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SKI was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SKI were set to Shprintzen-Goldberg syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SIX3 |
Zornitza Stark gene: SIX3 was added gene: SIX3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SIX3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SIX3 were set to Holoprosencephaly-2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SIX1 |
Zornitza Stark gene: SIX1 was added gene: SIX1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SIX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SIX1 were set to Branchiootorenal syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SIL1 |
Zornitza Stark gene: SIL1 was added gene: SIL1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SIL1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SIL1 were set to Marinesco-Sjogren syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SHH |
Zornitza Stark gene: SHH was added gene: SHH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SHH was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SHH were set to Holoprosencephaly-3 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SHANK3 |
Zornitza Stark gene: SHANK3 was added gene: SHANK3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SHANK3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SHANK3 were set to Phelan-McDermid syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SH3TC2 |
Zornitza Stark gene: SH3TC2 was added gene: SH3TC2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SH3TC2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SH3TC2 were set to Charcot-Marie-Tooth disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SH2D1A |
Zornitza Stark gene: SH2D1A was added gene: SH2D1A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SH2D1A was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: SH2D1A were set to Lymphoproliferative syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SGSH |
Zornitza Stark gene: SGSH was added gene: SGSH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SGSH was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SGSH were set to Mucopolysaccharidisis type IIIA (Sanfilippo A) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SGCG |
Zornitza Stark gene: SGCG was added gene: SGCG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SGCG was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SGCG were set to Muscular dystrophy, limb-girdle, type 2C |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SGCD |
Zornitza Stark gene: SGCD was added gene: SGCD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SGCD was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SGCD were set to Muscular dystrophy, limb-girdle, type 2F |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SGCB |
Zornitza Stark gene: SGCB was added gene: SGCB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SGCB was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SGCB were set to Muscular dystrophy, limb-girdle, type 2E |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SGCA |
Zornitza Stark gene: SGCA was added gene: SGCA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SGCA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SGCA were set to Muscular dystrophy, limb-girdle, type 2D |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SFTPB |
Zornitza Stark gene: SFTPB was added gene: SFTPB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SFTPB was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SFTPB were set to Surfactant metabolism dysfunction, pulmonary |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SETX |
Zornitza Stark gene: SETX was added gene: SETX was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SETX was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SETX were set to Ataxia-ocular apraxia 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SETBP1 |
Zornitza Stark gene: SETBP1 was added gene: SETBP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SETBP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SETBP1 were set to Schinzel-Giedion syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SEPT9 |
Zornitza Stark gene: SEPT9 was added gene: SEPT9 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SEPT9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SEPT9 were set to Amyotrophy, hereditary neuralgic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SELENON |
Zornitza Stark gene: SELENON was added gene: SELENON was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SELENON was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SELENON were set to Myopathy, congenital, with fiber-type disproportion; Muscular dystrophy, rigid spine |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SDHD |
Zornitza Stark gene: SDHD was added gene: SDHD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SDHD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SDHD were set to Hereditary Paraganglioma-Pheochromocytoma Syndromes |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SCO2 |
Zornitza Stark gene: SCO2 was added gene: SCO2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SCO2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SCO2 were set to Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SCNN1B |
Zornitza Stark gene: SCNN1B was added gene: SCNN1B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SCNN1B was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SCNN1B were set to Pseudohypoaldosteronism |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SCNN1A |
Zornitza Stark gene: SCNN1A was added gene: SCNN1A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SCNN1A was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SCNN1A were set to Pseudohypoaldosteronism |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SCN4A |
Zornitza Stark gene: SCN4A was added gene: SCN4A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SCN4A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SCN4A were set to Hyperkalemic periodic paralysis, type 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SCN1A |
Zornitza Stark gene: SCN1A was added gene: SCN1A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SCN1A was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SCN1A were set to Dravet syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SCN11A |
Zornitza Stark gene: SCN11A was added gene: SCN11A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SCN11A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SCN11A were set to Episodic pain syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SBDS |
Zornitza Stark gene: SBDS was added gene: SBDS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SBDS was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SBDS were set to Shwachman-Bodian-Diamond syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SAMHD1 |
Zornitza Stark gene: SAMHD1 was added gene: SAMHD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SAMHD1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SAMHD1 were set to Aicardi-Goutieres syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SALL1 |
Zornitza Stark gene: SALL1 was added gene: SALL1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SALL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: SALL1 were set to Townes-Brocks syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | SACS |
Zornitza Stark gene: SACS was added gene: SACS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: SACS was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: SACS were set to Spastic ataxia Charlevoix-Saguenay type |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RYR2 | Zornitza Stark Added phenotypes Ventricular tachycardia, catecholaminergic polymorphic for gene: RYR2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RYR2 |
Zornitza Stark gene: RYR2 was added gene: RYR2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RYR2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: RYR2 were set to Arrhythmogenic right ventricular dysplasia 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RYR1 | Zornitza Stark Added phenotypes Multiminicore disease for gene: RYR1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RYR1 |
Zornitza Stark Mode of inheritance for gene RYR1 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BIALLELIC, autosomal or pseudoautosomal Added phenotypes Centronuclear myopathy for gene: RYR1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RYR1 |
Zornitza Stark gene: RYR1 was added gene: RYR1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RYR1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: RYR1 were set to Central core disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RUNX2 |
Zornitza Stark gene: RUNX2 was added gene: RUNX2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RUNX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: RUNX2 were set to Cleidocranial dysostosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RSPH9 |
Zornitza Stark gene: RSPH9 was added gene: RSPH9 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RSPH9 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: RSPH9 were set to Ciliary dyskinesia, primary |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RSPH4A |
Zornitza Stark gene: RSPH4A was added gene: RSPH4A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RSPH4A was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: RSPH4A were set to Ciliary dyskinesia, primary |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RS1 |
Zornitza Stark gene: RS1 was added gene: RS1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RS1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: RS1 were set to Retinoschisis, X linked |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RRM2B |
Zornitza Stark gene: RRM2B was added gene: RRM2B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RRM2B was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: RRM2B were set to Mitochondrial DNA depletion syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RPS6KA3 |
Zornitza Stark gene: RPS6KA3 was added gene: RPS6KA3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RPS6KA3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: RPS6KA3 were set to Coffin-Lowry syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RPS26 |
Zornitza Stark gene: RPS26 was added gene: RPS26 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RPS26 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: RPS26 were set to Diamond-Blackfan anemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RPS24 |
Zornitza Stark gene: RPS24 was added gene: RPS24 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RPS24 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: RPS24 were set to Diamond-Blackfan anemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RPS19 |
Zornitza Stark gene: RPS19 was added gene: RPS19 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RPS19 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: RPS19 were set to Diamond-Blackfan anemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RPS17 |
Zornitza Stark gene: RPS17 was added gene: RPS17 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RPS17 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: RPS17 were set to Diamond-Blackfan anemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RPS15 |
Zornitza Stark gene: RPS15 was added gene: RPS15 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RPS15 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: RPS15 were set to Diamond-Blackfan anemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RPL5 |
Zornitza Stark gene: RPL5 was added gene: RPL5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RPL5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: RPL5 were set to Diamond-Blackfan anemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RPL11 |
Zornitza Stark gene: RPL11 was added gene: RPL11 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RPL11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: RPL11 were set to Diamond-Blackfan anemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RPGRIP1L | Zornitza Stark Added phenotypes Joubert syndrome for gene: RPGRIP1L | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RPGRIP1L |
Zornitza Stark gene: RPGRIP1L was added gene: RPGRIP1L was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RPGRIP1L was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: RPGRIP1L were set to Meckel syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RPGR |
Zornitza Stark gene: RPGR was added gene: RPGR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RPGR was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: RPGR were set to Retinitis pigmentosa |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ROR2 |
Zornitza Stark Mode of inheritance for gene ROR2 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Added phenotypes Brachydactyly, type B1 for gene: ROR2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ROR2 |
Zornitza Stark gene: ROR2 was added gene: ROR2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ROR2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ROR2 were set to Robinow syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RNASEH2C |
Zornitza Stark gene: RNASEH2C was added gene: RNASEH2C was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RNASEH2C was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: RNASEH2C were set to Aicardi-Goutieres syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RNASEH2B |
Zornitza Stark gene: RNASEH2B was added gene: RNASEH2B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RNASEH2B was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: RNASEH2B were set to Aicardi-Goutieres syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RNASEH2A |
Zornitza Stark gene: RNASEH2A was added gene: RNASEH2A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RNASEH2A was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: RNASEH2A were set to Aicardi-Goutieres syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RMRP |
Zornitza Stark gene: RMRP was added gene: RMRP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RMRP was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: RMRP were set to Cartilage-hair hypoplasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RET | Zornitza Stark Added phenotypes Multiple endocrine neoplasia IIB for gene: RET | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RET |
Zornitza Stark gene: RET was added gene: RET was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RET was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: RET were set to Multiple endocrine neoplasia IIA |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | REN |
Zornitza Stark gene: REN was added gene: REN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: REN was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: REN were set to Renal tubular dysgenesis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RECQL4 | Zornitza Stark Added phenotypes Rothmund-Thomson syndrome for gene: RECQL4 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RECQL4 | Zornitza Stark Added phenotypes Rapadilino syndrome for gene: RECQL4 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RECQL4 |
Zornitza Stark gene: RECQL4 was added gene: RECQL4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RECQL4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: RECQL4 were set to Baller-Gerold syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RBM8A |
Zornitza Stark gene: RBM8A was added gene: RBM8A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RBM8A was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: RBM8A were set to Thrombocytopaenia-absent radius syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RB1 |
Zornitza Stark gene: RB1 was added gene: RB1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: RB1 were set to Retinoblastoma |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RASA1 |
Zornitza Stark gene: RASA1 was added gene: RASA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RASA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: RASA1 were set to Capillary malformation-arteriovenous malformation |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RAPSN |
Zornitza Stark gene: RAPSN was added gene: RAPSN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RAPSN was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: RAPSN were set to Congenital myasthenic syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RAI1 | Zornitza Stark Added phenotypes Potocki-Lupski syndrome for gene: RAI1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RAI1 |
Zornitza Stark gene: RAI1 was added gene: RAI1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RAI1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: RAI1 were set to Smith-Magenis syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RAG2 |
Zornitza Stark gene: RAG2 was added gene: RAG2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RAG2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: RAG2 were set to Omenn syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RAG1 |
Zornitza Stark gene: RAG1 was added gene: RAG1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RAG1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: RAG1 were set to Omenn syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RAF1 |
Zornitza Stark gene: RAF1 was added gene: RAF1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RAF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: RAF1 were set to Noonan syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RAB7A |
Zornitza Stark gene: RAB7A was added gene: RAB7A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RAB7A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: RAB7A were set to Charcot-Marie-Tooth disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RAB3GAP1 |
Zornitza Stark gene: RAB3GAP1 was added gene: RAB3GAP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RAB3GAP1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: RAB3GAP1 were set to Warburg micro syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RAB27A |
Zornitza Stark gene: RAB27A was added gene: RAB27A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RAB27A was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: RAB27A were set to Griscelli syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | RAB23 |
Zornitza Stark gene: RAB23 was added gene: RAB23 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: RAB23 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: RAB23 were set to Carpenter syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | QDPR |
Zornitza Stark gene: QDPR was added gene: QDPR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: QDPR was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: QDPR were set to Dihydropteridine reductase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PYGL |
Zornitza Stark gene: PYGL was added gene: PYGL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PYGL was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PYGL were set to Glycogen storage disease VI |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PTS |
Zornitza Stark gene: PTS was added gene: PTS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PTS was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PTS were set to Hyperphenylalaninemia, BH4-deficient, A |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CAVIN1 |
Zornitza Stark gene: CAVIN1 was added gene: CAVIN1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CAVIN1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CAVIN1 were set to Lipodystrophy, congenital generalized, type 4 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PTPN11 |
Zornitza Stark gene: PTPN11 was added gene: PTPN11 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PTPN11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PTPN11 were set to Noonan syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PTH1R |
Zornitza Stark gene: PTH1R was added gene: PTH1R was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PTH1R was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PTH1R were set to Metaphyseal chondrodysplasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PTEN | Zornitza Stark Added phenotypes Bannayan-Riley-Ruvalcaba syndrome for gene: PTEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PTEN |
Zornitza Stark gene: PTEN was added gene: PTEN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PTEN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PTEN were set to Cowden disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PTCH1 |
Zornitza Stark gene: PTCH1 was added gene: PTCH1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PTCH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PTCH1 were set to Nevoid basal cell carcinoma syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PSAP |
Zornitza Stark gene: PSAP was added gene: PSAP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PSAP was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PSAP were set to Metachromatic leukodystrophy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PRX |
Zornitza Stark gene: PRX was added gene: PRX was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PRX was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PRX were set to Charcot-Marie-Tooth disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PROS1 |
Zornitza Stark gene: PROS1 was added gene: PROS1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PROS1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PROS1 were set to Protein S deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PROP1 |
Zornitza Stark gene: PROP1 was added gene: PROP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PROP1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PROP1 were set to Pituitary hormone deficiency, combined, 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PROKR2 |
Zornitza Stark gene: PROKR2 was added gene: PROKR2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PROKR2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PROKR2 were set to Hypogonadotropic hypogonadism |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PROC |
Zornitza Stark gene: PROC was added gene: PROC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PROC was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PROC were set to Thrombophilia due to protein C deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PRKAR1A |
Zornitza Stark gene: PRKAR1A was added gene: PRKAR1A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PRKAR1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PRKAR1A were set to Carney complex |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PRKAG2 |
Zornitza Stark gene: PRKAG2 was added gene: PRKAG2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PRKAG2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PRKAG2 were set to Wolff-Parkinson-White syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PRF1 |
Zornitza Stark gene: PRF1 was added gene: PRF1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PRF1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PRF1 were set to Hemophagocytic lymphohistiocytosis, familial, 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PQBP1 |
Zornitza Stark gene: PQBP1 was added gene: PQBP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PQBP1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: PQBP1 were set to Mental retardation |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PPT1 |
Zornitza Stark gene: PPT1 was added gene: PPT1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PPT1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PPT1 were set to Neuronal ceroid lipofuscinosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | POU4F3 |
Zornitza Stark gene: POU4F3 was added gene: POU4F3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: POU4F3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: POU4F3 were set to Deafness, autosomal dominant |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | POU3F4 |
Zornitza Stark gene: POU3F4 was added gene: POU3F4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: POU3F4 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: POU3F4 were set to Deafness, X-linked |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | POU1F1 |
Zornitza Stark gene: POU1F1 was added gene: POU1F1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: POU1F1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: POU1F1 were set to Pituitary hormone deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PORCN |
Zornitza Stark gene: PORCN was added gene: PORCN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PORCN was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: PORCN were set to Focal dermal hypoplasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | POR |
Zornitza Stark gene: POR was added gene: POR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: POR was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: POR were set to Disordered steroidogenesis with and without Antley-Bixler syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | POMT2 |
Zornitza Stark gene: POMT2 was added gene: POMT2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: POMT2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: POMT2 were set to Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | POMT1 | Zornitza Stark Added phenotypes Walker-Warburg syndrome for gene: POMT1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | POMT1 |
Zornitza Stark gene: POMT1 was added gene: POMT1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: POMT1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: POMT1 were set to Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | POMGNT1 | Zornitza Stark Added phenotypes Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 3 for gene: POMGNT1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | POMGNT1 |
Zornitza Stark gene: POMGNT1 was added gene: POMGNT1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: POMGNT1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: POMGNT1 were set to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | POLH |
Zornitza Stark gene: POLH was added gene: POLH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: POLH was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: POLH were set to Xeroderma pigmentosum |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | POLG |
Zornitza Stark gene: POLG was added gene: POLG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: POLG was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: POLG were set to POLG-Related Ataxia Neuropathy Spectrum Disorders |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PNPO |
Zornitza Stark gene: PNPO was added gene: PNPO was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PNPO was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PNPO were set to Epileptic encephalopathy, neonatal |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PNKP |
Zornitza Stark gene: PNKP was added gene: PNKP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PNKP was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PNKP were set to Microcephaly - seizures - developmental delay |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PNKD |
Zornitza Stark gene: PNKD was added gene: PNKD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PNKD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PNKD were set to Paroxysmal nonkinesiogenic dyskinesia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PMP22 |
Zornitza Stark gene: PMP22 was added gene: PMP22 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PMP22 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PMP22 were set to Charcot-Marie-Tooth disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PMM2 |
Zornitza Stark gene: PMM2 was added gene: PMM2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PMM2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PMM2 were set to Congenital disorder of glycosylation, type Ia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PLP1 | Zornitza Stark Added phenotypes Spastic paraplegia 2, X-linked for gene: PLP1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PLP1 |
Zornitza Stark gene: PLP1 was added gene: PLP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PLP1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: PLP1 were set to Pelizaeus-Merzbacher disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PLOD1 |
Zornitza Stark gene: PLOD1 was added gene: PLOD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PLOD1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PLOD1 were set to Ehlers-Danlos syndrome, kyphoscoliotic type |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PLG |
Zornitza Stark gene: PLG was added gene: PLG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PLG was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PLG were set to Plasminogen deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PLEC | Zornitza Stark Added phenotypes Muscular dystrophy for gene: PLEC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PLEC |
Zornitza Stark gene: PLEC was added gene: PLEC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PLEC was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PLEC were set to Epidermolysis bullosa simplex |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PLCE1 |
Zornitza Stark gene: PLCE1 was added gene: PLCE1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PLCE1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PLCE1 were set to Nephrotic syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PLA2G6 |
Zornitza Stark gene: PLA2G6 was added gene: PLA2G6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PLA2G6 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PLA2G6 were set to Infantile neuroaxonal dystrophy 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PKLR |
Zornitza Stark gene: PKLR was added gene: PKLR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PKLR was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PKLR were set to Pyruvate kinase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PKHD1 |
Zornitza Stark gene: PKHD1 was added gene: PKHD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PKHD1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PKHD1 were set to Polycystic kidney and hepatic disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PKD2 |
Zornitza Stark gene: PKD2 was added gene: PKD2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PKD2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PKD2 were set to Polycystic kidney disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PKD1 |
Zornitza Stark gene: PKD1 was added gene: PKD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PKD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PKD1 were set to Polycystic kidney disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PINK1 |
Zornitza Stark gene: PINK1 was added gene: PINK1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PINK1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PINK1 were set to Parkinson disease 6, early onset |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PIEZO2 |
Zornitza Stark gene: PIEZO2 was added gene: PIEZO2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PIEZO2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PIEZO2 were set to Arthrogryposis, distal, type 5 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PHYH |
Zornitza Stark gene: PHYH was added gene: PHYH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PHYH was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PHYH were set to Refsum disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PHKG2 |
Zornitza Stark gene: PHKG2 was added gene: PHKG2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PHKG2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PHKG2 were set to Phosphorylase kinase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PHKB |
Zornitza Stark gene: PHKB was added gene: PHKB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PHKB was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PHKB were set to Phosphorylase kinase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PHKA2 |
Zornitza Stark gene: PHKA2 was added gene: PHKA2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PHKA2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: PHKA2 were set to Phosphorylase kinase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PHF6 |
Zornitza Stark gene: PHF6 was added gene: PHF6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PHF6 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: PHF6 were set to Borjeson-Forssman-Lehmann syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PFKM |
Zornitza Stark gene: PFKM was added gene: PFKM was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PFKM was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PFKM were set to Glycogen storage disease 7 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PEX7 | Zornitza Stark Added phenotypes Rhizomelic chondrodysplasia punctata for gene: PEX7 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PEX7 |
Zornitza Stark gene: PEX7 was added gene: PEX7 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PEX7 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PEX7 were set to Refsum disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PEX6 |
Zornitza Stark gene: PEX6 was added gene: PEX6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PEX6 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PEX6 were set to Zellweger syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PEX5 |
Zornitza Stark gene: PEX5 was added gene: PEX5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PEX5 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PEX5 were set to Zellweger syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PEX3 |
Zornitza Stark gene: PEX3 was added gene: PEX3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PEX3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PEX3 were set to Zellweger syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PEX26 |
Zornitza Stark gene: PEX26 was added gene: PEX26 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PEX26 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PEX26 were set to Zellweger syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PEX2 |
Zornitza Stark gene: PEX2 was added gene: PEX2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PEX2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PEX2 were set to Zellweger syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PEX13 |
Zornitza Stark gene: PEX13 was added gene: PEX13 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PEX13 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PEX13 were set to Zellweger syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PEX12 |
Zornitza Stark gene: PEX12 was added gene: PEX12 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PEX12 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PEX12 were set to Zellweger syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PEX10 |
Zornitza Stark gene: PEX10 was added gene: PEX10 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PEX10 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PEX10 were set to Zellweger syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PEX1 |
Zornitza Stark gene: PEX1 was added gene: PEX1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PEX1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PEX1 were set to Zellweger syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PDHX |
Zornitza Stark gene: PDHX was added gene: PDHX was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PDHX was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PDHX were set to Pyruvate dehydrogenase complex deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PDHA1 |
Zornitza Stark gene: PDHA1 was added gene: PDHA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PDHA1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: PDHA1 were set to Pyruvate dehydrogenase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PDE4D |
Zornitza Stark gene: PDE4D was added gene: PDE4D was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PDE4D was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PDE4D were set to Acrodysostosis 2, with or without hormone resistance |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PCNT |
Zornitza Stark gene: PCNT was added gene: PCNT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PCNT was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PCNT were set to Microcephalic osteodysplastic primordial dwarfism type 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PCDH15 |
Zornitza Stark gene: PCDH15 was added gene: PCDH15 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PCDH15 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PCDH15 were set to Usher syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PCCB |
Zornitza Stark gene: PCCB was added gene: PCCB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PCCB was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PCCB were set to Propionicacidemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PCCA |
Zornitza Stark gene: PCCA was added gene: PCCA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PCCA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PCCA were set to Propionicacidemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PC |
Zornitza Stark gene: PC was added gene: PC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PC was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PC were set to Pyruvate carboxylase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PAX8 |
Zornitza Stark gene: PAX8 was added gene: PAX8 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PAX8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PAX8 were set to Hypothyroidism, congenital, due to thyroid dysgenesis or hypoplasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PAX6 |
Zornitza Stark gene: PAX6 was added gene: PAX6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PAX6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PAX6 were set to Aniridia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PAX3 |
Zornitza Stark gene: PAX3 was added gene: PAX3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PAX3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: PAX3 were set to Waardenburg syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PANK2 |
Zornitza Stark gene: PANK2 was added gene: PANK2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PANK2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PANK2 were set to Neurodegeneration with brain iron accumulation 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PAK3 |
Zornitza Stark gene: PAK3 was added gene: PAK3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PAK3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: PAK3 were set to Mental retardation syndrome, X-linked |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PAH |
Zornitza Stark gene: PAH was added gene: PAH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PAH was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PAH were set to Phenylketonuria |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | OTOGL |
Zornitza Stark gene: OTOGL was added gene: OTOGL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: OTOGL was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: OTOGL were set to Deafness, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | OTOF |
Zornitza Stark gene: OTOF was added gene: OTOF was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: OTOF was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: OTOF were set to Deafness, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | OTOA |
Zornitza Stark gene: OTOA was added gene: OTOA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: OTOA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: OTOA were set to Deafness, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | OTC |
Zornitza Stark gene: OTC was added gene: OTC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: OTC was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: OTC were set to Ornithine transcarbamylase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | OSTM1 |
Zornitza Stark gene: OSTM1 was added gene: OSTM1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: OSTM1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: OSTM1 were set to Osteopetrosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | OSMR |
Zornitza Stark gene: OSMR was added gene: OSMR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: OSMR was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: OSMR were set to Amyloidosis, primary cutaneous |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ORC1 |
Zornitza Stark gene: ORC1 was added gene: ORC1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ORC1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ORC1 were set to Meier-Gorlin syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | OPA3 |
Zornitza Stark gene: OPA3 was added gene: OPA3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: OPA3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: OPA3 were set to 3-methylglutaconic aciduria, type III |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | OPA1 |
Zornitza Stark gene: OPA1 was added gene: OPA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: OPA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: OPA1 were set to Optic atrophy 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | OFD1 |
Zornitza Stark gene: OFD1 was added gene: OFD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: OFD1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: OFD1 were set to Oral-facial-digital syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | OCRL |
Zornitza Stark gene: OCRL was added gene: OCRL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: OCRL was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: OCRL were set to Lowe oculocerebrorenal syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | OCA2 |
Zornitza Stark gene: OCA2 was added gene: OCA2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: OCA2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: OCA2 were set to Albinism, oculocutaneous |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | OBSL1 |
Zornitza Stark gene: OBSL1 was added gene: OBSL1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: OBSL1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: OBSL1 were set to 3-M syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NTRK1 |
Zornitza Stark gene: NTRK1 was added gene: NTRK1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: NTRK1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NTRK1 were set to Congenital insensitivity to pain with anhidrosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NSDHL |
Zornitza Stark gene: NSDHL was added gene: NSDHL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: NSDHL was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: NSDHL were set to CHILD syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NSD1 |
Zornitza Stark gene: NSD1 was added gene: NSD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: NSD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: NSD1 were set to Sotos syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NR0B1 |
Zornitza Stark gene: NR0B1 was added gene: NR0B1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: NR0B1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: NR0B1 were set to Congenital adrenal hypoplasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NPHS1 |
Zornitza Stark gene: NPHS1 was added gene: NPHS1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: NPHS1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NPHS1 were set to Congenital nephrotic syndrome, Finnish type |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NPHP4 |
Zornitza Stark gene: NPHP4 was added gene: NPHP4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: NPHP4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NPHP4 were set to Nephronophthisis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NPHP3 |
Zornitza Stark gene: NPHP3 was added gene: NPHP3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: NPHP3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NPHP3 were set to Nephronophthisis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NPHP1 |
Zornitza Stark gene: NPHP1 was added gene: NPHP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: NPHP1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NPHP1 were set to Nephronophthisis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NPC2 |
Zornitza Stark gene: NPC2 was added gene: NPC2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: NPC2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NPC2 were set to Niemann-Pick disease type C2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NPC1 |
Zornitza Stark gene: NPC1 was added gene: NPC1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: NPC1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NPC1 were set to Niemann-Pick disease type C1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NOTCH3 |
Zornitza Stark gene: NOTCH3 was added gene: NOTCH3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: NOTCH3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: NOTCH3 were set to Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NOTCH2 |
Zornitza Stark gene: NOTCH2 was added gene: NOTCH2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: NOTCH2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: NOTCH2 were set to Hajdu-Cheney syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NOG |
Zornitza Stark gene: NOG was added gene: NOG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: NOG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: NOG were set to Symphalangism, proximal, 1A |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NKX2-1 |
Zornitza Stark gene: NKX2-1 was added gene: NKX2-1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: NKX2-1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: NKX2-1 were set to Choreoathetosis, hypothyroidism, and neonatal respiratory distress |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NIPBL |
Zornitza Stark gene: NIPBL was added gene: NIPBL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: NIPBL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: NIPBL were set to Cornelia de Lange syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NIPAL4 |
Zornitza Stark gene: NIPAL4 was added gene: NIPAL4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: NIPAL4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NIPAL4 were set to Ichthyosis, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NHLRC1 |
Zornitza Stark gene: NHLRC1 was added gene: NHLRC1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: NHLRC1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NHLRC1 were set to Myoclonic epilepsy of Lafora |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NHEJ1 |
Zornitza Stark gene: NHEJ1 was added gene: NHEJ1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: NHEJ1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NHEJ1 were set to Severe combined immunodeficiency with microcephaly, growth retardation, and sensitivity to ionizing radiation |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NGLY1 |
Zornitza Stark gene: NGLY1 was added gene: NGLY1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: NGLY1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NGLY1 were set to Developmental delay, multifocal epilepsy & abnormal liver function |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NF2 |
Zornitza Stark gene: NF2 was added gene: NF2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: NF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: NF2 were set to Neurofibromatosis 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NF1 |
Zornitza Stark gene: NF1 was added gene: NF1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: NF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: NF1 were set to Neurofibromatosis, type 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NEU1 |
Zornitza Stark gene: NEU1 was added gene: NEU1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: NEU1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NEU1 were set to Sialidosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NEFL |
Zornitza Stark gene: NEFL was added gene: NEFL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: NEFL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: NEFL were set to Charcot-Marie-Tooth disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NEB |
Zornitza Stark gene: NEB was added gene: NEB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: NEB was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NEB were set to Nemaline myopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NDP |
Zornitza Stark gene: NDP was added gene: NDP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: NDP was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: NDP were set to Norrie disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NCF2 |
Zornitza Stark gene: NCF2 was added gene: NCF2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: NCF2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NCF2 were set to Chronic granulomatous disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NCF1 |
Zornitza Stark gene: NCF1 was added gene: NCF1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: NCF1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NCF1 were set to Chronic granulomatous disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NBN |
Zornitza Stark gene: NBN was added gene: NBN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: NBN was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NBN were set to Nijmegen breakage syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NAGS |
Zornitza Stark gene: NAGS was added gene: NAGS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: NAGS was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NAGS were set to N-acetylglutamate synthetase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NAGLU |
Zornitza Stark gene: NAGLU was added gene: NAGLU was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: NAGLU was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NAGLU were set to Sanfilippo syndrome type B |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | NAGA |
Zornitza Stark gene: NAGA was added gene: NAGA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: NAGA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: NAGA were set to N-acetylgalactosaminidase alpha deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYO7A |
Zornitza Stark gene: MYO7A was added gene: MYO7A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MYO7A was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MYO7A were set to Usher syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYO6 |
Zornitza Stark gene: MYO6 was added gene: MYO6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MYO6 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MYO6 were set to Deafness |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYO3A |
Zornitza Stark gene: MYO3A was added gene: MYO3A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MYO3A was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MYO3A were set to Sensorineural hearing loss |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYO15A |
Zornitza Stark gene: MYO15A was added gene: MYO15A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MYO15A was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MYO15A were set to Sensorineural hearing loss |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYH9 |
Zornitza Stark gene: MYH9 was added gene: MYH9 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MYH9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MYH9 were set to Macrothrombocytopenia and progressive sensorineural deafness |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYH7 | Zornitza Stark Added phenotypes Myopathy, myosin storage for gene: MYH7 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYH7 |
Zornitza Stark gene: MYH7 was added gene: MYH7 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MYH7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MYH7 were set to Laing distal myopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYH3 |
Zornitza Stark gene: MYH3 was added gene: MYH3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MYH3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MYH3 were set to Arthrogryposis, distal |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYH2 |
Zornitza Stark gene: MYH2 was added gene: MYH2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MYH2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MYH2 were set to Proximal myopathy and ophthalmoplegia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYH14 |
Zornitza Stark gene: MYH14 was added gene: MYH14 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MYH14 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MYH14 were set to Deafness, autosomal dominant |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MYCN |
Zornitza Stark gene: MYCN was added gene: MYCN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MYCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MYCN were set to Feingold syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MVK |
Zornitza Stark gene: MVK was added gene: MVK was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MVK was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MVK were set to Hyperimmunoglobulin D and periodic fever syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MUTYH |
Zornitza Stark gene: MUTYH was added gene: MUTYH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MUTYH was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MUTYH were set to MUTYH-associated polyposis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MUT |
Zornitza Stark gene: MUT was added gene: MUT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MUT was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MUT were set to Methylmalonic aciduria, mut(0) type |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MUSK |
Zornitza Stark gene: MUSK was added gene: MUSK was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MUSK was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MUSK were set to Congenital myasthenic syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MTTP |
Zornitza Stark gene: MTTP was added gene: MTTP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MTTP was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MTTP were set to Abetalipoproteinaemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MTRR |
Zornitza Stark gene: MTRR was added gene: MTRR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MTRR was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MTRR were set to Methylmalonic aciduria and homocystinuria |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MTR |
Zornitza Stark gene: MTR was added gene: MTR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MTR was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MTR were set to Methylmalonic aciduria and homocystinuria |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MTM1 |
Zornitza Stark gene: MTM1 was added gene: MTM1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MTM1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: MTM1 were set to Myotubular myopathy, X-linked |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MSX2 |
Zornitza Stark gene: MSX2 was added gene: MSX2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MSX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MSX2 were set to Parietal foramina 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MPZ |
Zornitza Stark gene: MPZ was added gene: MPZ was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MPZ was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MPZ were set to Charcot-Marie-Tooth disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MPV17 |
Zornitza Stark gene: MPV17 was added gene: MPV17 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MPV17 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MPV17 were set to Mitochondrial DNA depletion syndrome, hepatic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MPL |
Zornitza Stark gene: MPL was added gene: MPL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MPL was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MPL were set to Amegakaryocytic thrombocytopaenia, congenital |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MPI |
Zornitza Stark gene: MPI was added gene: MPI was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MPI was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MPI were set to Congenital disorder of glycosylation 1b |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MOCS2 |
Zornitza Stark gene: MOCS2 was added gene: MOCS2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MOCS2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MOCS2 were set to Molybdenum cofactor deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MOCS1 |
Zornitza Stark gene: MOCS1 was added gene: MOCS1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MOCS1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MOCS1 were set to Molybdenum cofactor deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MMADHC |
Zornitza Stark gene: MMADHC was added gene: MMADHC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MMADHC was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MMADHC were set to Methylmalonic aciduria and homocystinuria, cblD type |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MMACHC |
Zornitza Stark gene: MMACHC was added gene: MMACHC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MMACHC was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MMACHC were set to Methylmalonic aciduria and homocystinuria, cblC type |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MMAB |
Zornitza Stark gene: MMAB was added gene: MMAB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MMAB was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MMAB were set to Methylmalonic aciduria, vitamin B12-responsive, due to defect in synthesis of adenosylcobalamin, cblB complementation type |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MMAA |
Zornitza Stark gene: MMAA was added gene: MMAA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MMAA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MMAA were set to Methylmalonic aciduria, vitamin B12-responsive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MLYCD |
Zornitza Stark gene: MLYCD was added gene: MLYCD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MLYCD was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MLYCD were set to Malonyl-CoA decarboxylase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MLC1 |
Zornitza Stark gene: MLC1 was added gene: MLC1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MLC1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MLC1 were set to Megalencephalic leukoencephalopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MKS1 |
Zornitza Stark gene: MKS1 was added gene: MKS1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MKS1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MKS1 were set to Meckel syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MKKS |
Zornitza Stark gene: MKKS was added gene: MKKS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MKKS was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MKKS were set to Bardet-Biedl syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MITF |
Zornitza Stark gene: MITF was added gene: MITF was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MITF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MITF were set to Waardenburg syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MGP |
Zornitza Stark gene: MGP was added gene: MGP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MGP was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MGP were set to Keutel syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MFSD8 |
Zornitza Stark gene: MFSD8 was added gene: MFSD8 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MFSD8 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MFSD8 were set to Ceroid lipofuscinosis, neuronal |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MFN2 |
Zornitza Stark gene: MFN2 was added gene: MFN2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MFN2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MFN2 were set to Charcot-Marie-Tooth disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MEN1 |
Zornitza Stark gene: MEN1 was added gene: MEN1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MEN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MEN1 were set to Multiple endocrine neoplasia I |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MEGF10 |
Zornitza Stark gene: MEGF10 was added gene: MEGF10 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MEGF10 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MEGF10 were set to Myopathy, areflexia, respiratory distress, and dysphagia, early-onset |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MEFV |
Zornitza Stark gene: MEFV was added gene: MEFV was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MEFV was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MEFV were set to Mediterranean fever, familial |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MED12 |
Zornitza Stark gene: MED12 was added gene: MED12 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MED12 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: MED12 were set to Intellectual disability |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MECP2 |
Zornitza Stark gene: MECP2 was added gene: MECP2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MECP2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: MECP2 were set to Rett syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MCPH1 |
Zornitza Stark gene: MCPH1 was added gene: MCPH1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MCPH1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MCPH1 were set to Microcephaly 1, primary, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MCOLN1 |
Zornitza Stark gene: MCOLN1 was added gene: MCOLN1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MCOLN1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MCOLN1 were set to Mucolipidosis IV |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MCFD2 |
Zornitza Stark gene: MCFD2 was added gene: MCFD2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MCFD2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MCFD2 were set to Factor V and Factor VIII deficiency, combined |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MBTPS2 |
Zornitza Stark gene: MBTPS2 was added gene: MBTPS2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MBTPS2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: MBTPS2 were set to Ichthyosis follicularis, alopecia & photophobia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MARVELD2 |
Zornitza Stark gene: MARVELD2 was added gene: MARVELD2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MARVELD2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MARVELD2 were set to Deafness, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MAP2K2 |
Zornitza Stark gene: MAP2K2 was added gene: MAP2K2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MAP2K2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MAP2K2 were set to Cardiofaciocutaneous syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MAP2K1 |
Zornitza Stark gene: MAP2K1 was added gene: MAP2K1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MAP2K1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MAP2K1 were set to Cardiofaciocutaneous syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MAN2B1 |
Zornitza Stark gene: MAN2B1 was added gene: MAN2B1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MAN2B1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: MAN2B1 were set to Mannosidosis, alpha |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MAGI2 |
Zornitza Stark gene: MAGI2 was added gene: MAGI2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MAGI2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MAGI2 were set to Infantile spasms |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | MAFB |
Zornitza Stark gene: MAFB was added gene: MAFB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: MAFB was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: MAFB were set to Multicentric carpotarsal osteolysis syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LYST |
Zornitza Stark gene: LYST was added gene: LYST was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: LYST was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: LYST were set to Chediak-Higashi syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LTBP4 |
Zornitza Stark gene: LTBP4 was added gene: LTBP4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: LTBP4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: LTBP4 were set to Cutis laxa, autosomal recessive, type IC |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LRTOMT |
Zornitza Stark gene: LRTOMT was added gene: LRTOMT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: LRTOMT was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: LRTOMT were set to Deafness, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LRSAM1 |
Zornitza Stark gene: LRSAM1 was added gene: LRSAM1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: LRSAM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: LRSAM1 were set to Charcot-Marie-Tooth disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LRRC6 |
Zornitza Stark gene: LRRC6 was added gene: LRRC6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: LRRC6 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: LRRC6 were set to Primary ciliary dyskinesia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LRPPRC |
Zornitza Stark gene: LRPPRC was added gene: LRPPRC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: LRPPRC was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: LRPPRC were set to Leigh syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LRP5 |
Zornitza Stark Mode of inheritance for gene LRP5 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Added phenotypes Osteopetrosis, autosomal dominant for gene: LRP5 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LRP5 |
Zornitza Stark gene: LRP5 was added gene: LRP5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: LRP5 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: LRP5 were set to Osteoporosis-pseudoglioma syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LRP4 |
Zornitza Stark gene: LRP4 was added gene: LRP4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: LRP4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: LRP4 were set to Cenani-Lenz syndactyly syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LRP2 |
Zornitza Stark gene: LRP2 was added gene: LRP2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: LRP2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: LRP2 were set to Donnai-Barrow syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LOXHD1 |
Zornitza Stark gene: LOXHD1 was added gene: LOXHD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: LOXHD1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: LOXHD1 were set to Deafness, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LMX1B |
Zornitza Stark gene: LMX1B was added gene: LMX1B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: LMX1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: LMX1B were set to Nail patella syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LMOD3 |
Zornitza Stark gene: LMOD3 was added gene: LMOD3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: LMOD3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: LMOD3 were set to Nemaline myopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LMNA |
Zornitza Stark Mode of inheritance for gene LMNA was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BIALLELIC, autosomal or pseudoautosomal Added phenotypes Charcot-Marie-Tooth disease for gene: LMNA |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LMNA |
Zornitza Stark gene: LMNA was added gene: LMNA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: LMNA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: LMNA were set to Emery-Dreifuss muscular dystrophy 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LMBRD1 |
Zornitza Stark gene: LMBRD1 was added gene: LMBRD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: LMBRD1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: LMBRD1 were set to Methylmalonic aciduria and homocystinuria |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LITAF |
Zornitza Stark gene: LITAF was added gene: LITAF was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: LITAF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: LITAF were set to Charcot-Marie-Tooth disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LIPA |
Zornitza Stark gene: LIPA was added gene: LIPA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: LIPA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: LIPA were set to Wolman syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LIG4 |
Zornitza Stark gene: LIG4 was added gene: LIG4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: LIG4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: LIG4 were set to Severe combined immunodeficiency with sensitivity to ionizing radiation |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LIFR |
Zornitza Stark gene: LIFR was added gene: LIFR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: LIFR was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: LIFR were set to Stuve-Wiedemann syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LHX3 |
Zornitza Stark gene: LHX3 was added gene: LHX3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: LHX3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: LHX3 were set to Pituitary hormone deficiency, combined |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LHFPL5 |
Zornitza Stark gene: LHFPL5 was added gene: LHFPL5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: LHFPL5 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: LHFPL5 were set to Deafness, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LEPR |
Zornitza Stark gene: LEPR was added gene: LEPR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: LEPR was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: LEPR were set to Obesity, morbid, due to leptin receptor deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LDLR |
Zornitza Stark gene: LDLR was added gene: LDLR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: LDLR was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: LDLR were set to Hypercholesterolemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LBR |
Zornitza Stark gene: LBR was added gene: LBR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: LBR was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: LBR were set to Pelger-Huet anomaly |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LARGE1 |
Zornitza Stark gene: LARGE1 was added gene: LARGE1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: LARGE1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: LARGE1 were set to Walker-Warburg syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LAMP2 |
Zornitza Stark gene: LAMP2 was added gene: LAMP2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: LAMP2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: LAMP2 were set to Danon disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LAMC2 |
Zornitza Stark gene: LAMC2 was added gene: LAMC2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: LAMC2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: LAMC2 were set to Epidermolysis bullosa, junctional |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LAMB3 |
Zornitza Stark gene: LAMB3 was added gene: LAMB3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: LAMB3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: LAMB3 were set to Epidermolysis bullosa, junctional |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LAMB2 |
Zornitza Stark gene: LAMB2 was added gene: LAMB2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: LAMB2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: LAMB2 were set to Pierson syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LAMA3 |
Zornitza Stark gene: LAMA3 was added gene: LAMA3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: LAMA3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: LAMA3 were set to Epidermolysis bullosa, junctional |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | LAMA2 |
Zornitza Stark gene: LAMA2 was added gene: LAMA2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: LAMA2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: LAMA2 were set to Muscular dystrophy, congenital merosin-deficient |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | L1CAM |
Zornitza Stark gene: L1CAM was added gene: L1CAM was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: L1CAM was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: L1CAM were set to X-linked hydrocephalus syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KRT6A |
Zornitza Stark gene: KRT6A was added gene: KRT6A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: KRT6A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KRT6A were set to Pachyonychia congenita |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KRT5 |
Zornitza Stark gene: KRT5 was added gene: KRT5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: KRT5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KRT5 were set to Epidermolysis bullosa simplex |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KRT17 |
Zornitza Stark gene: KRT17 was added gene: KRT17 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: KRT17 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KRT17 were set to Pachyonychia congenita |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KRT16 |
Zornitza Stark gene: KRT16 was added gene: KRT16 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: KRT16 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KRT16 were set to Pachyonychia congenita |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KRT14 |
Zornitza Stark gene: KRT14 was added gene: KRT14 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: KRT14 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KRT14 were set to Epidermolysis bullosa simplex |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KRAS |
Zornitza Stark gene: KRAS was added gene: KRAS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: KRAS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KRAS were set to Noonan syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KMT2D |
Zornitza Stark gene: KMT2D was added gene: KMT2D was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: KMT2D was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KMT2D were set to Kabuki syndrome 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KLHL41 |
Zornitza Stark gene: KLHL41 was added gene: KLHL41 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: KLHL41 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: KLHL41 were set to Nemaline myopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KLHL40 |
Zornitza Stark gene: KLHL40 was added gene: KLHL40 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: KLHL40 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: KLHL40 were set to Nemaline myopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KIT |
Zornitza Stark gene: KIT was added gene: KIT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: KIT was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KIT were set to Piebaldism |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KIF21A |
Zornitza Stark gene: KIF21A was added gene: KIF21A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: KIF21A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KIF21A were set to Fibrosis of extraocular muscles, congenital |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KDM6A |
Zornitza Stark gene: KDM6A was added gene: KDM6A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: KDM6A was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: KDM6A were set to Kabuki syndrome 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KCTD7 |
Zornitza Stark gene: KCTD7 was added gene: KCTD7 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: KCTD7 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: KCTD7 were set to Epilepsy, progressive myoclonic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KCNQ4 |
Zornitza Stark gene: KCNQ4 was added gene: KCNQ4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: KCNQ4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KCNQ4 were set to Deafness, autosomal dominant |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KCNQ1 |
Zornitza Stark gene: KCNQ1 was added gene: KCNQ1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: KCNQ1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: KCNQ1 were set to Jervell and Lange-Nielsen syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KCNJ2 |
Zornitza Stark gene: KCNJ2 was added gene: KCNJ2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: KCNJ2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KCNJ2 were set to Andersen cardiodysrhythmic periodic paralysis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KCNJ11 |
Zornitza Stark gene: KCNJ11 was added gene: KCNJ11 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: KCNJ11 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: KCNJ11 were set to Hyperinsulinemic hypoglycemia, familial |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KCNJ1 |
Zornitza Stark gene: KCNJ1 was added gene: KCNJ1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: KCNJ1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: KCNJ1 were set to Bartter syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KCNE1 |
Zornitza Stark gene: KCNE1 was added gene: KCNE1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: KCNE1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: KCNE1 were set to Jervell and Lange-Nielsen syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KCNA1 |
Zornitza Stark gene: KCNA1 was added gene: KCNA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: KCNA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KCNA1 were set to Episodic ataxia type 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KBTBD13 |
Zornitza Stark gene: KBTBD13 was added gene: KBTBD13 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: KBTBD13 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KBTBD13 were set to Nemaline myopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KAT6B |
Zornitza Stark gene: KAT6B was added gene: KAT6B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: KAT6B was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: KAT6B were set to Genitopatellar syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | KANSL1 |
Zornitza Stark gene: KANSL1 was added gene: KANSL1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: KANSL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: KANSL1 were set to Koolen-De Vries syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | JUP |
Zornitza Stark gene: JUP was added gene: JUP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: JUP was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: JUP were set to Naxos disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | JAK3 |
Zornitza Stark gene: JAK3 was added gene: JAK3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: JAK3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: JAK3 were set to SCID, autosomal recessive, T-negative/B-positive type |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | JAG1 |
Zornitza Stark gene: JAG1 was added gene: JAG1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: JAG1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: JAG1 were set to Alagille syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | IVD |
Zornitza Stark gene: IVD was added gene: IVD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: IVD was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: IVD were set to Isovaleric acidemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ITGB4 |
Zornitza Stark gene: ITGB4 was added gene: ITGB4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ITGB4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ITGB4 were set to Epidermolysis bullosa, junctional, with pyloric atresia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ISPD |
Zornitza Stark gene: ISPD was added gene: ISPD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ISPD was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ISPD were set to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | IRF6 |
Zornitza Stark gene: IRF6 was added gene: IRF6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: IRF6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: IRF6 were set to van der Woude syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | IQCB1 |
Zornitza Stark gene: IQCB1 was added gene: IQCB1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: IQCB1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: IQCB1 were set to Senior-Loken syndrome 5 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | INVS |
Zornitza Stark gene: INVS was added gene: INVS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: INVS was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: INVS were set to Nephronophthisis 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | INSR |
Zornitza Stark gene: INSR was added gene: INSR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: INSR was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: INSR were set to Leprechaunism |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ILDR1 |
Zornitza Stark gene: ILDR1 was added gene: ILDR1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ILDR1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ILDR1 were set to Deafness, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | IL2RG |
Zornitza Stark gene: IL2RG was added gene: IL2RG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: IL2RG was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: IL2RG were set to Severe combined immunodeficiency, X-linked |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | IL10RA |
Zornitza Stark gene: IL10RA was added gene: IL10RA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: IL10RA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: IL10RA were set to Inflammatory bowel disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | IKBKG |
Zornitza Stark gene: IKBKG was added gene: IKBKG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: IKBKG was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: IKBKG were set to Incontinentia pigmenti 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ELP1 |
Zornitza Stark gene: ELP1 was added gene: ELP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ELP1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ELP1 were set to Dysautonomia, familial |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | IGSF1 |
Zornitza Stark gene: IGSF1 was added gene: IGSF1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: IGSF1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: IGSF1 were set to Central hypothyroidism and testicular enlargement |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | IGHMBP2 |
Zornitza Stark gene: IGHMBP2 was added gene: IGHMBP2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: IGHMBP2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: IGHMBP2 were set to Spinal muscular atrophy with respiratory distress |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | IDUA |
Zornitza Stark gene: IDUA was added gene: IDUA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: IDUA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: IDUA were set to Mucopolysaccharidosis Ih |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | IDS |
Zornitza Stark gene: IDS was added gene: IDS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: IDS was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: IDS were set to Mucopolysaccharidosis II |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HTRA1 |
Zornitza Stark gene: HTRA1 was added gene: HTRA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: HTRA1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HTRA1 were set to CARASIL syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HSPG2 |
Zornitza Stark gene: HSPG2 was added gene: HSPG2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: HSPG2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HSPG2 were set to Schwartz-Jampel syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HSPB8 |
Zornitza Stark gene: HSPB8 was added gene: HSPB8 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: HSPB8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: HSPB8 were set to Charcot-Marie-Tooth disease, axonal, type 2L |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HSD3B7 |
Zornitza Stark gene: HSD3B7 was added gene: HSD3B7 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: HSD3B7 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HSD3B7 were set to 3 beta-hydroxysteroid dehydrogenase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HSD17B4 |
Zornitza Stark gene: HSD17B4 was added gene: HSD17B4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: HSD17B4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HSD17B4 were set to D-bifunctional protein deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HSD17B3 |
Zornitza Stark gene: HSD17B3 was added gene: HSD17B3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: HSD17B3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HSD17B3 were set to Pseudohermaphroditism, male, with gynecomastia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HSD17B10 |
Zornitza Stark gene: HSD17B10 was added gene: HSD17B10 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: HSD17B10 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: HSD17B10 were set to 17-beta-hydroxysteroid dehydrogenase X deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HRAS |
Zornitza Stark gene: HRAS was added gene: HRAS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: HRAS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: HRAS were set to Costello syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HPS5 |
Zornitza Stark gene: HPS5 was added gene: HPS5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: HPS5 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HPS5 were set to Hermansky-Pudlak syndrome 5 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HPS4 |
Zornitza Stark gene: HPS4 was added gene: HPS4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: HPS4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HPS4 were set to Hermansky-Pudlak syndrome 4 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HPS3 |
Zornitza Stark gene: HPS3 was added gene: HPS3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: HPS3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HPS3 were set to Hermansky-Pudlak syndrome 3 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HPS1 |
Zornitza Stark gene: HPS1 was added gene: HPS1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: HPS1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HPS1 were set to Hermansky-Pudlak syndrome 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HPRT1 |
Zornitza Stark gene: HPRT1 was added gene: HPRT1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: HPRT1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: HPRT1 were set to Lesch-Nyhan syndrome 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HMGCL |
Zornitza Stark gene: HMGCL was added gene: HMGCL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: HMGCL was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HMGCL were set to 3-hydroxy-3-methylglutaric aciduria |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HLCS |
Zornitza Stark gene: HLCS was added gene: HLCS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: HLCS was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HLCS were set to Holocarboxylase synthetase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HINT1 |
Zornitza Stark gene: HINT1 was added gene: HINT1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: HINT1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HINT1 were set to Axonal neuropathy with neuromyotonia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HGSNAT |
Zornitza Stark gene: HGSNAT was added gene: HGSNAT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: HGSNAT was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HGSNAT were set to Mucopolysaccharidosis IIIC |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HGD |
Zornitza Stark gene: HGD was added gene: HGD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: HGD was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HGD were set to Alkaptonuria |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HEXB |
Zornitza Stark gene: HEXB was added gene: HEXB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: HEXB was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HEXB were set to Sandhoff disease, infantile, juvenile, and adult forms |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HEXA |
Zornitza Stark gene: HEXA was added gene: HEXA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: HEXA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HEXA were set to Tay-Sachs disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HDAC8 |
Zornitza Stark gene: HDAC8 was added gene: HDAC8 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: HDAC8 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: HDAC8 were set to Cornelia de Lange syndrome-like features, ocular hypertelorism & large fontanelle |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HBB |
Zornitza Stark gene: HBB was added gene: HBB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: HBB was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HBB were set to Beta-thalassemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HBA2 |
Zornitza Stark gene: HBA2 was added gene: HBA2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: HBA2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HBA2 were set to Thalassemia, alpha |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HBA1 |
Zornitza Stark gene: HBA1 was added gene: HBA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: HBA1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HBA1 were set to Thalassaemia alpha |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HADHB |
Zornitza Stark gene: HADHB was added gene: HADHB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: HADHB was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HADHB were set to Mitochondrial trifunctional protein deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HADHA |
Zornitza Stark gene: HADHA was added gene: HADHA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: HADHA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HADHA were set to Mitochondrial trifunctional protein deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | HADH |
Zornitza Stark gene: HADH was added gene: HADH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: HADH was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: HADH were set to Hyperinsulinemic hypoglycemia, familial, 4 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | H19 |
Zornitza Stark gene: H19 was added gene: H19 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: H19 was set to Unknown Phenotypes for gene: H19 were set to Beckwith-Wiedemann Syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GYS2 |
Zornitza Stark gene: GYS2 was added gene: GYS2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GYS2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GYS2 were set to Glycogen storage disease 0 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GUSB |
Zornitza Stark gene: GUSB was added gene: GUSB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GUSB was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GUSB were set to Mucopolysaccharidosis VII |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GSS |
Zornitza Stark gene: GSS was added gene: GSS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GSS was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GSS were set to Glutathione synthetase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GRHPR |
Zornitza Stark gene: GRHPR was added gene: GRHPR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GRHPR was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GRHPR were set to Hyperoxaluria, primary, type II |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GPSM2 |
Zornitza Stark gene: GPSM2 was added gene: GPSM2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GPSM2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GPSM2 were set to Chudley-McCullough syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | PDZD7 | Zornitza Stark Added phenotypes Usher syndrome for gene: PDZD7 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ADGRG1 | Zornitza Stark Added phenotypes Polymicrogyria, bilateral frontoparietal for gene: ADGRG1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GPR143 | Zornitza Stark Added phenotypes Ocular albinism, type I for gene: GPR143 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GPC3 | Zornitza Stark Added phenotypes Simpson-Golabi-Behmel syndrome for gene: GPC3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GNS | Zornitza Stark Added phenotypes Mucopolysaccharidosis IIId for gene: GNS | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GNPTG | Zornitza Stark Added phenotypes Mucolipidosis III gamma for gene: GNPTG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GNPTAB | Zornitza Stark Added phenotypes Mucolipidosis II for gene: GNPTAB | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GNE | Zornitza Stark Added phenotypes Inclusion body myopathy for gene: GNE | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GNAS | Zornitza Stark Added phenotypes Pseudopseudohypoparathyroidism for gene: GNAS | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GNAS | Zornitza Stark Added phenotypes Pseudohypoparathyroidism for gene: GNAS | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GLUD1 | Zornitza Stark Added phenotypes Hyperinsulinism for gene: GLUD1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GLRA1 | Zornitza Stark Added phenotypes Hyperekplexia, hereditary 1, autosomal dominant or recessive for gene: GLRA1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GLI3 | Zornitza Stark Added phenotypes Greig cephalopolysyndactyly syndrome for gene: GLI3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GLDC | Zornitza Stark Added phenotypes Glycine encephalopathy for gene: GLDC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GLB1 | Zornitza Stark Added phenotypes Gangliosidosis GM1 for gene: GLB1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GLA | Zornitza Stark Added phenotypes Fabry disease for gene: GLA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GJC2 | Zornitza Stark Added phenotypes Pelizaeus-Merzbacher-like disease for gene: GJC2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GJB2 |
Zornitza Stark Mode of inheritance for gene GJB2 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Added phenotypes Deafness and palmoplantar keratoderma for gene: GJB2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GJB2 |
Zornitza Stark Mode of inheritance for gene GJB2 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BIALLELIC, autosomal or pseudoautosomal Added phenotypes Deafness for gene: GJB2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GJB1 | Zornitza Stark Added phenotypes Charcot-Marie-Tooth neuropathy for gene: GJB1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GJA1 | Zornitza Stark Added phenotypes Oculodentodigital dysplasia for gene: GJA1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GIPC3 | Zornitza Stark Added phenotypes Hearing loss for gene: GIPC3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GFPT1 | Zornitza Stark Added phenotypes Congenital myasthenic syndrome, limb-girdle for gene: GFPT1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GFM1 | Zornitza Stark Added phenotypes Combined oxidative phosphorylation deficiency 1 for gene: GFM1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GFAP | Zornitza Stark Added phenotypes Alexander disease for gene: GFAP | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GDAP1 | Zornitza Stark Added phenotypes Charcot-Marie-Tooth disease for gene: GDAP1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GCK | Zornitza Stark Added phenotypes Hyperinsulinemic hypoglycemia, familial for gene: GCK | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GCDH | Zornitza Stark Added phenotypes Glutaricaciduria, type I for gene: GCDH | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GBE1 | Zornitza Stark Added phenotypes Glycogen storage disease IV for gene: GBE1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GBA | Zornitza Stark Added phenotypes Gaucher disease 1 for gene: GBA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GATA4 | Zornitza Stark Added phenotypes Congenital heart defects for gene: GATA4 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GATA1 | Zornitza Stark Added phenotypes Dyserythropoietic anemia with thrombocytopenia for gene: GATA1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GAN | Zornitza Stark Added phenotypes Giant axonal neuropathy for gene: GAN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GALT | Zornitza Stark Added phenotypes Galactosaemia for gene: GALT | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GALNS | Zornitza Stark Added phenotypes Mucopolysaccharidosis IVA for gene: GALNS | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GALK1 | Zornitza Stark Added phenotypes Galactokinase deficiency with cataracts for gene: GALK1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GALC | Zornitza Stark Added phenotypes Krabbe disease for gene: GALC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | GAA | Zornitza Stark Added phenotypes Glycogen storage disease II for gene: GAA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | G6PD | Zornitza Stark Added phenotypes Glucose-6-phosphate dehydrogenase deficiency for gene: G6PD | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | G6PC3 | Zornitza Stark Added phenotypes Neutropaenia, congenital for gene: G6PC3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | G6PC | Zornitza Stark Added phenotypes Glycogen storage disease Ia for gene: G6PC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FXN | Zornitza Stark Added phenotypes Friedreich ataxia for gene: FXN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FUCA1 | Zornitza Stark Added phenotypes Fucosidosis for gene: FUCA1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FTL | Zornitza Stark Added phenotypes Neuroferritinopathy for gene: FTL | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FRAS1 | Zornitza Stark Added phenotypes Fraser syndrome for gene: FRAS1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FOXP3 | Zornitza Stark Added phenotypes IPEX syndrome for gene: FOXP3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FOXF1 | Zornitza Stark Added phenotypes Alveolar capillary dysplasia with misalignment of pulmonary veins for gene: FOXF1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FOXC2 | Zornitza Stark Added phenotypes Lymphoedema, primary for gene: FOXC2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FOXC1 | Zornitza Stark Added phenotypes Axenfeld-Rieger syndrome for gene: FOXC1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FLNA | Zornitza Stark Added phenotypes Otopalatodigital spectrum disorder for gene: FLNA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FLCN | Zornitza Stark Added phenotypes Birt-Hogg-Dube syndrome for gene: FLCN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FKTN | Zornitza Stark Added phenotypes Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies for gene: FKTN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FKTN | Zornitza Stark Added phenotypes Muscular dystrophy, Fukuyama for gene: FKTN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FKRP | Zornitza Stark Added phenotypes Muscle-eye-brain disease for gene: FKRP | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FKRP | Zornitza Stark Added phenotypes Muscular dystrophy, limb girdle 2I for gene: FKRP | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FHL1 | Zornitza Stark Added phenotypes Emery-Dreifuss muscular dystrophy for gene: FHL1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FH | Zornitza Stark Added phenotypes Fumarase deficiency for gene: FH | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FGG | Zornitza Stark Added phenotypes Afibrinogenaemia for gene: FGG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FGFR3 | Zornitza Stark Added phenotypes Muenke syndrome for gene: FGFR3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FGFR3 | Zornitza Stark Added phenotypes Thanatophoric dysplasia type 1 for gene: FGFR3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FGFR3 | Zornitza Stark Added phenotypes Crouzon syndrome with acanthosis nigricans for gene: FGFR3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FGFR3 | Zornitza Stark Added phenotypes Hypochondroplasia for gene: FGFR3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FGFR3 | Zornitza Stark Added phenotypes Achondroplasia for gene: FGFR3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FGFR2 | Zornitza Stark Added phenotypes Jackson-Weiss syndrome for gene: FGFR2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FGFR2 | Zornitza Stark Added phenotypes Beare-Stevenson cutis gyrata syndrome for gene: FGFR2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FGFR2 | Zornitza Stark Added phenotypes Crouzon syndrome for gene: FGFR2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FGFR2 | Zornitza Stark Added phenotypes Apert syndrome for gene: FGFR2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FGFR2 | Zornitza Stark Added phenotypes Pfeiffer syndrome for gene: FGFR2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FGFR1 | Zornitza Stark Added phenotypes Kallmann syndrome for gene: FGFR1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FGF3 | Zornitza Stark Added phenotypes Deafness, congenital with inner ear agenesis, microtia, and microdontia for gene: FGF3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FGD4 | Zornitza Stark Added phenotypes Charcot-Marie-Tooth disease for gene: FGD4 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FGD1 | Zornitza Stark Added phenotypes Aarskog-Scott syndrome for gene: FGD1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FGB | Zornitza Stark Added phenotypes Afibrinogenaemia for gene: FGB | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FGA | Zornitza Stark Added phenotypes Afibrinogenaemia for gene: FGA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FBN2 | Zornitza Stark Added phenotypes Contractural arachnodactyly for gene: FBN2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FBN1 | Zornitza Stark Added phenotypes Marfan's syndrome for gene: FBN1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FBLN5 | Zornitza Stark Added phenotypes Cutis laxa for gene: FBLN5 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FANCI | Zornitza Stark Added phenotypes Fanconi anaemia for gene: FANCI | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FANCG | Zornitza Stark Added phenotypes Fanconi anaemia for gene: FANCG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FANCD2 | Zornitza Stark Added phenotypes Fanconi anaemia for gene: FANCD2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FANCC | Zornitza Stark Added phenotypes Fanconi anaemia for gene: FANCC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FANCB | Zornitza Stark Added phenotypes Fanconi anaemia for gene: FANCB | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FANCA | Zornitza Stark Added phenotypes Fanconi anaemia for gene: FANCA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FAM58A | Zornitza Stark Added phenotypes Syndactyly - telecanthus - anogenital and renal malformations for gene: FAM58A | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FAM20C | Zornitza Stark Added phenotypes Osteosclerotic bone dysplasia for gene: FAM20C | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FAM161A | Zornitza Stark Added phenotypes Retinal dystrophy for gene: FAM161A | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FAM126A | Zornitza Stark Added phenotypes Hypomyelination and congenital cataract for gene: FAM126A | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | FAH | Zornitza Stark Added phenotypes Tyrosinemia, type I for gene: FAH | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | F9 | Zornitza Stark Added phenotypes Hemophilia B for gene: F9 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | F8 | Zornitza Stark Added phenotypes Hemophilia A for gene: F8 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | F2 | Zornitza Stark Added phenotypes Prothrombin deficiency for gene: F2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | F11 | Zornitza Stark Added phenotypes Factor XI deficiency for gene: F11 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | EZH2 | Zornitza Stark Added phenotypes Weaver syndrome 2 for gene: EZH2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | EYA4 | Zornitza Stark Added phenotypes Deafness, autosomal dominant for gene: EYA4 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | EYA1 | Zornitza Stark Added phenotypes Branchiootorenal syndrome for gene: EYA1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | EXT2 | Zornitza Stark Added phenotypes Exostoses, multiple, type 2 for gene: EXT2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | EXT1 | Zornitza Stark Added phenotypes Exostoses, multiple, type 1 for gene: EXT1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | EVC2 | Zornitza Stark Added phenotypes Ellis-van Creveld syndrome for gene: EVC2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | EVC | Zornitza Stark Added phenotypes Ellis-van Creveld syndrome for gene: EVC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ETHE1 | Zornitza Stark Added phenotypes Ethylmalonic encephalopathy for gene: ETHE1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ETFDH | Zornitza Stark Added phenotypes Glutaric acidemia IIC for gene: ETFDH | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ETFB | Zornitza Stark Added phenotypes Glutaric acidemia IIB for gene: ETFB | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ETFA | Zornitza Stark Added phenotypes Glutaric acidemia IIA for gene: ETFA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ESRRB | Zornitza Stark Added phenotypes Hearing loss for gene: ESRRB | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ESCO2 | Zornitza Stark Added phenotypes Roberts syndrome for gene: ESCO2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ERCC8 | Zornitza Stark Added phenotypes Cockayne syndrome for gene: ERCC8 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ERCC6 | Zornitza Stark Added phenotypes Cockayne syndrome for gene: ERCC6 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ERCC5 | Zornitza Stark Added phenotypes Xeroderma pigmentosum for gene: ERCC5 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ERCC2 | Zornitza Stark Added phenotypes Xeroderma pigmentosum for gene: ERCC2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | EPM2A | Zornitza Stark Added phenotypes Epilepsy, progressive myoclonic 2A (Lafora) for gene: EPM2A | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ENPP1 | Zornitza Stark Added phenotypes Arterial calcification, generalized, of infancy, 1 for gene: ENPP1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ENG | Zornitza Stark Added phenotypes Telangiectasia, hereditary hemorrhagic, type 1 for gene: ENG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | EMD | Zornitza Stark Added phenotypes Muscular dystrophy, Emery-Dreifuss for gene: EMD | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ELN | Zornitza Stark Added phenotypes Supravalvar aortic stenosis for gene: ELN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ELANE | Zornitza Stark Added phenotypes Neutropenia, congenital for gene: ELANE | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | EIF2AK3 | Zornitza Stark Added phenotypes Wolcott-Rallison syndrome for gene: EIF2AK3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | EGR2 | Zornitza Stark Added phenotypes Charcot-Marie-Tooth disease for gene: EGR2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | EFTUD2 | Zornitza Stark Added phenotypes Mandibulofacial dysostosis with microcephaly for gene: EFTUD2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | EFHC1 | Zornitza Stark Added phenotypes Myoclonic epilepsy for gene: EFHC1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | EDARADD | Zornitza Stark Added phenotypes Ectodermal dysplasia, hypohidrotic for gene: EDARADD | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | EDAR | Zornitza Stark Added phenotypes Ectodermal dysplasia, hypohidrotic for gene: EDAR | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | EDA | Zornitza Stark Added phenotypes Ectodermal dysplasia, hypohidrotic for gene: EDA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DYSF | Zornitza Stark Added phenotypes Miyoshi muscular dystrophy 1 for gene: DYSF | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DYSF | Zornitza Stark Added phenotypes Muscular dystrophy, limb-girdle, type 2B for gene: DYSF | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DUOX2 | Zornitza Stark Added phenotypes Thyroid dyshormonogenesis for gene: DUOX2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DSP | Zornitza Stark Added phenotypes Epidermolysis bullosa, lethal acantholytic for gene: DSP | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DPAGT1 | Zornitza Stark Added phenotypes Congenital disorder of glycosylation, type Ij for gene: DPAGT1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DOK7 | Zornitza Stark Added phenotypes Congenital myasthenic syndrome for gene: DOK7 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DOCK8 | Zornitza Stark Added phenotypes Hyper-IgE syndrome for gene: DOCK8 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DNMT3B | Zornitza Stark Added phenotypes Immunodeficiency-centromeric instability-facial anomalies syndrome 1 for gene: DNMT3B | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DNM2 | Zornitza Stark Added phenotypes Charcot-Marie-Tooth disease, axonal, type 2M for gene: DNM2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DNM2 | Zornitza Stark Added phenotypes Myopathy, centronuclear for gene: DNM2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DNAJB6 | Zornitza Stark Added phenotypes Muscular dystrophy, limb girdle for gene: DNAJB6 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DNAI1 | Zornitza Stark Added phenotypes Primary ciliary dyskinesia for gene: DNAI1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DNAH5 | Zornitza Stark Added phenotypes Primary ciliary dyskinesia for gene: DNAH5 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DNAH11 | Zornitza Stark Added phenotypes Primary ciliary dyskinesia for gene: DNAH11 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DNAAF1 | Zornitza Stark Added phenotypes Primary ciliary dyskinesia for gene: DNAAF1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DMPK | Zornitza Stark Added phenotypes Myotonic dystrophy 1 for gene: DMPK | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DMP1 | Zornitza Stark Added phenotypes Hypophosphatemic rickets, AR for gene: DMP1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DMD | Zornitza Stark Added phenotypes Becker muscular dystrophy for gene: DMD | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DMD | Zornitza Stark Added phenotypes Duchenne muscular dystrophy for gene: DMD | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DLL3 | Zornitza Stark Added phenotypes Spondylocostal dysostosis, autosomal recessive, 1 for gene: DLL3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DLD | Zornitza Stark Added phenotypes Maple syrup urine disease, type III for gene: DLD | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DHCR7 | Zornitza Stark Added phenotypes Smith-Lemli-Opitz syndrome for gene: DHCR7 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DGUOK | Zornitza Stark Added phenotypes Mitochondrial DNA depletion syndrome for gene: DGUOK | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DFNB59 | Zornitza Stark Added phenotypes Hearing loss for gene: DFNB59 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DFNA5 | Zornitza Stark Added phenotypes Hearing loss for gene: DFNA5 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DES | Zornitza Stark Added phenotypes Myopathy, myofibrillar for gene: DES | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DDC | Zornitza Stark Added phenotypes Aromatic L-amino acid decarboxylase deficiency for gene: DDC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DDB2 | Zornitza Stark Added phenotypes Xeroderma pigmentosum for gene: DDB2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DCX | Zornitza Stark Added phenotypes Lissencephaly, X-linked for gene: DCX | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DCLRE1C | Zornitza Stark Added phenotypes Severe combined immunodeficiency, Athabascan type for gene: DCLRE1C | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | DBT | Zornitza Stark Added phenotypes Maple syrup urine disease for gene: DBT | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | D2HGDH | Zornitza Stark Added phenotypes D-2-hydroxyglutaric aciduria for gene: D2HGDH | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CYP4F22 | Zornitza Stark Added phenotypes Ichthyosis, congenital, autosomal recessive for gene: CYP4F22 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CYP27B1 | Zornitza Stark Added phenotypes Vitamin D-dependent rickets, type I for gene: CYP27B1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CYP27A1 | Zornitza Stark Added phenotypes Cerebrotendinous xanthomatosis for gene: CYP27A1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CYP21A2 | Zornitza Stark Added phenotypes Adrenal hyperplasia, congenital, due to 21-hydroxylase deficiency for gene: CYP21A2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CYP11B1 | Zornitza Stark Added phenotypes Adrenal hyperplasia, congenital, due to 11-beta-hydroxylase deficiency for gene: CYP11B1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CYP11A1 | Zornitza Stark Added phenotypes Adrenal insufficiency, congenital, with 46XY sex reversal, partial or complete for gene: CYP11A1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CYBB | Zornitza Stark Added phenotypes Chronic granulomatous disease for gene: CYBB | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CYBA | Zornitza Stark Added phenotypes Chronic granulomatous disease for gene: CYBA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CUL7 | Zornitza Stark Added phenotypes 3-M syndrome for gene: CUL7 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CUBN | Zornitza Stark Added phenotypes Megaloblastic anemia-1, Finnish type for gene: CUBN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CTSK | Zornitza Stark Added phenotypes Pycnodysostosis for gene: CTSK | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CTSD | Zornitza Stark Added phenotypes Ceroid lipofuscinosis, neuronal, 10 for gene: CTSD | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CTNS | Zornitza Stark Added phenotypes Cystinosis for gene: CTNS | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CTC1 | Zornitza Stark Added phenotypes Coats plus syndrome for gene: CTC1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CSTB | Zornitza Stark Added phenotypes Epilepsy, progressive myoclonic 1A for gene: CSTB | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CSF2RA | Zornitza Stark Added phenotypes Pulmonary alveolar proteinosis for gene: CSF2RA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CRYAB | Zornitza Stark Added phenotypes Myofibrillar myopathy for gene: CRYAB | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CRTAP | Zornitza Stark Added phenotypes Osteogenesis imperfecta, type VII for gene: CRTAP | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CRLF1 | Zornitza Stark Added phenotypes Crisponi syndrome for gene: CRLF1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CREBBP | Zornitza Stark Added phenotypes Rubinstein-Taybi syndrome for gene: CREBBP | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CPT2 | Zornitza Stark Added phenotypes Carnitine palmitoyltransferase 2 deficiency for gene: CPT2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CPT1A | Zornitza Stark Added phenotypes Carnitine palmitoyltransferase I deficiency for gene: CPT1A | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CPS1 | Zornitza Stark Added phenotypes Carbamoylphosphate synthetase I deficiency for gene: CPS1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | COLQ | Zornitza Stark Added phenotypes Congenital myasthenic syndrome for gene: COLQ | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | COL7A1 | Zornitza Stark Added phenotypes Epidermolysis bullosa dystrophica for gene: COL7A1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | COL6A3 | Zornitza Stark Added phenotypes Ullrich congenital muscular dystrophy for gene: COL6A3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | COL6A2 | Zornitza Stark Added phenotypes Ullrich congenital muscular dystrophy for gene: COL6A2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | COL6A1 | Zornitza Stark Added phenotypes Ullrich congenital muscular dystrophy for gene: COL6A1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | COL5A2 | Zornitza Stark Added phenotypes Ehlers-Danlos syndrome for gene: COL5A2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | COL5A1 | Zornitza Stark Added phenotypes Ehlers-Danlos syndrome, type I for gene: COL5A1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | COL4A5 | Zornitza Stark Added phenotypes Alport syndrome for gene: COL4A5 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | COL4A4 | Zornitza Stark Added phenotypes Alport syndrome for gene: COL4A4 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | COL4A3 | Zornitza Stark Added phenotypes Alport syndrome for gene: COL4A3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | COL3A1 | Zornitza Stark Added phenotypes Ehlers-Danlos syndrome, type IV for gene: COL3A1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | COL2A1 | Zornitza Stark Added phenotypes Stickler syndrome for gene: COL2A1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | COL1A2 | Zornitza Stark Added phenotypes Osteogenesis imperfecta, type II for gene: COL1A2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | COL1A1 | Zornitza Stark Added phenotypes Osteogenesis imperfecta, type I for gene: COL1A1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | COL17A1 | Zornitza Stark Added phenotypes Epidermolysis bullosa, junctional, non-Herlitz type for gene: COL17A1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | COL11A2 | Zornitza Stark Added phenotypes Otospondylomegaepiphyseal dysplasia for gene: COL11A2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | COL11A1 | Zornitza Stark Added phenotypes Stickler syndrome for gene: COL11A1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | COCH | Zornitza Stark Added phenotypes Deafness, non-syndromic, autosomal dominant for gene: COCH | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CNGB3 | Zornitza Stark Added phenotypes Achromatopsia-3 for gene: CNGB3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CLRN1 | Zornitza Stark Added phenotypes Usher syndrome, type 3A for gene: CLRN1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CLN8 | Zornitza Stark Added phenotypes Ceroid lipofuscinosis, neuronal, 8 for gene: CLN8 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CLN6 | Zornitza Stark Added phenotypes Ceroid lipofuscinosis, neuronal, 6 for gene: CLN6 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CLN5 | Zornitza Stark Added phenotypes Ceroid lipofuscinosis, neuronal, 5 for gene: CLN5 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CLN3 | Zornitza Stark Added phenotypes Ceroid lipofuscinosis, neuronal, 3 for gene: CLN3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CLDN19 | Zornitza Stark Added phenotypes Hypomagnesemia 5, renal, with ocular involvement for gene: CLDN19 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CLDN14 | Zornitza Stark Added phenotypes Hearing loss, non-syndromic, autosomal recessive for gene: CLDN14 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CLCN5 | Zornitza Stark Added phenotypes Dent disease for gene: CLCN5 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CHRNG | Zornitza Stark Added phenotypes Pterygium syndrome for gene: CHRNG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CHRNE | Zornitza Stark Added phenotypes Congenital myasthenic syndrome for gene: CHRNE | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CHRND | Zornitza Stark Added phenotypes Congenital myasthenic syndrome for gene: CHRND | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CHRNA1 | Zornitza Stark Added phenotypes Congenital myasthenic syndrome for gene: CHRNA1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CHM | Zornitza Stark Added phenotypes Choroideremia for gene: CHM | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CHKB | Zornitza Stark Added phenotypes Muscular dystrophy, congenital, megaconial type for gene: CHKB | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CHD7 | Zornitza Stark Added phenotypes CHARGE syndrome for gene: CHD7 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CHD2 | Zornitza Stark Added phenotypes Developmental delay, intellectual disability, epilepsy for gene: CHD2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CHAT | Zornitza Stark Added phenotypes Congenital myasthenic syndrome for gene: CHAT | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CFTR | Zornitza Stark Added phenotypes Cystic fibrosis for gene: CFTR | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CFP | Zornitza Stark Added phenotypes Properdin deficiency, X-linked for gene: CFP | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CFL2 | Zornitza Stark Added phenotypes Nemaline myopathy for gene: CFL2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CFC1 | Zornitza Stark Added phenotypes Congenital heart defects for gene: CFC1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CEP290 | Zornitza Stark Added phenotypes Joubert syndrome for gene: CEP290 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CEP152 | Zornitza Stark Added phenotypes Seckel syndrome for gene: CEP152 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CDSN | Zornitza Stark Added phenotypes Hypotrichosis for gene: CDSN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CDKN1C | Zornitza Stark Added phenotypes Beckwith-Wiedemann syndrome for gene: CDKN1C | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CDKL5 | Zornitza Stark Added phenotypes Epileptic encephalopathy, early infantile, 2 for gene: CDKL5 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CDH23 | Zornitza Stark Added phenotypes Usher syndrome, type 1D for gene: CDH23 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CDH23 | Zornitza Stark Added phenotypes Deafness, autosomal recessive for gene: CDH23 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CDAN1 | Zornitza Stark Added phenotypes Anemia, congenital dyserythropoietic, type I for gene: CDAN1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CD40LG | Zornitza Stark Added phenotypes Immunodeficiency, X-linked, with hyper-IgM for gene: CD40LG | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CCDC40 | Zornitza Stark Added phenotypes Primary ciliary dyskinesia for gene: CCDC40 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CCDC39 | Zornitza Stark Added phenotypes Primary ciliary dyskinesia for gene: CCDC39 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CC2D2A | Zornitza Stark Added phenotypes Joubert syndrome for gene: CC2D2A | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CBS | Zornitza Stark Added phenotypes Homocystinuria, B6-responsive and nonresponsive types for gene: CBS | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CBL | Zornitza Stark Added phenotypes Noonan syndrome-like disorder with or without juvenile meylomonocytic leukemia for gene: CBL | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CAV3 | Zornitza Stark Added phenotypes Caveolinopathy for gene: CAV3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CAV3 | Zornitza Stark Added phenotypes Muscular dystrophy, limb-girdle, type IC, for gene: CAV3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CASQ2 | Zornitza Stark Added phenotypes Ventricular tachycardia, catecholaminergic polymorphic for gene: CASQ2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CASK | Zornitza Stark Added phenotypes Mental retardation and microcephaly with pontine and cerebellar hypoplasia for gene: CASK | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CAPN3 | Zornitza Stark Added phenotypes Muscular dystrophy, limb-girdle, type 2A for gene: CAPN3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CACNA1F | Zornitza Stark Added phenotypes Night blindness, congenital stationary (complete), 1A, X-linked for gene: CACNA1F | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CACNA1A | Zornitza Stark Added phenotypes Episodic ataxia, type 2 for gene: CACNA1A | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | CA2 | Zornitza Stark Added phenotypes Osteopetrosis, autosomal recessive 3, with renal tubular acidosis for gene: CA2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | TWNK | Zornitza Stark Added phenotypes Spinocerebellar ataxia infantile-onset for gene: TWNK | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BTK | Zornitza Stark Added phenotypes Agammaglobulinemia, X-linked 1 for gene: BTK | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BTD | Zornitza Stark Added phenotypes Biotinidase deficiency for gene: BTD | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BSND | Zornitza Stark Added phenotypes Bartter syndrome with sensorineural deafness for gene: BSND | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BSCL2 | Zornitza Stark Added phenotypes Berardinelli-Seip lipodystrophy for gene: BSCL2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BRCA2 | Zornitza Stark Added phenotypes Fanconi anemia, complementation group D1 for gene: BRCA2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BRAF | Zornitza Stark Added phenotypes Cardiofaciocutaneous syndrome for gene: BRAF | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BMPR1A | Zornitza Stark Added phenotypes Juvenile polyposis syndrome for gene: BMPR1A | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BLM | Zornitza Stark Added phenotypes Bloom syndrome for gene: BLM | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BIN1 | Zornitza Stark Added phenotypes Myopathy, centronuclear, autosomal recessive for gene: BIN1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BICD2 | Zornitza Stark Added phenotypes Congenital spinal muscular atrophy for gene: BICD2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BCS1L | Zornitza Stark Added phenotypes Complex 3 deficiency for gene: BCS1L | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BCKDHB | Zornitza Stark Added phenotypes Maple syrup urine disease for gene: BCKDHB | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BCKDHA | Zornitza Stark Added phenotypes Maple syrup urine disease for gene: BCKDHA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BBS9 | Zornitza Stark Added phenotypes Bardet-Biedl syndrome for gene: BBS9 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BBS7 | Zornitza Stark Added phenotypes Bardet-Biedl syndrome for gene: BBS7 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BBS5 | Zornitza Stark Added phenotypes Bardet-Biedl syndrome for gene: BBS5 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BBS4 | Zornitza Stark Added phenotypes Bardet-Biedl syndrome for gene: BBS4 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BBS2 | Zornitza Stark Added phenotypes Bardet-Biedl syndrome for gene: BBS2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BBS12 | Zornitza Stark Added phenotypes Bardet-Biedl syndrome for gene: BBS12 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BBS10 | Zornitza Stark Added phenotypes Bardet-Biedl syndrome for gene: BBS10 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BBS1 | Zornitza Stark Added phenotypes Bardet-Biedl syndrome for gene: BBS1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | BAAT | Zornitza Stark Added phenotypes Bile acid amidation defect for gene: BAAT | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | B3GLCT | Zornitza Stark Added phenotypes Peters-Plus syndrome for gene: B3GLCT | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AVPR2 | Zornitza Stark Added phenotypes Diabetes insipidus, nephrogenic for gene: AVPR2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AUH | Zornitza Stark Added phenotypes 3-methylglutaconic aciduria, type I for gene: AUH | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ATRX | Zornitza Stark Added phenotypes Alpha-thalassemia/mental retardation syndrome for gene: ATRX | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ATP8B1 | Zornitza Stark Added phenotypes Cholestasis, progressive familial intrahepatic 1 for gene: ATP8B1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ATP7B | Zornitza Stark Added phenotypes Wilson disease for gene: ATP7B | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ATP7A | Zornitza Stark Added phenotypes Occipital horn syndrome for gene: ATP7A | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ATP7A | Zornitza Stark Added phenotypes Menkes syndrome for gene: ATP7A | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ATP6V1B1 | Zornitza Stark Added phenotypes Renal tubular acidosis & hearing loss for gene: ATP6V1B1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ATP6V0A2 | Zornitza Stark Added phenotypes Cutis laxa, autosomal recessive, type IIA for gene: ATP6V0A2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ATP2A1 | Zornitza Stark Added phenotypes Brody myopathy for gene: ATP2A1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ATP1A2 | Zornitza Stark Added phenotypes Hemiplegic migraine for gene: ATP1A2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ATM | Zornitza Stark Added phenotypes Ataxia-telangiectasia for gene: ATM | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ASS1 | Zornitza Stark Added phenotypes Citrullinemia for gene: ASS1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ASPA | Zornitza Stark Added phenotypes Canavan disease for gene: ASPA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ASL | Zornitza Stark Added phenotypes Argininosuccinic aciduria for gene: ASL | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ARX | Zornitza Stark Added phenotypes Lissencephaly, X-linked 2 for gene: ARX | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ARSB | Zornitza Stark Added phenotypes Mucopolysaccharidosis type VI (Maroteaux-Lamy) for gene: ARSB | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ARSA | Zornitza Stark Added phenotypes Metachromatic leukodystrophy for gene: ARSA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ARMC4 | Zornitza Stark Added phenotypes Primary ciliary dyskinesia for gene: ARMC4 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ARID1B | Zornitza Stark Added phenotypes Coffin-Siris syndrome for gene: ARID1B | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ARG1 | Zornitza Stark Added phenotypes Arginase deficiency for gene: ARG1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ARFGEF2 | Zornitza Stark Added phenotypes Periventricular heterotopia with microcephaly for gene: ARFGEF2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AR | Zornitza Stark Added phenotypes Androgen insensitivity for gene: AR | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | APTX | Zornitza Stark Added phenotypes Ataxia, early-onset, with oculomotor apraxia and hypoalbuminemia for gene: APTX | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | APOB | Zornitza Stark Added phenotypes Apolipoprotein B deficiency for gene: APOB | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | APC | Zornitza Stark Added phenotypes Adenomatous polyposis coli, attenuated for gene: APC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | APC | Zornitza Stark Added phenotypes Adenomatous polyposis coli for gene: APC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AP3B1 | Zornitza Stark Added phenotypes Hermansky-Pudlak syndrome 2 for gene: AP3B1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ANTXR2 | Zornitza Stark Added phenotypes Hyaline fibromatosis syndrome for gene: ANTXR2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ANO5 | Zornitza Stark Added phenotypes Muscular dystrophy, limb-girdle, type 2L for gene: ANO5 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ANO10 | Zornitza Stark Added phenotypes Spinocerebellar ataxia, autosomal recessive 10 for gene: ANO10 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ANKRD26 | Zornitza Stark Added phenotypes Thrombocytopenia 2 for gene: ANKRD26 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ANKH | Zornitza Stark Added phenotypes Craniometaphyseal dysplasia for gene: ANKH | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ANK1 | Zornitza Stark Added phenotypes Spherocytosis for gene: ANK1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AMT | Zornitza Stark Added phenotypes Hyperglycinaemia, non-ketotic for gene: AMT | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AMN | Zornitza Stark Added phenotypes Megaloblastic anemia-1, Norwegian type for gene: AMN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AMELX | Zornitza Stark Added phenotypes Amelogenesis imperfecta for gene: AMELX | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ALX4 | Zornitza Stark Added phenotypes Parietal foramina 2 for gene: ALX4 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ALS2 | Zornitza Stark Added phenotypes Amyotrophic lateral sclerosis for gene: ALS2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ALPL | Zornitza Stark Added phenotypes Hypophosphatasia for gene: ALPL | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ALOXE3 | Zornitza Stark Added phenotypes Ichthyosis, congenital, autosomal recessive for gene: ALOXE3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ALOX12B | Zornitza Stark Added phenotypes Ichthyosis, congenital, autosomal recessive for gene: ALOX12B | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ALMS1 | Zornitza Stark Added phenotypes Alstrom syndrome for gene: ALMS1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ALG8 | Zornitza Stark Added phenotypes Congenital disorder of glycosylation, type Ih for gene: ALG8 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ALG6 | Zornitza Stark Added phenotypes Congenital disorder of glycosylation, type Ic for gene: ALG6 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ALG3 | Zornitza Stark Added phenotypes Congenital disorder of glycosylation, type Id for gene: ALG3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ALG12 | Zornitza Stark Added phenotypes Congenital disorder of glycosylation, type Ig for gene: ALG12 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ALG1 | Zornitza Stark Added phenotypes Congenital disorder of glycosylation, type Ik for gene: ALG1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ALDOB | Zornitza Stark Added phenotypes Fructose intolerance for gene: ALDOB | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ALDH5A1 | Zornitza Stark Added phenotypes Succinic semialdehyde dehydrogenase deficiency for gene: ALDH5A1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ALDH3A2 | Zornitza Stark Added phenotypes Sjogren-Larsson syndrome for gene: ALDH3A2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ALDH18A1 | Zornitza Stark Added phenotypes Cutis laxa, autosomal recessive, type IIIA for gene: ALDH18A1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ALB | Zornitza Stark Added phenotypes Analbuminemia for gene: ALB | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ALAS2 | Zornitza Stark Added phenotypes Anemia, sideroblastic, X-linked for gene: ALAS2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AKR1D1 | Zornitza Stark Added phenotypes Bile acid synthesis defect, congenital, 2 for gene: AKR1D1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AIRE | Zornitza Stark Added phenotypes Autoimmune polyendocrinopathy syndrome , type I, with or without reversible metaphyseal dysplasia for gene: AIRE | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AIFM1 | Zornitza Stark Added phenotypes Cowchock syndrome for gene: AIFM1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AHI1 | Zornitza Stark Added phenotypes Joubert syndrome-3 for gene: AHI1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AGXT | Zornitza Stark Added phenotypes Hyperoxaluria, primary, type 1 for gene: AGXT | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AGRN | Zornitza Stark Added phenotypes Myasthenia, limb-girdle, familial for gene: AGRN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AGL | Zornitza Stark Added phenotypes Glycogen storage disease IIIa for gene: AGL | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AGA | Zornitza Stark Added phenotypes Aspartylglucosaminuria for gene: AGA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ADK | Zornitza Stark Added phenotypes Hypermethioninemia due to adenosine kinase deficiency for gene: ADK | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ADAR |
Zornitza Stark Mode of inheritance for gene ADAR was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Added phenotypes Dyschromatosis symmetrica hereditaria for gene: ADAR |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ADAR |
Zornitza Stark Mode of inheritance for gene ADAR was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BIALLELIC, autosomal or pseudoautosomal Added phenotypes Aicardi-Goutieres syndrome for gene: ADAR |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ADAMTSL2 | Zornitza Stark Added phenotypes Geleophysic dysplasia 1 for gene: ADAMTSL2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ADAMTS13 | Zornitza Stark Added phenotypes Thrombotic thrombocytopenic purpura, familial for gene: ADAMTS13 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ADA | Zornitza Stark Added phenotypes Severe combined immunodeficiency due to ADA deficiency for gene: ADA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACVRL1 | Zornitza Stark Added phenotypes Telangiectasia, hereditary hemorrhagic, type 2 for gene: ACVRL1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACVR1 | Zornitza Stark Added phenotypes Fibrodysplasia ossificans progressiva for gene: ACVR1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACTN4 | Zornitza Stark Added phenotypes Glomerulosclerosis, focal segmental, 1 for gene: ACTN4 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACTN1 | Zornitza Stark Added phenotypes Macrothrombocytopenia for gene: ACTN1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACTG2 | Zornitza Stark Added phenotypes Megacystis-microcolon-intestinal hypoperistalsis syndrome for gene: ACTG2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACTG1 | Zornitza Stark Added phenotypes Baraitser-Winter syndrome for gene: ACTG1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACTG1 | Zornitza Stark Added phenotypes Deafness, autosomal dominant for gene: ACTG1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACTB | Zornitza Stark Added phenotypes Baraitser-Winter syndrome for gene: ACTB | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACTA1 | Zornitza Stark Added phenotypes Nemaline myopathy for gene: ACTA1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACSF3 | Zornitza Stark Added phenotypes Combined malonic and methylmalonic aciduria for gene: ACSF3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACOX1 | Zornitza Stark Added phenotypes Peroxisomal acyl-CoA oxidase deficiency for gene: ACOX1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACE | Zornitza Stark Added phenotypes Renal tubular dysgenesis for gene: ACE | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACAT1 | Zornitza Stark Added phenotypes Alpha-methylacetoacetic aciduria for gene: ACAT1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACADVL | Zornitza Stark Added phenotypes VLCAD deficiency for gene: ACADVL | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACADM | Zornitza Stark Added phenotypes Medium chain acyl CoA dehydrogenase deficiency for gene: ACADM | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACAD9 | Zornitza Stark Added phenotypes ACAD9 deficiency for gene: ACAD9 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ACAD8 | Zornitza Stark Added phenotypes Isobutyryl-CoA dehydrogenase deficiency for gene: ACAD8 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ABCG5 | Zornitza Stark Added phenotypes Sitosterolemia for gene: ABCG5 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ABCD1 | Zornitza Stark Added phenotypes Adrenoleukodystrophy for gene: ABCD1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ABCC9 | Zornitza Stark Added phenotypes Hypertrichotic osteochondrodysplasia for gene: ABCC9 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ABCC8 | Zornitza Stark Added phenotypes Hyperinsulinemic hypoglycemia, familial for gene: ABCC8 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ABCC6 | Zornitza Stark Added phenotypes Pseudoxanthoma elasticum for gene: ABCC6 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ABCB4 | Zornitza Stark Added phenotypes Cholestasis, progressive familial intrahepatic 3 for gene: ABCB4 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ABCB11 | Zornitza Stark Added phenotypes Cholestasis, progressive familial intrahepatic 2 for gene: ABCB11 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ABCA4 | Zornitza Stark Added phenotypes Stargardt disease for gene: ABCA4 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ABCA3 | Zornitza Stark Added phenotypes Surfactant metabolism dysfunction, pulmonary, 3 for gene: ABCA3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | ABCA12 | Zornitza Stark Added phenotypes Ichthyosis, congenital, autosomal recessive for gene: ABCA12 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AARS | Zornitza Stark Added phenotypes Charcot-Marie-Tooth disease for gene: AARS | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.2 | AAAS | Zornitza Stark Added phenotypes Achalasia-addisonianism-alacrimia syndrome for gene: AAAS | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.18 | FAT4 | Zornitza Stark Marked gene: FAT4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.18 | FAT4 | Zornitza Stark Gene: fat4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.18 | FAT4 | Zornitza Stark Phenotypes for gene: FAT4 were changed from to Van Maldergem syndrome 2, MIM# 615546 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.17 | FAT4 | Zornitza Stark Publications for gene: FAT4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.16 | FAT4 | Zornitza Stark Mode of inheritance for gene: FAT4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.15 | FAT4 | Zornitza Stark Classified gene: FAT4 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.15 | FAT4 | Zornitza Stark Gene: fat4 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.14 | FAT4 | Zornitza Stark reviewed gene: FAT4: Rating: AMBER; Mode of pathogenicity: None; Publications: 22473091, 24056717; Phenotypes: Van Maldergem syndrome 2, MIM# 615546; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | PDZD7 |
Zornitza Stark gene: PDZD7 was added gene: PDZD7 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: PDZD7 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: PDZD7 were set to Usher syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ADGRG1 |
Zornitza Stark gene: ADGRG1 was added gene: ADGRG1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ADGRG1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ADGRG1 were set to Polymicrogyria, bilateral frontoparietal |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GPR143 |
Zornitza Stark gene: GPR143 was added gene: GPR143 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GPR143 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: GPR143 were set to Ocular albinism, type I |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GPC3 |
Zornitza Stark gene: GPC3 was added gene: GPC3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GPC3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: GPC3 were set to Simpson-Golabi-Behmel syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GNS |
Zornitza Stark gene: GNS was added gene: GNS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GNS was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GNS were set to Mucopolysaccharidosis IIId |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GNPTG |
Zornitza Stark gene: GNPTG was added gene: GNPTG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GNPTG was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GNPTG were set to Mucolipidosis III gamma |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GNPTAB |
Zornitza Stark gene: GNPTAB was added gene: GNPTAB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GNPTAB was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GNPTAB were set to Mucolipidosis II |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GNE |
Zornitza Stark gene: GNE was added gene: GNE was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GNE was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GNE were set to Inclusion body myopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GNAS | Zornitza Stark Added phenotypes Pseudopseudohypoparathyroidism for gene: GNAS | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GNAS |
Zornitza Stark gene: GNAS was added gene: GNAS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GNAS was set to Unknown Phenotypes for gene: GNAS were set to Pseudohypoparathyroidism |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GLUD1 |
Zornitza Stark gene: GLUD1 was added gene: GLUD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GLUD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: GLUD1 were set to Hyperinsulinism |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GLRA1 |
Zornitza Stark gene: GLRA1 was added gene: GLRA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GLRA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: GLRA1 were set to Hyperekplexia, hereditary 1, autosomal dominant or recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GLI3 |
Zornitza Stark gene: GLI3 was added gene: GLI3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GLI3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: GLI3 were set to Greig cephalopolysyndactyly syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GLDC |
Zornitza Stark gene: GLDC was added gene: GLDC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GLDC was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GLDC were set to Glycine encephalopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GLB1 |
Zornitza Stark gene: GLB1 was added gene: GLB1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GLB1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GLB1 were set to Gangliosidosis GM1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GLA |
Zornitza Stark gene: GLA was added gene: GLA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GLA was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: GLA were set to Fabry disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GJC2 |
Zornitza Stark gene: GJC2 was added gene: GJC2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GJC2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GJC2 were set to Pelizaeus-Merzbacher-like disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GJB2 |
Zornitza Stark Mode of inheritance for gene GJB2 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Added phenotypes Deafness and palmoplantar keratoderma for gene: GJB2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GJB2 |
Zornitza Stark gene: GJB2 was added gene: GJB2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GJB2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GJB2 were set to Deafness |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GJB1 |
Zornitza Stark gene: GJB1 was added gene: GJB1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GJB1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: GJB1 were set to Charcot-Marie-Tooth neuropathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GJA1 |
Zornitza Stark gene: GJA1 was added gene: GJA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GJA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: GJA1 were set to Oculodentodigital dysplasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GIPC3 |
Zornitza Stark gene: GIPC3 was added gene: GIPC3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GIPC3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GIPC3 were set to Hearing loss |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GFPT1 |
Zornitza Stark gene: GFPT1 was added gene: GFPT1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GFPT1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GFPT1 were set to Congenital myasthenic syndrome, limb-girdle |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GFM1 |
Zornitza Stark gene: GFM1 was added gene: GFM1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GFM1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GFM1 were set to Combined oxidative phosphorylation deficiency 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GFAP |
Zornitza Stark gene: GFAP was added gene: GFAP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GFAP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: GFAP were set to Alexander disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GDAP1 |
Zornitza Stark gene: GDAP1 was added gene: GDAP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GDAP1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GDAP1 were set to Charcot-Marie-Tooth disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GCK |
Zornitza Stark gene: GCK was added gene: GCK was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GCK was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: GCK were set to Hyperinsulinemic hypoglycemia, familial |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GCDH |
Zornitza Stark gene: GCDH was added gene: GCDH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GCDH was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GCDH were set to Glutaricaciduria, type I |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GBE1 |
Zornitza Stark gene: GBE1 was added gene: GBE1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GBE1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GBE1 were set to Glycogen storage disease IV |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GBA |
Zornitza Stark gene: GBA was added gene: GBA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GBA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GBA were set to Gaucher disease 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GATA4 |
Zornitza Stark gene: GATA4 was added gene: GATA4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GATA4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: GATA4 were set to Congenital heart defects |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GATA1 |
Zornitza Stark gene: GATA1 was added gene: GATA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GATA1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: GATA1 were set to Dyserythropoietic anemia with thrombocytopenia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GAN |
Zornitza Stark gene: GAN was added gene: GAN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GAN was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GAN were set to Giant axonal neuropathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GALT |
Zornitza Stark gene: GALT was added gene: GALT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GALT was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GALT were set to Galactosaemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GALNS |
Zornitza Stark gene: GALNS was added gene: GALNS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GALNS was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GALNS were set to Mucopolysaccharidosis IVA |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GALK1 |
Zornitza Stark gene: GALK1 was added gene: GALK1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GALK1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GALK1 were set to Galactokinase deficiency with cataracts |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GALC |
Zornitza Stark gene: GALC was added gene: GALC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GALC was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GALC were set to Krabbe disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | GAA |
Zornitza Stark gene: GAA was added gene: GAA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: GAA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: GAA were set to Glycogen storage disease II |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | G6PD |
Zornitza Stark gene: G6PD was added gene: G6PD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: G6PD was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: G6PD were set to Glucose-6-phosphate dehydrogenase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | G6PC3 |
Zornitza Stark gene: G6PC3 was added gene: G6PC3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: G6PC3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: G6PC3 were set to Neutropaenia, congenital |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | G6PC |
Zornitza Stark gene: G6PC was added gene: G6PC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: G6PC was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: G6PC were set to Glycogen storage disease Ia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FXN |
Zornitza Stark gene: FXN was added gene: FXN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FXN was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FXN were set to Friedreich ataxia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FUCA1 |
Zornitza Stark gene: FUCA1 was added gene: FUCA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FUCA1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FUCA1 were set to Fucosidosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FTL |
Zornitza Stark gene: FTL was added gene: FTL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FTL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: FTL were set to Neuroferritinopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FRAS1 |
Zornitza Stark gene: FRAS1 was added gene: FRAS1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FRAS1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FRAS1 were set to Fraser syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FOXP3 |
Zornitza Stark gene: FOXP3 was added gene: FOXP3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FOXP3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: FOXP3 were set to IPEX syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FOXF1 |
Zornitza Stark gene: FOXF1 was added gene: FOXF1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FOXF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: FOXF1 were set to Alveolar capillary dysplasia with misalignment of pulmonary veins |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FOXC2 |
Zornitza Stark gene: FOXC2 was added gene: FOXC2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FOXC2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: FOXC2 were set to Lymphoedema, primary |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FOXC1 |
Zornitza Stark gene: FOXC1 was added gene: FOXC1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FOXC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: FOXC1 were set to Axenfeld-Rieger syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FLNA |
Zornitza Stark gene: FLNA was added gene: FLNA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FLNA was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: FLNA were set to Otopalatodigital spectrum disorder |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FLCN |
Zornitza Stark gene: FLCN was added gene: FLCN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FLCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: FLCN were set to Birt-Hogg-Dube syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FKTN | Zornitza Stark Added phenotypes Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies for gene: FKTN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FKTN |
Zornitza Stark gene: FKTN was added gene: FKTN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FKTN was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FKTN were set to Muscular dystrophy, Fukuyama |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FKRP | Zornitza Stark Added phenotypes Muscle-eye-brain disease for gene: FKRP | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FKRP |
Zornitza Stark gene: FKRP was added gene: FKRP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FKRP was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FKRP were set to Muscular dystrophy, limb girdle 2I |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FHL1 |
Zornitza Stark gene: FHL1 was added gene: FHL1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FHL1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: FHL1 were set to Emery-Dreifuss muscular dystrophy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FH |
Zornitza Stark gene: FH was added gene: FH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FH was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FH were set to Fumarase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FGG |
Zornitza Stark gene: FGG was added gene: FGG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FGG was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FGG were set to Afibrinogenaemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FGFR3 | Zornitza Stark Added phenotypes Muenke syndrome for gene: FGFR3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FGFR3 | Zornitza Stark Added phenotypes Thanatophoric dysplasia type 1 for gene: FGFR3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FGFR3 | Zornitza Stark Added phenotypes Crouzon syndrome with acanthosis nigricans for gene: FGFR3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FGFR3 | Zornitza Stark Added phenotypes Hypochondroplasia for gene: FGFR3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FGFR3 |
Zornitza Stark gene: FGFR3 was added gene: FGFR3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FGFR3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: FGFR3 were set to Achondroplasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FGFR2 | Zornitza Stark Added phenotypes Jackson-Weiss syndrome for gene: FGFR2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FGFR2 | Zornitza Stark Added phenotypes Beare-Stevenson cutis gyrata syndrome for gene: FGFR2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FGFR2 | Zornitza Stark Added phenotypes Crouzon syndrome for gene: FGFR2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FGFR2 | Zornitza Stark Added phenotypes Apert syndrome for gene: FGFR2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FGFR2 |
Zornitza Stark gene: FGFR2 was added gene: FGFR2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FGFR2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: FGFR2 were set to Pfeiffer syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FGFR1 |
Zornitza Stark gene: FGFR1 was added gene: FGFR1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FGFR1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: FGFR1 were set to Kallmann syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FGF3 |
Zornitza Stark gene: FGF3 was added gene: FGF3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FGF3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FGF3 were set to Deafness, congenital with inner ear agenesis, microtia, and microdontia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FGD4 |
Zornitza Stark gene: FGD4 was added gene: FGD4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FGD4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FGD4 were set to Charcot-Marie-Tooth disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FGD1 |
Zornitza Stark gene: FGD1 was added gene: FGD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FGD1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: FGD1 were set to Aarskog-Scott syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FGB |
Zornitza Stark gene: FGB was added gene: FGB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FGB was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FGB were set to Afibrinogenaemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FGA |
Zornitza Stark gene: FGA was added gene: FGA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FGA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FGA were set to Afibrinogenaemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FBN2 |
Zornitza Stark gene: FBN2 was added gene: FBN2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FBN2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: FBN2 were set to Contractural arachnodactyly |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FBN1 |
Zornitza Stark gene: FBN1 was added gene: FBN1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FBN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: FBN1 were set to Marfan's syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FBLN5 |
Zornitza Stark gene: FBLN5 was added gene: FBLN5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FBLN5 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FBLN5 were set to Cutis laxa |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FANCI |
Zornitza Stark gene: FANCI was added gene: FANCI was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FANCI was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FANCI were set to Fanconi anaemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FANCG |
Zornitza Stark gene: FANCG was added gene: FANCG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FANCG was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FANCG were set to Fanconi anaemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FANCD2 |
Zornitza Stark gene: FANCD2 was added gene: FANCD2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FANCD2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FANCD2 were set to Fanconi anaemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FANCC |
Zornitza Stark gene: FANCC was added gene: FANCC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FANCC was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FANCC were set to Fanconi anaemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FANCB |
Zornitza Stark gene: FANCB was added gene: FANCB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FANCB was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: FANCB were set to Fanconi anaemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FANCA |
Zornitza Stark gene: FANCA was added gene: FANCA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FANCA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FANCA were set to Fanconi anaemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FAM58A |
Zornitza Stark gene: FAM58A was added gene: FAM58A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FAM58A was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: FAM58A were set to Syndactyly - telecanthus - anogenital and renal malformations |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FAM20C |
Zornitza Stark gene: FAM20C was added gene: FAM20C was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FAM20C was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FAM20C were set to Osteosclerotic bone dysplasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FAM161A |
Zornitza Stark gene: FAM161A was added gene: FAM161A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FAM161A was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FAM161A were set to Retinal dystrophy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FAM126A |
Zornitza Stark gene: FAM126A was added gene: FAM126A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FAM126A was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FAM126A were set to Hypomyelination and congenital cataract |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | FAH |
Zornitza Stark gene: FAH was added gene: FAH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: FAH was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: FAH were set to Tyrosinemia, type I |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | F9 |
Zornitza Stark gene: F9 was added gene: F9 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: F9 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: F9 were set to Hemophilia B |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | F8 |
Zornitza Stark gene: F8 was added gene: F8 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: F8 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: F8 were set to Hemophilia A |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | F2 |
Zornitza Stark gene: F2 was added gene: F2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: F2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: F2 were set to Prothrombin deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | F11 |
Zornitza Stark gene: F11 was added gene: F11 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: F11 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: F11 were set to Factor XI deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | EZH2 |
Zornitza Stark gene: EZH2 was added gene: EZH2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: EZH2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: EZH2 were set to Weaver syndrome 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | EYA4 |
Zornitza Stark gene: EYA4 was added gene: EYA4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: EYA4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: EYA4 were set to Deafness, autosomal dominant |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | EYA1 |
Zornitza Stark gene: EYA1 was added gene: EYA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: EYA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: EYA1 were set to Branchiootorenal syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | EXT2 |
Zornitza Stark gene: EXT2 was added gene: EXT2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: EXT2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: EXT2 were set to Exostoses, multiple, type 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | EXT1 |
Zornitza Stark gene: EXT1 was added gene: EXT1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: EXT1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: EXT1 were set to Exostoses, multiple, type 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | EVC2 |
Zornitza Stark gene: EVC2 was added gene: EVC2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: EVC2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: EVC2 were set to Ellis-van Creveld syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | EVC |
Zornitza Stark gene: EVC was added gene: EVC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: EVC was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: EVC were set to Ellis-van Creveld syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ETHE1 |
Zornitza Stark gene: ETHE1 was added gene: ETHE1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ETHE1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ETHE1 were set to Ethylmalonic encephalopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ETFDH |
Zornitza Stark gene: ETFDH was added gene: ETFDH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ETFDH was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ETFDH were set to Glutaric acidemia IIC |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ETFB |
Zornitza Stark gene: ETFB was added gene: ETFB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ETFB was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ETFB were set to Glutaric acidemia IIB |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ETFA |
Zornitza Stark gene: ETFA was added gene: ETFA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ETFA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ETFA were set to Glutaric acidemia IIA |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ESRRB |
Zornitza Stark gene: ESRRB was added gene: ESRRB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ESRRB was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ESRRB were set to Hearing loss |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ESCO2 |
Zornitza Stark gene: ESCO2 was added gene: ESCO2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ESCO2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ESCO2 were set to Roberts syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ERCC8 |
Zornitza Stark gene: ERCC8 was added gene: ERCC8 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ERCC8 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ERCC8 were set to Cockayne syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ERCC6 |
Zornitza Stark gene: ERCC6 was added gene: ERCC6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ERCC6 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ERCC6 were set to Cockayne syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ERCC5 |
Zornitza Stark gene: ERCC5 was added gene: ERCC5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ERCC5 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ERCC5 were set to Xeroderma pigmentosum |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ERCC2 |
Zornitza Stark gene: ERCC2 was added gene: ERCC2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ERCC2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ERCC2 were set to Xeroderma pigmentosum |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | EPM2A |
Zornitza Stark gene: EPM2A was added gene: EPM2A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: EPM2A was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: EPM2A were set to Epilepsy, progressive myoclonic 2A (Lafora) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ENPP1 |
Zornitza Stark gene: ENPP1 was added gene: ENPP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ENPP1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ENPP1 were set to Arterial calcification, generalized, of infancy, 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ENG |
Zornitza Stark gene: ENG was added gene: ENG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ENG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ENG were set to Telangiectasia, hereditary hemorrhagic, type 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | EMD |
Zornitza Stark gene: EMD was added gene: EMD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: EMD was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: EMD were set to Muscular dystrophy, Emery-Dreifuss |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ELN |
Zornitza Stark gene: ELN was added gene: ELN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ELN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ELN were set to Supravalvar aortic stenosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ELANE |
Zornitza Stark gene: ELANE was added gene: ELANE was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ELANE was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ELANE were set to Neutropenia, congenital |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | EIF2AK3 |
Zornitza Stark gene: EIF2AK3 was added gene: EIF2AK3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: EIF2AK3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: EIF2AK3 were set to Wolcott-Rallison syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | EGR2 |
Zornitza Stark gene: EGR2 was added gene: EGR2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: EGR2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: EGR2 were set to Charcot-Marie-Tooth disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | EFTUD2 |
Zornitza Stark gene: EFTUD2 was added gene: EFTUD2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: EFTUD2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: EFTUD2 were set to Mandibulofacial dysostosis with microcephaly |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | EFHC1 |
Zornitza Stark gene: EFHC1 was added gene: EFHC1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: EFHC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: EFHC1 were set to Myoclonic epilepsy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | EDARADD |
Zornitza Stark gene: EDARADD was added gene: EDARADD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: EDARADD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: EDARADD were set to Ectodermal dysplasia, hypohidrotic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | EDAR |
Zornitza Stark gene: EDAR was added gene: EDAR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: EDAR was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: EDAR were set to Ectodermal dysplasia, hypohidrotic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | EDA |
Zornitza Stark gene: EDA was added gene: EDA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: EDA was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: EDA were set to Ectodermal dysplasia, hypohidrotic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | DYSF | Zornitza Stark Added phenotypes Miyoshi muscular dystrophy 1 for gene: DYSF | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | DYSF |
Zornitza Stark gene: DYSF was added gene: DYSF was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: DYSF was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DYSF were set to Muscular dystrophy, limb-girdle, type 2B |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | DUOX2 |
Zornitza Stark gene: DUOX2 was added gene: DUOX2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: DUOX2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DUOX2 were set to Thyroid dyshormonogenesis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | DSP |
Zornitza Stark gene: DSP was added gene: DSP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: DSP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: DSP were set to Epidermolysis bullosa, lethal acantholytic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | DPAGT1 |
Zornitza Stark gene: DPAGT1 was added gene: DPAGT1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: DPAGT1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DPAGT1 were set to Congenital disorder of glycosylation, type Ij |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | DOK7 |
Zornitza Stark gene: DOK7 was added gene: DOK7 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: DOK7 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DOK7 were set to Congenital myasthenic syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | DOCK8 |
Zornitza Stark gene: DOCK8 was added gene: DOCK8 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: DOCK8 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DOCK8 were set to Hyper-IgE syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | DNMT3B |
Zornitza Stark gene: DNMT3B was added gene: DNMT3B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: DNMT3B was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DNMT3B were set to Immunodeficiency-centromeric instability-facial anomalies syndrome 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | DNM2 | Zornitza Stark Added phenotypes Charcot-Marie-Tooth disease, axonal, type 2M for gene: DNM2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | DNM2 |
Zornitza Stark gene: DNM2 was added gene: DNM2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: DNM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: DNM2 were set to Myopathy, centronuclear |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | DNAJB6 |
Zornitza Stark gene: DNAJB6 was added gene: DNAJB6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: DNAJB6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: DNAJB6 were set to Muscular dystrophy, limb girdle |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | DNAI1 |
Zornitza Stark gene: DNAI1 was added gene: DNAI1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: DNAI1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DNAI1 were set to Primary ciliary dyskinesia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | DNAH5 |
Zornitza Stark gene: DNAH5 was added gene: DNAH5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: DNAH5 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DNAH5 were set to Primary ciliary dyskinesia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | DNAH11 |
Zornitza Stark gene: DNAH11 was added gene: DNAH11 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: DNAH11 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DNAH11 were set to Primary ciliary dyskinesia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | DNAAF1 |
Zornitza Stark gene: DNAAF1 was added gene: DNAAF1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: DNAAF1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DNAAF1 were set to Primary ciliary dyskinesia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | DMPK |
Zornitza Stark gene: DMPK was added gene: DMPK was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: DMPK was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: DMPK were set to Myotonic dystrophy 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | DMP1 |
Zornitza Stark gene: DMP1 was added gene: DMP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: DMP1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DMP1 were set to Hypophosphatemic rickets, AR |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | DMD | Zornitza Stark Added phenotypes Becker muscular dystrophy for gene: DMD | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | DMD |
Zornitza Stark gene: DMD was added gene: DMD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: DMD was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: DMD were set to Duchenne muscular dystrophy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | DLL3 |
Zornitza Stark gene: DLL3 was added gene: DLL3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: DLL3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DLL3 were set to Spondylocostal dysostosis, autosomal recessive, 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | DLD |
Zornitza Stark gene: DLD was added gene: DLD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: DLD was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DLD were set to Maple syrup urine disease, type III |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | DHCR7 |
Zornitza Stark gene: DHCR7 was added gene: DHCR7 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: DHCR7 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DHCR7 were set to Smith-Lemli-Opitz syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | DGUOK |
Zornitza Stark gene: DGUOK was added gene: DGUOK was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: DGUOK was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DGUOK were set to Mitochondrial DNA depletion syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | DFNB59 |
Zornitza Stark gene: DFNB59 was added gene: DFNB59 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: DFNB59 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DFNB59 were set to Hearing loss |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | DFNA5 |
Zornitza Stark gene: DFNA5 was added gene: DFNA5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: DFNA5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: DFNA5 were set to Hearing loss |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | DES |
Zornitza Stark gene: DES was added gene: DES was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: DES was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: DES were set to Myopathy, myofibrillar |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | DDC |
Zornitza Stark gene: DDC was added gene: DDC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: DDC was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DDC were set to Aromatic L-amino acid decarboxylase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | DDB2 |
Zornitza Stark gene: DDB2 was added gene: DDB2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: DDB2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DDB2 were set to Xeroderma pigmentosum |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | DCX |
Zornitza Stark gene: DCX was added gene: DCX was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: DCX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: DCX were set to Lissencephaly, X-linked |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | DCLRE1C |
Zornitza Stark gene: DCLRE1C was added gene: DCLRE1C was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: DCLRE1C was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DCLRE1C were set to Severe combined immunodeficiency, Athabascan type |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | DBT |
Zornitza Stark gene: DBT was added gene: DBT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: DBT was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: DBT were set to Maple syrup urine disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | D2HGDH |
Zornitza Stark gene: D2HGDH was added gene: D2HGDH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: D2HGDH was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: D2HGDH were set to D-2-hydroxyglutaric aciduria |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CYP4F22 |
Zornitza Stark gene: CYP4F22 was added gene: CYP4F22 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CYP4F22 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CYP4F22 were set to Ichthyosis, congenital, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CYP27B1 |
Zornitza Stark gene: CYP27B1 was added gene: CYP27B1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CYP27B1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CYP27B1 were set to Vitamin D-dependent rickets, type I |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CYP27A1 |
Zornitza Stark gene: CYP27A1 was added gene: CYP27A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CYP27A1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CYP27A1 were set to Cerebrotendinous xanthomatosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CYP21A2 |
Zornitza Stark gene: CYP21A2 was added gene: CYP21A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CYP21A2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CYP21A2 were set to Adrenal hyperplasia, congenital, due to 21-hydroxylase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CYP11B1 |
Zornitza Stark gene: CYP11B1 was added gene: CYP11B1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CYP11B1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CYP11B1 were set to Adrenal hyperplasia, congenital, due to 11-beta-hydroxylase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CYP11A1 |
Zornitza Stark gene: CYP11A1 was added gene: CYP11A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CYP11A1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CYP11A1 were set to Adrenal insufficiency, congenital, with 46XY sex reversal, partial or complete |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CYBB |
Zornitza Stark gene: CYBB was added gene: CYBB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CYBB was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: CYBB were set to Chronic granulomatous disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CYBA |
Zornitza Stark gene: CYBA was added gene: CYBA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CYBA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CYBA were set to Chronic granulomatous disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CUL7 |
Zornitza Stark gene: CUL7 was added gene: CUL7 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CUL7 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CUL7 were set to 3-M syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CUBN |
Zornitza Stark gene: CUBN was added gene: CUBN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CUBN was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CUBN were set to Megaloblastic anemia-1, Finnish type |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CTSK |
Zornitza Stark gene: CTSK was added gene: CTSK was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CTSK was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CTSK were set to Pycnodysostosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CTSD |
Zornitza Stark gene: CTSD was added gene: CTSD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CTSD was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CTSD were set to Ceroid lipofuscinosis, neuronal, 10 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CTNS |
Zornitza Stark gene: CTNS was added gene: CTNS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CTNS was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CTNS were set to Cystinosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CTC1 |
Zornitza Stark gene: CTC1 was added gene: CTC1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CTC1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CTC1 were set to Coats plus syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CSTB |
Zornitza Stark gene: CSTB was added gene: CSTB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CSTB was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CSTB were set to Epilepsy, progressive myoclonic 1A |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CSF2RA |
Zornitza Stark gene: CSF2RA was added gene: CSF2RA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CSF2RA was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: CSF2RA were set to Pulmonary alveolar proteinosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CRYAB |
Zornitza Stark gene: CRYAB was added gene: CRYAB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CRYAB was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CRYAB were set to Myofibrillar myopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CRTAP |
Zornitza Stark gene: CRTAP was added gene: CRTAP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CRTAP was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CRTAP were set to Osteogenesis imperfecta, type VII |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CRLF1 |
Zornitza Stark gene: CRLF1 was added gene: CRLF1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CRLF1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CRLF1 were set to Crisponi syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CREBBP |
Zornitza Stark gene: CREBBP was added gene: CREBBP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CREBBP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CREBBP were set to Rubinstein-Taybi syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CPT2 |
Zornitza Stark gene: CPT2 was added gene: CPT2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CPT2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CPT2 were set to Carnitine palmitoyltransferase 2 deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CPT1A |
Zornitza Stark gene: CPT1A was added gene: CPT1A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CPT1A was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CPT1A were set to Carnitine palmitoyltransferase I deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CPS1 |
Zornitza Stark gene: CPS1 was added gene: CPS1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CPS1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CPS1 were set to Carbamoylphosphate synthetase I deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | COLQ |
Zornitza Stark gene: COLQ was added gene: COLQ was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: COLQ was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: COLQ were set to Congenital myasthenic syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | COL7A1 |
Zornitza Stark gene: COL7A1 was added gene: COL7A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: COL7A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: COL7A1 were set to Epidermolysis bullosa dystrophica |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | COL6A3 |
Zornitza Stark gene: COL6A3 was added gene: COL6A3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: COL6A3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: COL6A3 were set to Ullrich congenital muscular dystrophy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | COL6A2 |
Zornitza Stark gene: COL6A2 was added gene: COL6A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: COL6A2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: COL6A2 were set to Ullrich congenital muscular dystrophy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | COL6A1 |
Zornitza Stark gene: COL6A1 was added gene: COL6A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: COL6A1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: COL6A1 were set to Ullrich congenital muscular dystrophy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | COL5A2 |
Zornitza Stark gene: COL5A2 was added gene: COL5A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: COL5A2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: COL5A2 were set to Ehlers-Danlos syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | COL5A1 |
Zornitza Stark gene: COL5A1 was added gene: COL5A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: COL5A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: COL5A1 were set to Ehlers-Danlos syndrome, type I |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | COL4A5 |
Zornitza Stark gene: COL4A5 was added gene: COL4A5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: COL4A5 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: COL4A5 were set to Alport syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | COL4A4 |
Zornitza Stark gene: COL4A4 was added gene: COL4A4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: COL4A4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: COL4A4 were set to Alport syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | COL4A3 |
Zornitza Stark gene: COL4A3 was added gene: COL4A3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: COL4A3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: COL4A3 were set to Alport syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | COL3A1 |
Zornitza Stark gene: COL3A1 was added gene: COL3A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: COL3A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: COL3A1 were set to Ehlers-Danlos syndrome, type IV |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | COL2A1 |
Zornitza Stark gene: COL2A1 was added gene: COL2A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: COL2A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: COL2A1 were set to Stickler syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | COL1A2 |
Zornitza Stark gene: COL1A2 was added gene: COL1A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: COL1A2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: COL1A2 were set to Osteogenesis imperfecta, type II |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | COL1A1 |
Zornitza Stark gene: COL1A1 was added gene: COL1A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: COL1A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: COL1A1 were set to Osteogenesis imperfecta, type I |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | COL17A1 |
Zornitza Stark gene: COL17A1 was added gene: COL17A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: COL17A1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: COL17A1 were set to Epidermolysis bullosa, junctional, non-Herlitz type |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | COL11A2 |
Zornitza Stark gene: COL11A2 was added gene: COL11A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: COL11A2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: COL11A2 were set to Otospondylomegaepiphyseal dysplasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | COL11A1 |
Zornitza Stark gene: COL11A1 was added gene: COL11A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: COL11A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: COL11A1 were set to Stickler syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | COCH |
Zornitza Stark gene: COCH was added gene: COCH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: COCH was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: COCH were set to Deafness, non-syndromic, autosomal dominant |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CNGB3 |
Zornitza Stark gene: CNGB3 was added gene: CNGB3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CNGB3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CNGB3 were set to Achromatopsia-3 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CLRN1 |
Zornitza Stark gene: CLRN1 was added gene: CLRN1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CLRN1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CLRN1 were set to Usher syndrome, type 3A |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CLN8 |
Zornitza Stark gene: CLN8 was added gene: CLN8 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CLN8 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CLN8 were set to Ceroid lipofuscinosis, neuronal, 8 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CLN6 |
Zornitza Stark gene: CLN6 was added gene: CLN6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CLN6 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CLN6 were set to Ceroid lipofuscinosis, neuronal, 6 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CLN5 |
Zornitza Stark gene: CLN5 was added gene: CLN5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CLN5 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CLN5 were set to Ceroid lipofuscinosis, neuronal, 5 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CLN3 |
Zornitza Stark gene: CLN3 was added gene: CLN3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CLN3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CLN3 were set to Ceroid lipofuscinosis, neuronal, 3 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CLDN19 |
Zornitza Stark gene: CLDN19 was added gene: CLDN19 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CLDN19 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CLDN19 were set to Hypomagnesemia 5, renal, with ocular involvement |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CLDN14 |
Zornitza Stark gene: CLDN14 was added gene: CLDN14 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CLDN14 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CLDN14 were set to Hearing loss, non-syndromic, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CLCN5 |
Zornitza Stark gene: CLCN5 was added gene: CLCN5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CLCN5 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: CLCN5 were set to Dent disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CHRNG |
Zornitza Stark gene: CHRNG was added gene: CHRNG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CHRNG was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CHRNG were set to Pterygium syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CHRNE |
Zornitza Stark gene: CHRNE was added gene: CHRNE was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CHRNE was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CHRNE were set to Congenital myasthenic syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CHRND |
Zornitza Stark gene: CHRND was added gene: CHRND was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CHRND was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CHRND were set to Congenital myasthenic syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CHRNA1 |
Zornitza Stark gene: CHRNA1 was added gene: CHRNA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CHRNA1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CHRNA1 were set to Congenital myasthenic syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CHM |
Zornitza Stark gene: CHM was added gene: CHM was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CHM was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: CHM were set to Choroideremia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CHKB |
Zornitza Stark gene: CHKB was added gene: CHKB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CHKB was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CHKB were set to Muscular dystrophy, congenital, megaconial type |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CHD7 |
Zornitza Stark gene: CHD7 was added gene: CHD7 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CHD7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CHD7 were set to CHARGE syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CHD2 |
Zornitza Stark gene: CHD2 was added gene: CHD2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CHD2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CHD2 were set to Developmental delay, intellectual disability, epilepsy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CHAT |
Zornitza Stark gene: CHAT was added gene: CHAT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CHAT was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CHAT were set to Congenital myasthenic syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CFTR |
Zornitza Stark gene: CFTR was added gene: CFTR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CFTR was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CFTR were set to Cystic fibrosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CFP |
Zornitza Stark gene: CFP was added gene: CFP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CFP was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: CFP were set to Properdin deficiency, X-linked |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CFL2 |
Zornitza Stark gene: CFL2 was added gene: CFL2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CFL2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CFL2 were set to Nemaline myopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CFC1 |
Zornitza Stark gene: CFC1 was added gene: CFC1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CFC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CFC1 were set to Congenital heart defects |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CEP290 |
Zornitza Stark gene: CEP290 was added gene: CEP290 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CEP290 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CEP290 were set to Joubert syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CEP152 |
Zornitza Stark gene: CEP152 was added gene: CEP152 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CEP152 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CEP152 were set to Seckel syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CDSN |
Zornitza Stark gene: CDSN was added gene: CDSN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CDSN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CDSN were set to Hypotrichosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CDKN1C |
Zornitza Stark gene: CDKN1C was added gene: CDKN1C was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CDKN1C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CDKN1C were set to Beckwith-Wiedemann syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CDKL5 |
Zornitza Stark gene: CDKL5 was added gene: CDKL5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CDKL5 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: CDKL5 were set to Epileptic encephalopathy, early infantile, 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CDH23 | Zornitza Stark Added phenotypes Usher syndrome, type 1D for gene: CDH23 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CDH23 |
Zornitza Stark gene: CDH23 was added gene: CDH23 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CDH23 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CDH23 were set to Deafness, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CDAN1 |
Zornitza Stark gene: CDAN1 was added gene: CDAN1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CDAN1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CDAN1 were set to Anemia, congenital dyserythropoietic, type I |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CD40LG |
Zornitza Stark gene: CD40LG was added gene: CD40LG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CD40LG was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: CD40LG were set to Immunodeficiency, X-linked, with hyper-IgM |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CCDC40 |
Zornitza Stark gene: CCDC40 was added gene: CCDC40 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CCDC40 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CCDC40 were set to Primary ciliary dyskinesia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CCDC39 |
Zornitza Stark gene: CCDC39 was added gene: CCDC39 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CCDC39 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CCDC39 were set to Primary ciliary dyskinesia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CC2D2A |
Zornitza Stark gene: CC2D2A was added gene: CC2D2A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CC2D2A was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CC2D2A were set to Joubert syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CBS |
Zornitza Stark gene: CBS was added gene: CBS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CBS was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CBS were set to Homocystinuria, B6-responsive and nonresponsive types |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CBL |
Zornitza Stark gene: CBL was added gene: CBL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CBL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CBL were set to Noonan syndrome-like disorder with or without juvenile meylomonocytic leukemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CAV3 | Zornitza Stark Added phenotypes Caveolinopathy for gene: CAV3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CAV3 |
Zornitza Stark gene: CAV3 was added gene: CAV3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CAV3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CAV3 were set to Muscular dystrophy, limb-girdle, type IC, |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CASQ2 |
Zornitza Stark gene: CASQ2 was added gene: CASQ2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CASQ2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CASQ2 were set to Ventricular tachycardia, catecholaminergic polymorphic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CASK |
Zornitza Stark gene: CASK was added gene: CASK was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CASK was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: CASK were set to Mental retardation and microcephaly with pontine and cerebellar hypoplasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CAPN3 |
Zornitza Stark gene: CAPN3 was added gene: CAPN3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CAPN3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CAPN3 were set to Muscular dystrophy, limb-girdle, type 2A |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CACNA1F |
Zornitza Stark gene: CACNA1F was added gene: CACNA1F was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CACNA1F was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: CACNA1F were set to Night blindness, congenital stationary (complete), 1A, X-linked |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CACNA1A |
Zornitza Stark gene: CACNA1A was added gene: CACNA1A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CACNA1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: CACNA1A were set to Episodic ataxia, type 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | CA2 |
Zornitza Stark gene: CA2 was added gene: CA2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: CA2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: CA2 were set to Osteopetrosis, autosomal recessive 3, with renal tubular acidosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | TWNK |
Zornitza Stark gene: TWNK was added gene: TWNK was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: TWNK was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: TWNK were set to Spinocerebellar ataxia infantile-onset |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | BTK |
Zornitza Stark gene: BTK was added gene: BTK was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: BTK was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: BTK were set to Agammaglobulinemia, X-linked 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | BTD |
Zornitza Stark gene: BTD was added gene: BTD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: BTD was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: BTD were set to Biotinidase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | BSND |
Zornitza Stark gene: BSND was added gene: BSND was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: BSND was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: BSND were set to Bartter syndrome with sensorineural deafness |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | BSCL2 |
Zornitza Stark gene: BSCL2 was added gene: BSCL2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: BSCL2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: BSCL2 were set to Berardinelli-Seip lipodystrophy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | BRCA2 |
Zornitza Stark gene: BRCA2 was added gene: BRCA2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: BRCA2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: BRCA2 were set to Fanconi anemia, complementation group D1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | BRAF |
Zornitza Stark gene: BRAF was added gene: BRAF was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: BRAF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: BRAF were set to Cardiofaciocutaneous syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | BMPR1A |
Zornitza Stark gene: BMPR1A was added gene: BMPR1A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: BMPR1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: BMPR1A were set to Juvenile polyposis syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | BLM |
Zornitza Stark gene: BLM was added gene: BLM was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: BLM was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: BLM were set to Bloom syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | BIN1 |
Zornitza Stark gene: BIN1 was added gene: BIN1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: BIN1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: BIN1 were set to Myopathy, centronuclear, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | BICD2 |
Zornitza Stark gene: BICD2 was added gene: BICD2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: BICD2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: BICD2 were set to Congenital spinal muscular atrophy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | BCS1L |
Zornitza Stark gene: BCS1L was added gene: BCS1L was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: BCS1L was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: BCS1L were set to Complex 3 deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | BCKDHB |
Zornitza Stark gene: BCKDHB was added gene: BCKDHB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: BCKDHB was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: BCKDHB were set to Maple syrup urine disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | BCKDHA |
Zornitza Stark gene: BCKDHA was added gene: BCKDHA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: BCKDHA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: BCKDHA were set to Maple syrup urine disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | BBS9 |
Zornitza Stark gene: BBS9 was added gene: BBS9 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: BBS9 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: BBS9 were set to Bardet-Biedl syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | BBS7 |
Zornitza Stark gene: BBS7 was added gene: BBS7 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: BBS7 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: BBS7 were set to Bardet-Biedl syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | BBS5 |
Zornitza Stark gene: BBS5 was added gene: BBS5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: BBS5 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: BBS5 were set to Bardet-Biedl syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | BBS4 |
Zornitza Stark gene: BBS4 was added gene: BBS4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: BBS4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: BBS4 were set to Bardet-Biedl syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | BBS2 |
Zornitza Stark gene: BBS2 was added gene: BBS2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: BBS2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: BBS2 were set to Bardet-Biedl syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | BBS12 |
Zornitza Stark gene: BBS12 was added gene: BBS12 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: BBS12 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: BBS12 were set to Bardet-Biedl syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | BBS10 |
Zornitza Stark gene: BBS10 was added gene: BBS10 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: BBS10 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: BBS10 were set to Bardet-Biedl syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | BBS1 |
Zornitza Stark gene: BBS1 was added gene: BBS1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: BBS1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: BBS1 were set to Bardet-Biedl syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | BAAT |
Zornitza Stark gene: BAAT was added gene: BAAT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: BAAT was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: BAAT were set to Bile acid amidation defect |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | B3GLCT |
Zornitza Stark gene: B3GLCT was added gene: B3GLCT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: B3GLCT was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: B3GLCT were set to Peters-Plus syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | AVPR2 |
Zornitza Stark gene: AVPR2 was added gene: AVPR2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: AVPR2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: AVPR2 were set to Diabetes insipidus, nephrogenic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | AUH |
Zornitza Stark gene: AUH was added gene: AUH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: AUH was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: AUH were set to 3-methylglutaconic aciduria, type I |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ATRX |
Zornitza Stark gene: ATRX was added gene: ATRX was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ATRX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: ATRX were set to Alpha-thalassemia/mental retardation syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ATP8B1 |
Zornitza Stark gene: ATP8B1 was added gene: ATP8B1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ATP8B1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ATP8B1 were set to Cholestasis, progressive familial intrahepatic 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ATP7B |
Zornitza Stark gene: ATP7B was added gene: ATP7B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ATP7B was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ATP7B were set to Wilson disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ATP7A | Zornitza Stark Added phenotypes Occipital horn syndrome for gene: ATP7A | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ATP7A |
Zornitza Stark gene: ATP7A was added gene: ATP7A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ATP7A was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: ATP7A were set to Menkes syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ATP6V1B1 |
Zornitza Stark gene: ATP6V1B1 was added gene: ATP6V1B1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ATP6V1B1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ATP6V1B1 were set to Renal tubular acidosis & hearing loss |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ATP6V0A2 |
Zornitza Stark gene: ATP6V0A2 was added gene: ATP6V0A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ATP6V0A2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ATP6V0A2 were set to Cutis laxa, autosomal recessive, type IIA |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ATP2A1 |
Zornitza Stark gene: ATP2A1 was added gene: ATP2A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ATP2A1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ATP2A1 were set to Brody myopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ATP1A2 |
Zornitza Stark gene: ATP1A2 was added gene: ATP1A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ATP1A2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ATP1A2 were set to Hemiplegic migraine |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ATM |
Zornitza Stark gene: ATM was added gene: ATM was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ATM was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ATM were set to Ataxia-telangiectasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ASS1 |
Zornitza Stark gene: ASS1 was added gene: ASS1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ASS1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ASS1 were set to Citrullinemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ASPA |
Zornitza Stark gene: ASPA was added gene: ASPA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ASPA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ASPA were set to Canavan disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ASL |
Zornitza Stark gene: ASL was added gene: ASL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ASL was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ASL were set to Argininosuccinic aciduria |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ARX |
Zornitza Stark gene: ARX was added gene: ARX was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ARX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: ARX were set to Lissencephaly, X-linked 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ARSB |
Zornitza Stark gene: ARSB was added gene: ARSB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ARSB was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ARSB were set to Mucopolysaccharidosis type VI (Maroteaux-Lamy) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ARSA |
Zornitza Stark gene: ARSA was added gene: ARSA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ARSA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ARSA were set to Metachromatic leukodystrophy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ARMC4 |
Zornitza Stark gene: ARMC4 was added gene: ARMC4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ARMC4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ARMC4 were set to Primary ciliary dyskinesia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ARID1B |
Zornitza Stark gene: ARID1B was added gene: ARID1B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ARID1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ARID1B were set to Coffin-Siris syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ARG1 |
Zornitza Stark gene: ARG1 was added gene: ARG1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ARG1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ARG1 were set to Arginase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ARFGEF2 |
Zornitza Stark gene: ARFGEF2 was added gene: ARFGEF2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ARFGEF2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ARFGEF2 were set to Periventricular heterotopia with microcephaly |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | AR |
Zornitza Stark gene: AR was added gene: AR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: AR was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: AR were set to Androgen insensitivity |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | APTX |
Zornitza Stark gene: APTX was added gene: APTX was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: APTX was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: APTX were set to Ataxia, early-onset, with oculomotor apraxia and hypoalbuminemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | APOB |
Zornitza Stark gene: APOB was added gene: APOB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: APOB was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: APOB were set to Apolipoprotein B deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | APC | Zornitza Stark Added phenotypes Adenomatous polyposis coli, attenuated for gene: APC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | APC |
Zornitza Stark gene: APC was added gene: APC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: APC was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: APC were set to Adenomatous polyposis coli |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | AP3B1 |
Zornitza Stark gene: AP3B1 was added gene: AP3B1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: AP3B1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: AP3B1 were set to Hermansky-Pudlak syndrome 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ANTXR2 |
Zornitza Stark gene: ANTXR2 was added gene: ANTXR2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ANTXR2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ANTXR2 were set to Hyaline fibromatosis syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ANO5 |
Zornitza Stark gene: ANO5 was added gene: ANO5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ANO5 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ANO5 were set to Muscular dystrophy, limb-girdle, type 2L |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ANO10 |
Zornitza Stark gene: ANO10 was added gene: ANO10 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ANO10 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ANO10 were set to Spinocerebellar ataxia, autosomal recessive 10 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ANKRD26 |
Zornitza Stark gene: ANKRD26 was added gene: ANKRD26 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ANKRD26 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ANKRD26 were set to Thrombocytopenia 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ANKH |
Zornitza Stark gene: ANKH was added gene: ANKH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ANKH was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ANKH were set to Craniometaphyseal dysplasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ANK1 |
Zornitza Stark gene: ANK1 was added gene: ANK1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ANK1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ANK1 were set to Spherocytosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | AMT |
Zornitza Stark gene: AMT was added gene: AMT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: AMT was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: AMT were set to Hyperglycinaemia, non-ketotic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | AMN |
Zornitza Stark gene: AMN was added gene: AMN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: AMN was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: AMN were set to Megaloblastic anemia-1, Norwegian type |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | AMELX |
Zornitza Stark gene: AMELX was added gene: AMELX was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: AMELX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: AMELX were set to Amelogenesis imperfecta |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ALX4 |
Zornitza Stark gene: ALX4 was added gene: ALX4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ALX4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ALX4 were set to Parietal foramina 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ALS2 |
Zornitza Stark gene: ALS2 was added gene: ALS2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ALS2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ALS2 were set to Amyotrophic lateral sclerosis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ALPL |
Zornitza Stark gene: ALPL was added gene: ALPL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ALPL was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ALPL were set to Hypophosphatasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ALOXE3 |
Zornitza Stark gene: ALOXE3 was added gene: ALOXE3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ALOXE3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ALOXE3 were set to Ichthyosis, congenital, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ALOX12B |
Zornitza Stark gene: ALOX12B was added gene: ALOX12B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ALOX12B was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ALOX12B were set to Ichthyosis, congenital, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ALMS1 |
Zornitza Stark gene: ALMS1 was added gene: ALMS1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ALMS1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ALMS1 were set to Alstrom syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ALG8 |
Zornitza Stark gene: ALG8 was added gene: ALG8 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ALG8 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ALG8 were set to Congenital disorder of glycosylation, type Ih |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ALG6 |
Zornitza Stark gene: ALG6 was added gene: ALG6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ALG6 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ALG6 were set to Congenital disorder of glycosylation, type Ic |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ALG3 |
Zornitza Stark gene: ALG3 was added gene: ALG3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ALG3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ALG3 were set to Congenital disorder of glycosylation, type Id |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ALG12 |
Zornitza Stark gene: ALG12 was added gene: ALG12 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ALG12 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ALG12 were set to Congenital disorder of glycosylation, type Ig |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ALG1 |
Zornitza Stark gene: ALG1 was added gene: ALG1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ALG1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ALG1 were set to Congenital disorder of glycosylation, type Ik |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ALDOB |
Zornitza Stark gene: ALDOB was added gene: ALDOB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ALDOB was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ALDOB were set to Fructose intolerance |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ALDH5A1 |
Zornitza Stark gene: ALDH5A1 was added gene: ALDH5A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ALDH5A1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ALDH5A1 were set to Succinic semialdehyde dehydrogenase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ALDH3A2 |
Zornitza Stark gene: ALDH3A2 was added gene: ALDH3A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ALDH3A2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ALDH3A2 were set to Sjogren-Larsson syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ALDH18A1 |
Zornitza Stark gene: ALDH18A1 was added gene: ALDH18A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ALDH18A1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ALDH18A1 were set to Cutis laxa, autosomal recessive, type IIIA |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ALB |
Zornitza Stark gene: ALB was added gene: ALB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ALB was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ALB were set to Analbuminemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ALAS2 |
Zornitza Stark gene: ALAS2 was added gene: ALAS2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ALAS2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: ALAS2 were set to Anemia, sideroblastic, X-linked |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | AKR1D1 |
Zornitza Stark gene: AKR1D1 was added gene: AKR1D1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: AKR1D1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: AKR1D1 were set to Bile acid synthesis defect, congenital, 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | AIRE |
Zornitza Stark gene: AIRE was added gene: AIRE was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: AIRE was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: AIRE were set to Autoimmune polyendocrinopathy syndrome , type I, with or without reversible metaphyseal dysplasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | AIFM1 |
Zornitza Stark gene: AIFM1 was added gene: AIFM1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: AIFM1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: AIFM1 were set to Cowchock syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | AHI1 |
Zornitza Stark gene: AHI1 was added gene: AHI1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: AHI1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: AHI1 were set to Joubert syndrome-3 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | AGXT |
Zornitza Stark gene: AGXT was added gene: AGXT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: AGXT was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: AGXT were set to Hyperoxaluria, primary, type 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | AGRN |
Zornitza Stark gene: AGRN was added gene: AGRN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: AGRN was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: AGRN were set to Myasthenia, limb-girdle, familial |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | AGL |
Zornitza Stark gene: AGL was added gene: AGL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: AGL was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: AGL were set to Glycogen storage disease IIIa |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | AGA |
Zornitza Stark gene: AGA was added gene: AGA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: AGA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: AGA were set to Aspartylglucosaminuria |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ADK |
Zornitza Stark gene: ADK was added gene: ADK was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ADK was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ADK were set to Hypermethioninemia due to adenosine kinase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ADAR |
Zornitza Stark Mode of inheritance for gene ADAR was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Added phenotypes Dyschromatosis symmetrica hereditaria for gene: ADAR |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ADAR |
Zornitza Stark gene: ADAR was added gene: ADAR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ADAR was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ADAR were set to Aicardi-Goutieres syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ADAMTSL2 |
Zornitza Stark gene: ADAMTSL2 was added gene: ADAMTSL2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ADAMTSL2 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ADAMTSL2 were set to Geleophysic dysplasia 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ADAMTS13 |
Zornitza Stark gene: ADAMTS13 was added gene: ADAMTS13 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ADAMTS13 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ADAMTS13 were set to Thrombotic thrombocytopenic purpura, familial |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ADA |
Zornitza Stark gene: ADA was added gene: ADA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ADA was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ADA were set to Severe combined immunodeficiency due to ADA deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ACVRL1 |
Zornitza Stark gene: ACVRL1 was added gene: ACVRL1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ACVRL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ACVRL1 were set to Telangiectasia, hereditary hemorrhagic, type 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ACVR1 |
Zornitza Stark gene: ACVR1 was added gene: ACVR1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ACVR1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ACVR1 were set to Fibrodysplasia ossificans progressiva |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ACTN4 |
Zornitza Stark gene: ACTN4 was added gene: ACTN4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ACTN4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ACTN4 were set to Glomerulosclerosis, focal segmental, 1 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ACTN1 |
Zornitza Stark gene: ACTN1 was added gene: ACTN1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ACTN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ACTN1 were set to Macrothrombocytopenia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ACTG2 |
Zornitza Stark gene: ACTG2 was added gene: ACTG2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ACTG2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ACTG2 were set to Megacystis-microcolon-intestinal hypoperistalsis syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ACTG1 | Zornitza Stark Added phenotypes Baraitser-Winter syndrome for gene: ACTG1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ACTG1 |
Zornitza Stark gene: ACTG1 was added gene: ACTG1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ACTG1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ACTG1 were set to Deafness, autosomal dominant |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ACTB |
Zornitza Stark gene: ACTB was added gene: ACTB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ACTB was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ACTB were set to Baraitser-Winter syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ACTA1 |
Zornitza Stark gene: ACTA1 was added gene: ACTA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ACTA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ACTA1 were set to Nemaline myopathy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ACSF3 |
Zornitza Stark gene: ACSF3 was added gene: ACSF3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ACSF3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ACSF3 were set to Combined malonic and methylmalonic aciduria |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ACOX1 |
Zornitza Stark gene: ACOX1 was added gene: ACOX1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ACOX1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ACOX1 were set to Peroxisomal acyl-CoA oxidase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ACE |
Zornitza Stark gene: ACE was added gene: ACE was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ACE was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ACE were set to Renal tubular dysgenesis |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ACAT1 |
Zornitza Stark gene: ACAT1 was added gene: ACAT1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ACAT1 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ACAT1 were set to Alpha-methylacetoacetic aciduria |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ACADVL |
Zornitza Stark gene: ACADVL was added gene: ACADVL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ACADVL was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ACADVL were set to VLCAD deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ACADM |
Zornitza Stark gene: ACADM was added gene: ACADM was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ACADM was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ACADM were set to Medium chain acyl CoA dehydrogenase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ACAD9 |
Zornitza Stark gene: ACAD9 was added gene: ACAD9 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ACAD9 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ACAD9 were set to ACAD9 deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ACAD8 |
Zornitza Stark gene: ACAD8 was added gene: ACAD8 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ACAD8 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ACAD8 were set to Isobutyryl-CoA dehydrogenase deficiency |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ABCG5 |
Zornitza Stark gene: ABCG5 was added gene: ABCG5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ABCG5 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ABCG5 were set to Sitosterolemia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ABCD1 |
Zornitza Stark gene: ABCD1 was added gene: ABCD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ABCD1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Phenotypes for gene: ABCD1 were set to Adrenoleukodystrophy |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ABCC9 |
Zornitza Stark gene: ABCC9 was added gene: ABCC9 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ABCC9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: ABCC9 were set to Hypertrichotic osteochondrodysplasia |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ABCC8 |
Zornitza Stark gene: ABCC8 was added gene: ABCC8 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ABCC8 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ABCC8 were set to Hyperinsulinemic hypoglycemia, familial |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ABCC6 |
Zornitza Stark gene: ABCC6 was added gene: ABCC6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ABCC6 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ABCC6 were set to Pseudoxanthoma elasticum |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ABCB4 |
Zornitza Stark gene: ABCB4 was added gene: ABCB4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ABCB4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ABCB4 were set to Cholestasis, progressive familial intrahepatic 3 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ABCB11 |
Zornitza Stark gene: ABCB11 was added gene: ABCB11 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ABCB11 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ABCB11 were set to Cholestasis, progressive familial intrahepatic 2 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ABCA4 |
Zornitza Stark gene: ABCA4 was added gene: ABCA4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ABCA4 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ABCA4 were set to Stargardt disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ABCA3 |
Zornitza Stark gene: ABCA3 was added gene: ABCA3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ABCA3 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ABCA3 were set to Surfactant metabolism dysfunction, pulmonary, 3 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | ABCA12 |
Zornitza Stark gene: ABCA12 was added gene: ABCA12 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: ABCA12 was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: ABCA12 were set to Ichthyosis, congenital, autosomal recessive |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | AARS |
Zornitza Stark gene: AARS was added gene: AARS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: AARS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Phenotypes for gene: AARS were set to Charcot-Marie-Tooth disease |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | AAAS |
Zornitza Stark gene: AAAS was added gene: AAAS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene Mode of inheritance for gene: AAAS was set to BIALLELIC, autosomal or pseudoautosomal Phenotypes for gene: AAAS were set to Achalasia-addisonianism-alacrimia syndrome |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Additional findings_Paediatric v0.0 | Zornitza Stark Added panel Newborn Screening_BabySeq | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.68 | C9orf72 | Bryony Thompson Classified gene: C9orf72 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.68 | C9orf72 | Bryony Thompson Added comment: Comment on list classification: Only reported cause of disease is a hexanucleotide repeat (GGGGCC) located between the noncoding exons 1a and 1b. RNA toxicity or proteotoxicity is the expected mechanism of disease. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.68 | C9orf72 | Bryony Thompson Gene: c9orf72 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.97 | EPM1 | Bryony Thompson Classified STR: EPM1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.97 | EPM1 | Bryony Thompson Str: epm1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.96 | EPM1 |
Bryony Thompson STR: EPM1 was added STR: EPM1 was added to Ataxia - adult onset. Sources: Literature STR tags were added to STR: EPM1. Mode of inheritance for STR: EPM1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: EPM1 were set to 29325606; 20301321 Phenotypes for STR: EPM1 were set to Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800 Review for STR: EPM1 was set to GREEN STR: EPM1 was marked as clinically relevant Added comment: NM_000100.4:c.-179CCCCGCCCCGCG[X] Loss of function, other disease-associated variants can cause loss of function too. Ataxia age of onset usually occurs a couple of years after PME. Normal: 2-3 dodecamer repeats Uncertain significance: 12-17 dodecamer repeats (unstable, but not clinically characterized) Pathogenic (full penetrance): ≥30 dodecamer repeats Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.95 | FMR1 | Bryony Thompson Classified gene: FMR1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.95 | FMR1 | Bryony Thompson Added comment: Comment on list classification: CCG repeat expansion is the only reported cause of ataxia (FXTAS). The SNVs are associated with intellectual disability in FXS. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.95 | FMR1 | Bryony Thompson Gene: fmr1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.94 | FMR1 | Bryony Thompson Deleted their review | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.94 | FRDA | Bryony Thompson Classified STR: FRDA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.94 | FRDA | Bryony Thompson Str: frda has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.93 | FRDA |
Bryony Thompson STR: FRDA was added STR: FRDA was added to Ataxia - adult onset. Sources: Expert list STR tags were added to STR: FRDA. Mode of inheritance for STR: FRDA was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: FRDA were set to 20301458 Phenotypes for STR: FRDA were set to Friedreich ataxia MIM#229300 Review for STR: FRDA was set to GREEN STR: FRDA was marked as clinically relevant Added comment: NM_000144.4:c.165+1340GAA[X] Loss of function is the mechanism of disease Normal: 5-33 repeats Mutable normal (premutation): 34-65 repeats Borderline: 44-66 repeats Full-penetrance: ≥66 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.67 | HDL2 | Bryony Thompson Classified STR: HDL2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.67 | HDL2 | Bryony Thompson Str: hdl2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.66 | HDL2 |
Bryony Thompson STR: HDL2 was added STR: HDL2 was added to Early-onset Dementia. Sources: Expert list STR tags were added to STR: HDL2. Mode of inheritance for STR: HDL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: HDL2 were set to 20301701 Phenotypes for STR: HDL2 were set to Huntington disease-like 2 MIM#606438 Review for STR: HDL2 was set to GREEN STR: HDL2 was marked as clinically relevant Added comment: NM_001271604.2:c.431CTG[X] or NM_020655.4:c.382+760CTG[X] In an alternatively spliced exon, the repeat can be transcribed in both directions, leading to CUG (more common) or CAG (less common) repeat-containing transcripts. While a dominant RNA toxic effect may occur, the repeat expansion also reduces levels of the Junctophilin-3 protein Normal: ≤28 repeats Questionable significance: 29-39 repeats, mutable normal or reduced penetrance included Full penetrance: ≥40 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.92 | SCA36 | Bryony Thompson Classified STR: SCA36 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.92 | SCA36 | Bryony Thompson Str: sca36 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.91 | SCA36 |
Bryony Thompson STR: SCA36 was added STR: SCA36 was added to Ataxia - adult onset. Sources: Expert list STR tags were added to STR: SCA36. Mode of inheritance for STR: SCA36 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA36 were set to 25101480 Phenotypes for STR: SCA36 were set to Spinocerebellar ataxia 36 MIM#614153 Review for STR: SCA36 was set to GREEN STR: SCA36 was marked as clinically relevant Added comment: NM_006392.3:c.3+71GGCCTG[X] Toxic RNA effect is suggested mechanism of disease Normal: 3-14 repeats Uncertain significance: 15-650 repeats Pathogenic: ≥650 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.90 | NOP56 | Bryony Thompson Classified gene: NOP56 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.90 | NOP56 | Bryony Thompson Added comment: Comment on list classification: A hexanucleotide (GGCCTG) repeat expansion in the first intron of the NOP56 gene is the only reported cause of disease. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.90 | NOP56 | Bryony Thompson Gene: nop56 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.89 | NOP56 | Bryony Thompson Publications for gene: NOP56 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.88 | NOP56 | Bryony Thompson Tag STR tag was added to gene: NOP56. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.88 | NOP56 | Bryony Thompson Phenotypes for gene: NOP56 were changed from Spinocerebellarataxia36,614153 to Spinocerebellar ataxia 36, 614153 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3952 | BCLAF1 | Zornitza Stark Marked gene: BCLAF1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3952 | BCLAF1 | Zornitza Stark Gene: bclaf1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3952 | BCLAF1 | Zornitza Stark Classified gene: BCLAF1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3952 | BCLAF1 | Zornitza Stark Gene: bclaf1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.87 | SCA12 | Bryony Thompson Classified STR: SCA12 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.87 | SCA12 | Bryony Thompson Str: sca12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.86 | SCA12 |
Bryony Thompson STR: SCA12 was added STR: SCA12 was added to Ataxia - adult onset. Sources: Expert list STR tags were added to STR: SCA12. Mode of inheritance for STR: SCA12 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA12 were set to 29325606; 20301381 Phenotypes for STR: SCA12 were set to Spinocerebellar ataxia 12 MIM#604326 Review for STR: SCA12 was set to GREEN STR: SCA12 was marked as clinically relevant Added comment: NM_181675.3:c.27CAG[X] Uncertain if CAG repeat encodes polyglutamine or instead effects expression of specific splice variants of the encoded phosphatase Normal: ≤32 repeats Reduced penetrance: ~40-66 repeats Full penetrance: ≥66 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3951 | BCLAF1 | Naomi Baker reviewed gene: BCLAF1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.85 | SCA10 | Bryony Thompson Classified STR: SCA10 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.85 | SCA10 | Bryony Thompson Str: sca10 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.84 | SCA10 |
Bryony Thompson STR: SCA10 was added STR: SCA10 was added to Ataxia - adult onset. Sources: Expert list STR tags were added to STR: SCA10. Mode of inheritance for STR: SCA10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA10 were set to 20301354 Phenotypes for STR: SCA10 were set to Spinocerebellar ataxia 10 MIM#603516 STR: SCA10 was marked as clinically relevant Added comment: NM_013236.2:c.1430+54822ATTCT[X] Toxic RNA gain-of-function mechanism of disease Normal alleles: 10-32 ATTCT repeats Alleles of questionable significance: 33-280 ATTCT repeats Reduced-penetrance alleles: 33-850 repeats Full-penetrance alleles: 800-4,500 ATTCT repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.83 | SCA8 | Bryony Thompson Classified STR: SCA8 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.83 | SCA8 | Bryony Thompson Str: sca8 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.82 | SCA8 |
Bryony Thompson STR: SCA8 was added STR: SCA8 was added to Ataxia - adult onset. Sources: Expert list STR tags were added to STR: SCA8. Mode of inheritance for STR: SCA8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA8 were set to 20301445 Phenotypes for STR: SCA8 were set to Spinocerebellar ataxia 8 MIM#608768 Review for STR: SCA8 was set to GREEN STR: SCA8 was marked as clinically relevant Added comment: NR_002717.2:n.1073CTA[X]1103CTG[X] ATXN8 (CAG)n(TAG)n vs ATXN8OS on opposite strand (CTA)n(CTG)n Both toxic RNA and toxic protein gain of function mechanisms likely contribute to disease mechanism Normal alleles: 15-50 combined (CTA·TAG)n(CTG·CAG)n repeats Alleles of questionable significance: 50-70 repeats. Reduced penetrance allele size: found for (CTA·TAG)n(CTG·CAG)n repeats of all sizes Higher penetrance allele size: ≥80 (CTA·TAG)n(CTG·CAG)n repeats most often seen in individuals with ataxia; however, repeat sizes ranging from 71 to more than 1300 repeats have been found both in individuals who develop ataxia and in those who do not. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.81 | SCA17 | Bryony Thompson Classified STR: SCA17 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.81 | SCA17 | Bryony Thompson Str: sca17 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.80 | SCA17 |
Bryony Thompson STR: SCA17 was added STR: SCA17 was added to Ataxia - adult onset. Sources: Expert list STR tags were added to STR: SCA17. Mode of inheritance for STR: SCA17 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA17 were set to 20301611; 29325606 Phenotypes for STR: SCA17 were set to Spinocerebellar ataxia 17 MIM#607136 Review for STR: SCA17 was set to GREEN STR: SCA17 was marked as clinically relevant Added comment: NM_003194.4:c.172_174[X] Mechanism of disease expected to be gain of function Normal: ≤ 40 CAG/CAA repeats Reduced-penetrance: 41-48 CAG/CAA repeats, individual may or may not develop symptoms. Full-penetrance: ≥49 CAG/CAA repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.204 | MYO9A | Alison Yeung Marked gene: MYO9A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.204 | MYO9A | Alison Yeung Gene: myo9a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.204 | MYO9A | Alison Yeung Classified gene: MYO9A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.204 | MYO9A | Alison Yeung Gene: myo9a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Arthrogryposis v0.203 | MYO9A |
Alison Yeung gene: MYO9A was added gene: MYO9A was added to Arthrogryposis. Sources: Literature Mode of inheritance for gene: MYO9A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: MYO9A were set to 26752647; 27259756 Phenotypes for gene: MYO9A were set to MYASTHENIC SYNDROME, CONGENITAL, 24 OMIM# 618198 Review for gene: MYO9A was set to GREEN Added comment: Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2881 | ALG12 | Zornitza Stark Marked gene: ALG12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2881 | ALG12 | Zornitza Stark Gene: alg12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2881 | ALG12 | Zornitza Stark Phenotypes for gene: ALG12 were changed from to Congenital disorder of glycosylation, type Ig, MIM# 607143 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2880 | ALG12 | Zornitza Stark Publications for gene: ALG12 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2879 | ALG12 | Zornitza Stark Mode of inheritance for gene: ALG12 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2878 | ALG12 | Zornitza Stark reviewed gene: ALG12: Rating: GREEN; Mode of pathogenicity: None; Publications: 31481313; Phenotypes: Congenital disorder of glycosylation, type Ig, MIM# 607143; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3951 | ALG12 | Zornitza Stark Marked gene: ALG12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3951 | ALG12 | Zornitza Stark Gene: alg12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3951 | ALG12 | Zornitza Stark Phenotypes for gene: ALG12 were changed from to Congenital disorder of glycosylation, type Ig, MIM# 607143 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.79 | SCA7 | Bryony Thompson Classified STR: SCA7 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.79 | SCA7 | Bryony Thompson Str: sca7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.78 | SCA7 |
Bryony Thompson STR: SCA7 was added STR: SCA7 was added to Ataxia - adult onset. Sources: Expert list STR tags were added to STR: SCA7. Mode of inheritance for STR: SCA7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA7 were set to 29325606; 20301433 Phenotypes for STR: SCA7 were set to Spinocerebellar ataxia 7 MIM#164500 Review for STR: SCA7 was set to GREEN STR: SCA7 was marked as clinically relevant Added comment: NM_000333.3:c.89_91AGC[X] Gain of function mechanism of disease Normal: ≤27 repeats Mutable normal: 28-33 repeats, meiotically unstable, but not associated with an abnormal phenotype. Pathogenic reduced penetrance: 34-36 repeats, when manifestations occur, they are more likely to be later onset and milder than average Pathogenic full penetrance: 37-460 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3950 | SEC61A1 | Zornitza Stark Marked gene: SEC61A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3950 | SEC61A1 | Zornitza Stark Gene: sec61a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3950 | SEC61A1 | Zornitza Stark Phenotypes for gene: SEC61A1 were changed from to Hyperuricemic nephropathy, familial juvenile, 4, MIM# 617056; Hypogammaglobulinaemia; Neutropaenia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3949 | SEC61A1 | Zornitza Stark Publications for gene: SEC61A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3948 | SEC61A1 | Zornitza Stark Mode of inheritance for gene: SEC61A1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3947 | SEC61A1 | Zornitza Stark reviewed gene: SEC61A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27392076, 32325141, 28782633; Phenotypes: Hyperuricemic nephropathy, familial juvenile, 4, MIM# 617056, Hypogammaglobulinaemia, Neutropaenia; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Tubulointerstitial Disease v0.25 | SEC61A1 | Zornitza Stark Marked gene: SEC61A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Tubulointerstitial Disease v0.25 | SEC61A1 | Zornitza Stark Gene: sec61a1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Tubulointerstitial Disease v0.25 | SEC61A1 | Zornitza Stark Phenotypes for gene: SEC61A1 were changed from to Hyperuricemic nephropathy, familial juvenile, 4, MIM# 617056 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Tubulointerstitial Disease v0.24 | SEC61A1 | Zornitza Stark Publications for gene: SEC61A1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Tubulointerstitial Disease v0.23 | SEC61A1 | Zornitza Stark Mode of inheritance for gene: SEC61A1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Tubulointerstitial Disease v0.22 | SEC61A1 | Zornitza Stark reviewed gene: SEC61A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27392076; Phenotypes: Hyperuricemic nephropathy, familial juvenile, 4, MIM# 617056; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3947 | ALG12 | Zornitza Stark Publications for gene: ALG12 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3946 | ALG12 | Zornitza Stark Mode of inheritance for gene: ALG12 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3945 | ALG12 | Zornitza Stark reviewed gene: ALG12: Rating: GREEN; Mode of pathogenicity: None; Publications: 31481313; Phenotypes: Congenital disorder of glycosylation, type Ig, MIM# 607143; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v0.160 | ALG12 | Zornitza Stark Marked gene: ALG12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v0.160 | ALG12 | Zornitza Stark Gene: alg12 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v0.160 | ALG12 | Zornitza Stark Phenotypes for gene: ALG12 were changed from to Congenital disorder of glycosylation, type Ig 607143 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v0.159 | ALG12 | Zornitza Stark Publications for gene: ALG12 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v0.158 | ALG12 | Zornitza Stark Mode of inheritance for gene: ALG12 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2878 | ALG11 | Zornitza Stark Marked gene: ALG11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2878 | ALG11 | Zornitza Stark Gene: alg11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2878 | ALG11 | Zornitza Stark Phenotypes for gene: ALG11 were changed from to Congenital disorder of glycosylation, type Ip, MIM# 613661 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2877 | ALG11 | Zornitza Stark Publications for gene: ALG11 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Macrocystic Disease v0.37 | ALG9 |
Zornitza Stark changed review comment from: Two individuals with mono-allelic variants reported with polycystic kidney disease, and ALG9 LOF variants over-represented in a population-based cohort. However, penetrance and expressivity seem variable, and also it is unclear whether parents of children affected by the AR CDG have renal cysts. Bi-allelic variants cause CDG: kidney cysts reported as part of phenotype but note this is generally a severe multi-system disorder. Sources: Literature; to: Two individuals with mono-allelic variants reported with polycystic kidney disease, and ALG9 LOF variants over-represented in a population-based cohort. However, penetrance and expressivity seem variable, and also it is unclear whether parents of children affected by the AR CDG have renal cysts. Bi-allelic variants cause CDG: kidney cysts reported as part of phenotype but note this is generally a severe multi-system disorder. It is unclear at present whether the mechanism is the same for both. It may be that bi-allelic LOF is perinatal lethal, hence CDG carriers for missense variants are less likely to manifest renal cysts. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2876 | ALG11 | Zornitza Stark Mode of inheritance for gene: ALG11 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2875 | ALG11 | Zornitza Stark reviewed gene: ALG11: Rating: GREEN; Mode of pathogenicity: None; Publications: 30676690; Phenotypes: Congenital disorder of glycosylation, type Ip, MIM# 613661; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.804 | ALG11 | Zornitza Stark Marked gene: ALG11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.804 | ALG11 | Zornitza Stark Gene: alg11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.804 | ALG11 | Zornitza Stark Phenotypes for gene: ALG11 were changed from to Congenital disorder of glycosylation, type Ip, MIM# 613661 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.803 | ALG11 | Zornitza Stark Publications for gene: ALG11 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.802 | ALG11 | Zornitza Stark Mode of inheritance for gene: ALG11 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.801 | ALG11 | Zornitza Stark reviewed gene: ALG11: Rating: GREEN; Mode of pathogenicity: None; Publications: 30676690; Phenotypes: Congenital disorder of glycosylation, type Ip, MIM# 613661; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3945 | ALG11 | Zornitza Stark Marked gene: ALG11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3945 | ALG11 | Zornitza Stark Gene: alg11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3945 | ALG11 | Zornitza Stark Phenotypes for gene: ALG11 were changed from to Congenital disorder of glycosylation, type Ip, MIM# 613661 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Renal Macrocystic Disease v0.37 | ALG9 | Zornitza Stark edited their review of gene: ALG9: Added comment: Additional individual reported in PMID 30676690 as part of a large cohort.; Changed publications: 31395617, 32398770; Changed phenotypes: Congenital disorder of glycosylation, type Il, MIM# 608776, Gillessen-Kaesbach-Nishimura syndrome, MIM#263210, Polycystic kidney disease | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3944 | ALG11 | Zornitza Stark Publications for gene: ALG11 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3943 | ALG11 | Zornitza Stark Mode of inheritance for gene: ALG11 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3942 | ALG11 | Zornitza Stark reviewed gene: ALG11: Rating: GREEN; Mode of pathogenicity: None; Publications: 30676690; Phenotypes: Congenital disorder of glycosylation, type Ip, MIM# 613661; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v0.157 | ALG11 | Zornitza Stark Marked gene: ALG11 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v0.157 | ALG11 | Zornitza Stark Gene: alg11 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v0.157 | ALG11 | Zornitza Stark Phenotypes for gene: ALG11 were changed from to Congenital disorder of glycosylation, type Ip, MIM# 613661 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v0.156 | ALG11 | Zornitza Stark Publications for gene: ALG11 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v0.155 | ALG11 | Zornitza Stark Mode of inheritance for gene: ALG11 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v0.154 | ALG1 | Zornitza Stark Marked gene: ALG1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v0.154 | ALG1 | Zornitza Stark Gene: alg1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v0.154 | ALG1 | Zornitza Stark Phenotypes for gene: ALG1 were changed from to Congenital disorder of glycosylation, type Ik 608540 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v0.153 | ALG1 | Zornitza Stark Publications for gene: ALG1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v0.152 | ALG1 | Zornitza Stark Mode of inheritance for gene: ALG1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.70 | KATNB1 | Zornitza Stark Marked gene: KATNB1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.70 | KATNB1 | Zornitza Stark Gene: katnb1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.70 | TUBGCP2 | Zornitza Stark Marked gene: TUBGCP2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.70 | TUBGCP2 | Zornitza Stark Gene: tubgcp2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.137 | L1CAM | Zornitza Stark Marked gene: L1CAM as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.137 | L1CAM | Zornitza Stark Gene: l1cam has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.137 | L1CAM | Zornitza Stark Phenotypes for gene: L1CAM were changed from to L1CAM-related disease | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.136 | L1CAM | Zornitza Stark Publications for gene: L1CAM were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.135 | L1CAM | Zornitza Stark Mode of inheritance for gene: L1CAM was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.134 | L1CAM | Zornitza Stark Classified gene: L1CAM as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.134 | L1CAM | Zornitza Stark Gene: l1cam has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.133 | RAB3GAP2 | Zornitza Stark Marked gene: RAB3GAP2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.133 | RAB3GAP2 | Zornitza Stark Gene: rab3gap2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.133 | RAB3GAP2 | Zornitza Stark Phenotypes for gene: RAB3GAP2 were changed from to Warburg micro syndrome 2 614225 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.132 | RAB3GAP2 | Zornitza Stark Publications for gene: RAB3GAP2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.131 | RAB3GAP2 | Zornitza Stark Mode of inheritance for gene: RAB3GAP2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.130 | TUBA8 | Zornitza Stark Marked gene: TUBA8 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.130 | TUBA8 | Zornitza Stark Gene: tuba8 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.130 | PEX16 | Zornitza Stark Marked gene: PEX16 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.130 | PEX16 | Zornitza Stark Gene: pex16 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.130 | PEX16 | Zornitza Stark Classified gene: PEX16 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.130 | PEX16 | Zornitza Stark Gene: pex16 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.129 | PEX14 | Zornitza Stark Marked gene: PEX14 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.129 | PEX14 | Zornitza Stark Gene: pex14 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.129 | PEX14 | Zornitza Stark Classified gene: PEX14 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.129 | PEX14 | Zornitza Stark Gene: pex14 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.128 | PEX13 | Zornitza Stark Marked gene: PEX13 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.128 | PEX13 | Zornitza Stark Gene: pex13 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.128 | PEX13 | Zornitza Stark Classified gene: PEX13 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.128 | PEX13 | Zornitza Stark Gene: pex13 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.127 | PEX12 | Zornitza Stark Marked gene: PEX12 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.127 | PEX12 | Zornitza Stark Gene: pex12 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.127 | PEX12 | Zornitza Stark Classified gene: PEX12 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.127 | PEX12 | Zornitza Stark Gene: pex12 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v0.151 | ALG14 | Sarah Donoghue reviewed gene: ALG14: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 30221345, PMID: 28733338, PMID: 23404334; Phenotypes: Intellectual disability, epilepsy, dysmorphic features, myasthenia, hypotonia, cerebral atrophy, contractures, congenital myasthenia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.126 | PEX19 | Zornitza Stark Marked gene: PEX19 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.126 | PEX19 | Zornitza Stark Gene: pex19 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.126 | PEX19 | Zornitza Stark Classified gene: PEX19 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.126 | PEX19 | Zornitza Stark Gene: pex19 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v0.151 | ALG12 | Sarah Donoghue edited their review of gene: ALG12: Added comment: Usually type I CDG pattern; Changed phenotypes: Dysmorphic features, Psychomotor delay, Seizures, Ocular abnormalities, Sensorineural hearing loss, Hypotonia, Failure to thrive/short stature, Cardiac Abnormalities, Genitourinary abnormalities, Recurrent infections, Hypogammaglobulinaemia, Coagulation abnormalities, Abnormal liver enzymes, Lipid abnormalities, Abnormal transferrin IEF, Abnormal brain imaging, Microcephaly, Skeletal malformations | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v0.151 | ALG12 | Sarah Donoghue reviewed gene: ALG12: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 31481313; Phenotypes: Dysmorphic features, Psychomotor delay, Seizures, Ocular abnormalities, Sensorineural hearing loss, Hypotonia, Failure to thrive/short stature, Cardiac Abnormalities, Genitourinary abnormalities, Recurrent infections, Hypogammaglobulinaemia, Coagulation abnormalities, Abnormal liver enzymes; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v0.151 | ALG11 | Sarah Donoghue reviewed gene: ALG11: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 30676690; Phenotypes: Developmental disability, Epilepsy, Dysmorphic features, Microcephaly, Hypotonia, Hypertonia, Hyperreflexia, Sensorineural deafness, Eye/Visual Problems, Feeding problems; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Disorders of Glycosylation v0.151 | ALG1 | Sarah Donoghue reviewed gene: ALG1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 26931382; Phenotypes: Developmental delay, Intellectual disability, Hypotonia, Seizure/Epilepsy, Visual Involvement, Microcephaly, Abnormal Brain Imaging, Facial Dysmorphism, Haematological, Gastrointestinal, Skeletal Abnormalities, Hypoalbuminaemia, Recurrent infections, Liver dysfunction, Cardiac Abnormalities, Renal Abnormalities; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3942 | NPRL2 | Zornitza Stark Marked gene: NPRL2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3942 | NPRL2 | Zornitza Stark Gene: nprl2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3942 | NPRL2 | Zornitza Stark Phenotypes for gene: NPRL2 were changed from to Epilepsy, familial focal, with variable foci 2, MIM# 617116; focal seizures; frontal lobe epilepsy; nocturnal frontal lobe epilepsy; temporal lobe epilepsy; focal cortical dysplasia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3941 | NPRL2 | Zornitza Stark Publications for gene: NPRL2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3940 | NPRL2 | Zornitza Stark Mode of inheritance for gene: NPRL2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.125 | PEX13 |
Ain Roesley gene: PEX13 was added gene: PEX13 was added to Polymicrogyria and Schizencephaly. Sources: Literature Mode of inheritance for gene: PEX13 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PEX13 were set to 21031596; 19449432 Phenotypes for gene: PEX13 were set to Peroxisome biogenesis disorder 11A (Zellweger) (MIM#614883) Penetrance for gene: PEX13 were set to unknown Review for gene: PEX13 was set to AMBER Added comment: Accounts for ~1.5% of Zellweger Spectrum Disorder (ZSD) (GeneReviews), for which Polymicrogyria is a feature PMID: 19449432; - 1x ZSD proband with PMG Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.125 | PEX14 |
Paul De Fazio gene: PEX14 was added gene: PEX14 was added to Polymicrogyria and Schizencephaly. Sources: Literature Mode of inheritance for gene: PEX14 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PEX14 were set to 21031596; 18285423; 15146459; 30224891 Phenotypes for gene: PEX14 were set to Peroxisome biogenesis disorder 8A (Zellweger) MIM#614876 Review for gene: PEX14 was set to AMBER gene: PEX14 was marked as current diagnostic Added comment: Accounts for ~0.5% of Zellweger Spectrum Disorder (GeneReviews https://www.ncbi.nlm.nih.gov/books/NBK1448/). At least 3 independent patients have been reported with a homozygous nonsense variant, a rare missense variant, and a whole-exon deletion (PMID: 18285423, 15146459, 30224891) so gene-disease association is established. Reports of patients with polymicrogyria specifically were not identified, but as Zellweger has the potential to present with polymicrogyria this gene has been rated Amber. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.125 | PEX12 |
Ain Roesley gene: PEX12 was added gene: PEX12 was added to Polymicrogyria and Schizencephaly. Sources: Literature Mode of inheritance for gene: PEX12 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PEX12 were set to 21031596 Phenotypes for gene: PEX12 were set to Peroxisome biogenesis disorder 3A (Zellweger) (MIM#614859) Penetrance for gene: PEX12 were set to unknown Review for gene: PEX12 was set to AMBER Added comment: Accounts for ~7.6% of Zellweger Spectrum Disorder (ZSD) (GeneReviews), for which Polymicrogyria is a feature Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.125 | PEX11B | Zornitza Stark Marked gene: PEX11B as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.125 | PEX11B | Zornitza Stark Added comment: Comment when marking as ready: Aware of another family tested through our service, but agree gene-disease association limited, and no specific reports of PMG. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.125 | PEX11B | Zornitza Stark Gene: pex11b has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.125 | PEX16 |
Paul De Fazio gene: PEX16 was added gene: PEX16 was added to Polymicrogyria and Schizencephaly. Sources: Literature Mode of inheritance for gene: PEX16 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PEX16 were set to 21031596 Phenotypes for gene: PEX16 were set to Peroxisome biogenesis disorder 8A (Zellweger) MIM#614876 Review for gene: PEX16 was set to AMBER gene: PEX16 was marked as current diagnostic Added comment: Accounts for ~1.1% of Zellweger Spectrum Disorder (GeneReviews https://www.ncbi.nlm.nih.gov/books/NBK1448/). Reports of patients with polymicrogyria specifically were not identified, but as Zellweger has the potential to present with polymicrogyria this gene has been rated Amber. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.125 | PEX11B | Zornitza Stark Classified gene: PEX11B as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.125 | PEX11B | Zornitza Stark Gene: pex11b has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.124 | PEX10 | Zornitza Stark Marked gene: PEX10 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.124 | PEX10 | Zornitza Stark Gene: pex10 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.124 | PEX10 | Zornitza Stark Classified gene: PEX10 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.124 | PEX10 | Zornitza Stark Gene: pex10 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.123 | PEX2 | Zornitza Stark Marked gene: PEX2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.123 | PEX2 | Zornitza Stark Gene: pex2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.123 | PEX2 | Zornitza Stark Classified gene: PEX2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.123 | PEX2 | Zornitza Stark Gene: pex2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.122 | PEX26 | Zornitza Stark Marked gene: PEX26 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.122 | PEX26 | Zornitza Stark Gene: pex26 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.122 | PEX26 | Zornitza Stark Classified gene: PEX26 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.122 | PEX26 | Zornitza Stark Gene: pex26 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.121 | PEX19 |
Paul De Fazio gene: PEX19 was added gene: PEX19 was added to Polymicrogyria and Schizencephaly. Sources: Literature Mode of inheritance for gene: PEX19 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PEX19 were set to 21031596 Phenotypes for gene: PEX19 were set to Peroxisome biogenesis disorder 12A (Zellweger) MIM#614886 Review for gene: PEX19 was set to AMBER gene: PEX19 was marked as current diagnostic Added comment: Accounts for ~0.6% of Zellweger Spectrum Disorder (GeneReviews https://www.ncbi.nlm.nih.gov/books/NBK1448/). Reports of patients with polymicrogyria specifically were not identified, but as Zellweger has the potential to present with polymicrogyria this gene has been rated Amber. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.121 | PEX3 | Zornitza Stark Marked gene: PEX3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.121 | PEX3 | Zornitza Stark Gene: pex3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.121 | PEX3 | Zornitza Stark Classified gene: PEX3 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.121 | PEX3 | Zornitza Stark Gene: pex3 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.120 | PEX11B |
Ain Roesley gene: PEX11B was added gene: PEX11B was added to Polymicrogyria and Schizencephaly. Sources: Literature Mode of inheritance for gene: PEX11B was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PEX11B were set to 22581968 Phenotypes for gene: PEX11B were set to ?Peroxisome biogenesis disorder 14B (MIM#614920) Penetrance for gene: PEX11B were set to unknown Review for gene: PEX11B was set to RED Added comment: Accounts for ~0.1% of Zellweger Spectrum Disorder (ZSD) (GeneReviews), for which Polymicrogyria is a feature PMID: 22581968; Sinlge patient reported Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.120 | PEX10 |
Ain Roesley gene: PEX10 was added gene: PEX10 was added to Polymicrogyria and Schizencephaly. Sources: Literature Mode of inheritance for gene: PEX10 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PEX10 were set to 21031596 Phenotypes for gene: PEX10 were set to Peroxisome biogenesis disorder 6A (Zellweger) (MIM#614870) Penetrance for gene: PEX10 were set to unknown Review for gene: PEX10 was set to AMBER Added comment: Accounts for ~3.4% of Zellweger Spectrum Disorder (ZSD) (GeneReviews), for which Polymicrogyria is a feature Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.120 | PEX2 |
Paul De Fazio gene: PEX2 was added gene: PEX2 was added to Polymicrogyria and Schizencephaly. Sources: Literature Mode of inheritance for gene: PEX2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PEX2 were set to 21031596 Phenotypes for gene: PEX2 were set to Peroxisome biogenesis disorder 5A (Zellweger) MIM#614866 Review for gene: PEX2 was set to AMBER gene: PEX2 was marked as current diagnostic Added comment: Accounts for ~3.1% of Zellweger Spectrum Disorder (GeneReviews https://www.ncbi.nlm.nih.gov/books/NBK1448/). Reports of patients with polymicrogyria specifically were not identified, but as Zellweger has the potential to present with polymicrogyria this gene has been rated Amber. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.120 | PEX26 |
Paul De Fazio gene: PEX26 was added gene: PEX26 was added to Polymicrogyria and Schizencephaly. Sources: Literature Mode of inheritance for gene: PEX26 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PEX26 were set to 21031596 Phenotypes for gene: PEX26 were set to Peroxisome biogenesis disorder 7A (Zellweger) MIM#614872 Review for gene: PEX26 was set to AMBER gene: PEX26 was marked as current diagnostic Added comment: Accounts for ~4.2% of Zellweger Spectrum Disorder (GeneReviews https://www.ncbi.nlm.nih.gov/books/NBK1448/). Reports of patients with polymicrogyria specifically were not identified, but as Zellweger has the potential to present with polymicrogyria this gene has been rated Amber. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.120 | PEX3 | Paul De Fazio edited their review of gene: PEX3: Changed rating: AMBER; Changed phenotypes: Peroxisome biogenesis disorder 10A (Zellweger) 614882 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.120 | PEX3 |
Paul De Fazio gene: PEX3 was added gene: PEX3 was added to Polymicrogyria and Schizencephaly. Sources: Literature Mode of inheritance for gene: PEX3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PEX3 were set to 21031596 Phenotypes for gene: PEX3 were set to Peroxisome biogenesis disorder 10A (Zellweger) 614882 gene: PEX3 was marked as current diagnostic Added comment: Accounts for ~0.7% of Zellweger Spectrum Disorder (GeneReviews https://www.ncbi.nlm.nih.gov/books/NBK1448/). Reports of patients with polymicrogyria specifically were not identified, but as Zellweger has the potential to present with polymicrogyria this gene has been rated Amber. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.120 | PEX1 | Zornitza Stark Marked gene: PEX1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.120 | PEX1 | Zornitza Stark Gene: pex1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.120 | PEX1 | Zornitza Stark Classified gene: PEX1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.120 | PEX1 | Zornitza Stark Gene: pex1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.119 | PEX5 | Zornitza Stark Marked gene: PEX5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.119 | PEX5 | Zornitza Stark Gene: pex5 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.119 | PEX5 | Zornitza Stark Classified gene: PEX5 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.119 | PEX5 | Zornitza Stark Gene: pex5 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.118 | PEX1 |
Ain Roesley gene: PEX1 was added gene: PEX1 was added to Polymicrogyria and Schizencephaly. Sources: Literature Mode of inheritance for gene: PEX1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PEX1 were set to 21031596 Phenotypes for gene: PEX1 were set to Peroxisome biogenesis disorder 1A (Zellweger) (MIM#214100) Penetrance for gene: PEX1 were set to unknown Review for gene: PEX1 was set to GREEN Added comment: Accounts for ~60.5% of Zellweger Spectrum Disorder (ZSD) (GeneReviews), for which Polymicrogyria is a feature Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.118 | PEX5 |
Paul De Fazio gene: PEX5 was added gene: PEX5 was added to Polymicrogyria and Schizencephaly. Sources: Literature Mode of inheritance for gene: PEX5 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PEX5 were set to 21031596 Phenotypes for gene: PEX5 were set to Peroxisome biogenesis disorder 2A (Zellweger) (MIM#214110) Review for gene: PEX5 was set to AMBER gene: PEX5 was marked as current diagnostic Added comment: Accounts for ~2% of Zellweger Spectrum Disorder (GeneReviews https://www.ncbi.nlm.nih.gov/books/NBK1448/). Reports of patients with polymicrogyria specifically were not identified, but as Zellweger has the potential to present with polymicrogyria this gene has been rated Amber. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.23 | STRADA | Seb Lunke Marked gene: STRADA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.23 | STRADA | Seb Lunke Gene: strada has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.23 | STRADA | Seb Lunke Publications for gene: STRADA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.22 | STRADA | Seb Lunke Mode of inheritance for gene: STRADA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.21 | STRADA | Seb Lunke Classified gene: STRADA as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.21 | STRADA | Seb Lunke Added comment: Comment on list classification: megalencephaly link well established, but no conclusive evidence of hemi-megalencephaly | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.21 | STRADA | Seb Lunke Gene: strada has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.118 | SHH | Zornitza Stark Marked gene: SHH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.118 | SHH | Zornitza Stark Gene: shh has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.118 | SHH | Zornitza Stark Tag disputed tag was added to gene: SHH. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.20 | NPRL3 | Zornitza Stark Marked gene: NPRL3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.20 | NPRL3 | Zornitza Stark Gene: nprl3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.20 | NPRL3 | Zornitza Stark Phenotypes for gene: NPRL3 were changed from to Epilepsy, familial focal, with variable foci 3 (MIM#617118) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.19 | NPRL3 | Zornitza Stark Publications for gene: NPRL3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.118 | SHH | Zornitza Stark Phenotypes for gene: SHH were changed from to Schizencephaly (MIM#269160) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.18 | NPRL3 | Zornitza Stark Mode of inheritance for gene: NPRL3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.17 | STRADA | Paul De Fazio edited their review of gene: STRADA: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.17 | STRADA |
Paul De Fazio changed review comment from: Associated with PMSE (Polyhydramnios, megalencephaly, and symptomatic epilepsy). Link to TSC seems tenuous and is limited to the authors of PMID: 17522105 citing similarities to TSC in histological findings in an individual with biallelic STRADA deletions, and the fact that this gene is implicated in the mTORC pathway. This gene is an upstream inhibitor of mTORC1. Treatment with rapamycin reduces seizures in a mouse model (PMID: 23616120).; to: Associated with PMSE (Polyhydramnios, megalencephaly, and symptomatic epilepsy). Link to TSC seems tenuous and is limited to the authors of PMID: 17522105 citing similarities to TSC in histological findings in an individual with biallelic STRADA deletions, and the fact that this gene is implicated in the mTORC pathway. However megalencephaly is a common characteristic in almost all patients (summarised in PMID: 27170158). Reported patients include 7 distantly-related Mennonite children with the same 7kb deletion, plus two other separate unrelated individuals. This gene is an upstream inhibitor of mTORC1. Treatment with rapamycin reduces seizures in a mouse model (PMID: 23616120). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.117 | PEX6 | Seb Lunke Marked gene: PEX6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.117 | PEX6 | Seb Lunke Gene: pex6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.117 | PEX6 | Seb Lunke Classified gene: PEX6 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.117 | PEX6 | Seb Lunke Gene: pex6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.116 | SHH | Zornitza Stark Publications for gene: SHH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.115 | SHH | Zornitza Stark Mode of inheritance for gene: SHH was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.114 | SIX3 | Seb Lunke Marked gene: SIX3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.114 | SIX3 | Seb Lunke Gene: six3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.114 | SIX3 | Seb Lunke Mode of inheritance for gene: SIX3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.113 | SIX3 | Seb Lunke Publications for gene: SIX3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.113 | SHH | Zornitza Stark Classified gene: SHH as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.113 | SHH | Zornitza Stark Gene: shh has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.112 | SHH | Zornitza Stark Classified gene: SHH as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.112 | SHH | Zornitza Stark Gene: shh has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.112 | SIX3 | Seb Lunke Classified gene: SIX3 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.112 | SIX3 | Seb Lunke Added comment: Comment on list classification: Missense variants too common in gnomAD. Left with one novel nonsense, insufficient evidence for association with schizencephaly at this stage. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.112 | SIX3 | Seb Lunke Gene: six3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3939 | NPRL2 | Dean Phelan reviewed gene: NPRL2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 26505888, 27173016, 28199897, 31594065; Phenotypes: focal seizures, frontal lobe epilepsy, nocturnal frontal lobe epilepsy, temporal lobe epilepsy, focal cortical dysplasia; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.801 | NPRL2 | Zornitza Stark Marked gene: NPRL2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.801 | NPRL2 | Zornitza Stark Gene: nprl2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.801 | NPRL2 | Zornitza Stark Phenotypes for gene: NPRL2 were changed from to Epilepsy, familial focal, with variable foci 2 617116; focal seizures; frontal lobe epilepsy; nocturnal frontal lobe epilepsy; temporal lobe epilepsy; focal cortical dysplasia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.800 | NPRL2 | Zornitza Stark Publications for gene: NPRL2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.799 | NPRL2 | Zornitza Stark Mode of inheritance for gene: NPRL2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.17 | NPRL2 | Zornitza Stark Marked gene: NPRL2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.17 | NPRL2 | Zornitza Stark Gene: nprl2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.17 | NPRL2 | Zornitza Stark Phenotypes for gene: NPRL2 were changed from to Focal epilepsy; Focal cortical dysplasia | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.16 | NPRL2 | Zornitza Stark Publications for gene: NPRL2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.15 | NPRL2 | Zornitza Stark Mode of inheritance for gene: NPRL2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.14 | NPRL2 | Zornitza Stark Classified gene: NPRL2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.14 | NPRL2 | Zornitza Stark Gene: nprl2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.111 | SNAP29 | Seb Lunke Marked gene: SNAP29 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.111 | SNAP29 | Seb Lunke Gene: snap29 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.111 | SNAP29 | Seb Lunke Classified gene: SNAP29 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.111 | SNAP29 | Seb Lunke Gene: snap29 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.70 | SNAP29 | Zornitza Stark Marked gene: SNAP29 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.70 | SNAP29 | Zornitza Stark Gene: snap29 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.70 | SNAP29 | Zornitza Stark Phenotypes for gene: SNAP29 were changed from to Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome (MIM#609528) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.110 | SRD5A3 | Seb Lunke Marked gene: SRD5A3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.110 | SRD5A3 | Seb Lunke Gene: srd5a3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.69 | SNAP29 | Zornitza Stark Publications for gene: SNAP29 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.68 | SNAP29 | Zornitza Stark Mode of inheritance for gene: SNAP29 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.110 | SRD5A3 | Seb Lunke Classified gene: SRD5A3 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.110 | SRD5A3 | Seb Lunke Gene: srd5a3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.13 | DEPDC5 | Zornitza Stark Marked gene: DEPDC5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.13 | DEPDC5 | Zornitza Stark Gene: depdc5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.13 | DEPDC5 | Zornitza Stark Phenotypes for gene: DEPDC5 were changed from to Epilepsy, familial focal, with variable foci 1 (MIM#604364) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.12 | DEPDC5 | Zornitza Stark Publications for gene: DEPDC5 were set to 31444548 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.12 | DEPDC5 | Zornitza Stark Publications for gene: DEPDC5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.67 | SRD5A3 | Zornitza Stark Marked gene: SRD5A3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.67 | SRD5A3 | Zornitza Stark Gene: srd5a3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.11 | DEPDC5 | Zornitza Stark Mode of inheritance for gene: DEPDC5 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.67 | SRD5A3 | Zornitza Stark Phenotypes for gene: SRD5A3 were changed from to Congenital disorder of glycosylation, type Iq (MIM#612379) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.66 | SRD5A3 | Zornitza Stark Publications for gene: SRD5A3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.65 | DCHS1 | Seb Lunke Marked gene: DCHS1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.65 | DCHS1 | Seb Lunke Gene: dchs1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.65 | DCHS1 | Seb Lunke Classified gene: DCHS1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.65 | DCHS1 | Seb Lunke Gene: dchs1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.65 | SRD5A3 | Zornitza Stark Mode of inheritance for gene: SRD5A3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.64 | SRD5A3 | Zornitza Stark Classified gene: SRD5A3 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.64 | SRD5A3 | Zornitza Stark Gene: srd5a3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.63 | NSDHL | Zornitza Stark Marked gene: NSDHL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.63 | NSDHL | Zornitza Stark Gene: nsdhl has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.63 | NSDHL | Zornitza Stark Classified gene: NSDHL as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.63 | NSDHL | Zornitza Stark Gene: nsdhl has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.109 | NSDHL | Zornitza Stark Marked gene: NSDHL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.109 | NSDHL | Zornitza Stark Gene: nsdhl has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.109 | NSDHL | Zornitza Stark Phenotypes for gene: NSDHL were changed from to CK syndrome 300831 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.108 | NSDHL | Zornitza Stark Publications for gene: NSDHL were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.107 | DAG1 | Seb Lunke Marked gene: DAG1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.107 | DAG1 | Seb Lunke Gene: dag1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.107 | NSDHL | Zornitza Stark Mode of inheritance for gene: NSDHL was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.107 | DAG1 | Seb Lunke Classified gene: DAG1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.107 | DAG1 | Seb Lunke Gene: dag1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.106 | NSDHL | Zornitza Stark Classified gene: NSDHL as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.106 | NSDHL | Zornitza Stark Gene: nsdhl has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.106 | DAG1 | Seb Lunke Classified gene: DAG1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.106 | DAG1 | Seb Lunke Gene: dag1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.105 | TMEM216 | Zornitza Stark Marked gene: TMEM216 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.105 | TMEM216 | Zornitza Stark Gene: tmem216 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.105 | TMEM216 | Zornitza Stark Phenotypes for gene: TMEM216 were changed from Joubert syndrome 2 (MIM#608091) to Joubert syndrome 2 (MIM#608091) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.104 | TMEM216 | Zornitza Stark Publications for gene: TMEM216 were set to 20512146 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.103 | TMEM216 | Zornitza Stark Mode of inheritance for gene: TMEM216 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.102 | TMEM216 | Zornitza Stark Classified gene: TMEM216 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.102 | TMEM216 | Zornitza Stark Gene: tmem216 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.101 | TMEM216 | Zornitza Stark Marked gene: TMEM216 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.101 | TMEM216 | Zornitza Stark Gene: tmem216 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.101 | TMEM216 | Zornitza Stark Phenotypes for gene: TMEM216 were changed from to Joubert syndrome 2 (MIM#608091) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.100 | TMEM216 | Zornitza Stark Publications for gene: TMEM216 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.99 | TMEM216 | Zornitza Stark Mode of inheritance for gene: TMEM216 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.98 | PEX6 |
Paul De Fazio gene: PEX6 was added gene: PEX6 was added to Polymicrogyria and Schizencephaly. Sources: Literature Mode of inheritance for gene: PEX6 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PEX6 were set to 21031596; 9877282; 26700162 Phenotypes for gene: PEX6 were set to Peroxisome biogenesis disorder 4A (Zellweger) (MIM#614862) Review for gene: PEX6 was set to GREEN gene: PEX6 was marked as current diagnostic Added comment: Variants in this gene account for 14.5% of Zellweger Spectrum Disorder patients according to GeneReviews (https://www.ncbi.nlm.nih.gov/books/NBK1448/). Genetic spectrum of 77 patients reviewed in PMID: 19877282. PMID: 26700162, 22894767, and 28452594 describe three patients with polymicrogyria. Did not look further for others but they possibly exist. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.98 | TMEM216 | Zornitza Stark Classified gene: TMEM216 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.98 | TMEM216 | Zornitza Stark Gene: tmem216 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.62 | OSGEP | Zornitza Stark Marked gene: OSGEP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.62 | OSGEP | Zornitza Stark Gene: osgep has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.62 | OSGEP | Zornitza Stark Classified gene: OSGEP as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.62 | OSGEP | Zornitza Stark Gene: osgep has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cobblestone Malformations v0.9 | DAG1 | Zornitza Stark Marked gene: DAG1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cobblestone Malformations v0.9 | DAG1 | Zornitza Stark Gene: dag1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cobblestone Malformations v0.9 | DAG1 | Zornitza Stark Classified gene: DAG1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cobblestone Malformations v0.9 | DAG1 | Zornitza Stark Gene: dag1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.61 | CSNK2A1 | Zornitza Stark Marked gene: CSNK2A1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.61 | CSNK2A1 | Zornitza Stark Gene: csnk2a1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.61 | CSNK2A1 | Zornitza Stark Classified gene: CSNK2A1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.61 | CSNK2A1 | Zornitza Stark Gene: csnk2a1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.10 | NPRL3 | Ain Roesley reviewed gene: NPRL3: Rating: GREEN; Mode of pathogenicity: None; Publications: 27173016, 26285051; Phenotypes: Epilepsy, familial focal, with variable foci 3 (MIM#617118); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.97 | SHH | Paul De Fazio reviewed gene: SHH: Rating: RED; Mode of pathogenicity: None; Publications: 19533790; Phenotypes: Schizencephaly (MIM#269160); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.10 | NPRL2 | Ain Roesley Deleted their review | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.10 | NPRL2 | Ain Roesley reviewed gene: NPRL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30093711, 27173016; Phenotypes: Epilepsy, familial focal, with variable foci 2 (MIM#617116); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.97 | SIX3 | Paul De Fazio reviewed gene: SIX3: Rating: AMBER; Mode of pathogenicity: None; Publications: 20157829; Phenotypes: Schizencephaly (MIM#269160); Mode of inheritance: None; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.798 | NPRL2 | Dean Phelan reviewed gene: NPRL2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 26505888, 27173016, 28199897, 31594065; Phenotypes: focal seizures, frontal lobe epilepsy, nocturnal frontal lobe epilepsy, temporal lobe epilepsy, focal cortical dysplasia; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.10 | NPRL2 | Dean Phelan reviewed gene: NPRL2: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 29281825, 27173016, 31625153; Phenotypes: Focal epilepsy, Focal cortical dysplasia; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.97 | SNAP29 |
Paul De Fazio gene: SNAP29 was added gene: SNAP29 was added to Polymicrogyria and Schizencephaly. Sources: Literature Mode of inheritance for gene: SNAP29 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SNAP29 were set to 29051910; 21073448; 30793783 Phenotypes for gene: SNAP29 were set to Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome (MIM#609528) Review for gene: SNAP29 was set to GREEN gene: SNAP29 was marked as current diagnostic Added comment: Associated with CEDNIK syndrome. Both pachygyria and polymicrogyria, and additionally dysgenesis of the corpus callosum, are reported in multiple patients from unrelated families with pathogenic variants in this gene (at least 5 patients from 3 families with both pachygyria and polymicrogyria, and at least 5 patients from 3 families with polymicrogyria alone (PMID: 29051910, 30793783)). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.60 | SNAP29 | Paul De Fazio changed review comment from: Associated with CEDNIK syndrome. Both pachygyria and polymicrogyria, and additionally dysgenesis of the corpus callosum, are reported in multiple patients from unrelated families with pathogenic variants in this gene (4 patients from 2 families with both pachygyria and polymicrogyria, and 5 patients from 3 families with polymicrogyria, in 12 patients from 5 families reviewed in PMID: 29051910).; to: Associated with CEDNIK syndrome. Both pachygyria and polymicrogyria, and additionally dysgenesis of the corpus callosum, are reported in multiple patients from unrelated families with pathogenic variants in this gene (at least 5 patients from 3 families with both pachygyria and polymicrogyria, and at least 5 patients from 3 families with polymicrogyria alone (PMID: 29051910, 30793783)). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.60 | SNAP29 | Paul De Fazio changed review comment from: Associated with CEDNIK syndrome. Both pachygyria and polymicrogyria, and additionally dysgenesis of the corpus callosum, are reported in multiple patients from 5 families with pathogenic variants in this gene (4 patients with pachygyria and 9 patients with polymicrogyria, in 12 patients from 5 families reviewed in PMID: 29051910).; to: Associated with CEDNIK syndrome. Both pachygyria and polymicrogyria, and additionally dysgenesis of the corpus callosum, are reported in multiple patients from unrelated families with pathogenic variants in this gene (4 patients from 2 families with both pachygyria and polymicrogyria, and 5 patients from 3 families with polymicrogyria, in 12 patients from 5 families reviewed in PMID: 29051910). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.60 | SNAP29 | Paul De Fazio changed review comment from: Associated with CEDNIK syndrome. Both pachygyria and polymicrogyria, and additionally dysgenesis of the corpus callosum, are reported in multiple unrelated patients with pathogenic variants in this gene (4 patients with pachygyria and 9 patients with polymicrogyria, in 12 patients reviewed in PMID: 29051910).; to: Associated with CEDNIK syndrome. Both pachygyria and polymicrogyria, and additionally dysgenesis of the corpus callosum, are reported in multiple patients from 5 families with pathogenic variants in this gene (4 patients with pachygyria and 9 patients with polymicrogyria, in 12 patients from 5 families reviewed in PMID: 29051910). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.60 | SNAP29 | Paul De Fazio reviewed gene: SNAP29: Rating: GREEN; Mode of pathogenicity: None; Publications: 29051910, 21073448, 30793783; Phenotypes: Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome (MIM#609528); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.97 | SRD5A3 |
Paul De Fazio gene: SRD5A3 was added gene: SRD5A3 was added to Polymicrogyria and Schizencephaly. Sources: Literature Mode of inheritance for gene: SRD5A3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: SRD5A3 were set to 18271001; 20637498; 31638560; 27480077 Phenotypes for gene: SRD5A3 were set to Congenital disorder of glycosylation, type Iq (MIM#612379) Review for gene: SRD5A3 was set to RED gene: SRD5A3 was marked as current diagnostic Added comment: Associated with a CDG. Brain abnormalities reported include vermis hypoplasia, hypoplastic corpus callosum, cerebral atrophy. Polymicrogyria has been reported in 2 individuals from the same family in PMID: 18271001, but given that it is only this one family I have rated it red. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.60 | SRD5A3 |
Paul De Fazio changed review comment from: Associated with a CDG. Brain abnormalities reported include vermis hypoplasia, hypoplastic corpus callosum, cerebral atrophy. Polymicrogyria has been reported (2 individuals from the same family in PMID: 18271001), but lissencephaly or band heterotopia are not reported.; to: Associated with a CDG. Brain abnormalities reported include vermis hypoplasia, hypoplastic corpus callosum, cerebral atrophy. Polymicrogyria has been reported (2 individuals from the same family in PMID: 18271001), but lissencephaly or band heterotopia are not reported. Not sure this gene should be on this panel. Have added to polymicrogyria panel instead. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.10 | DEPDC5 | Ain Roesley reviewed gene: DEPDC5: Rating: GREEN; Mode of pathogenicity: None; Publications: 31444548; Phenotypes: Epilepsy, familial focal, with variable foci 1 (MIM#604364); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.60 | SRD5A3 | Paul De Fazio reviewed gene: SRD5A3: Rating: RED; Mode of pathogenicity: None; Publications: 18271001, 20637498, 31638560, 27480077; Phenotypes: Congenital disorder of glycosylation, type Iq (MIM#612379); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.60 | DCHS1 |
Ain Roesley gene: DCHS1 was added gene: DCHS1 was added to Lissencephaly and Band Heterotopia. Sources: Literature Mode of inheritance for gene: DCHS1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DCHS1 were set to 27262615; 22473091 Phenotypes for gene: DCHS1 were set to Van Maldergem syndrome 1 (MIM#601390) Penetrance for gene: DCHS1 were set to unknown Review for gene: DCHS1 was set to GREEN Added comment: PMID: 27262615; - cohort of 26x periventricular band heterotopias however 2x had additional phenotype of pachygyria - 2nd cohort of 10x band heterotopias PMID: 22473091; - 1x patient with localised areas of cortical thickening and gyral simplification Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.10 | STRADA | Paul De Fazio reviewed gene: STRADA: Rating: RED; Mode of pathogenicity: None; Publications: 28688840, 17522105, 27170158, 23616120; Phenotypes: Polyhydramnios, megalencephaly, and symptomatic epilepsy (MIM#611087); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.60 | NSDHL |
Belinda Chong gene: NSDHL was added gene: NSDHL was added to Lissencephaly and Band Heterotopia. Sources: Literature Mode of inheritance for gene: NSDHL was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for gene: NSDHL were set to 19377476; 19842190; 21129721 Phenotypes for gene: NSDHL were set to CK syndrome 300831 Review for gene: NSDHL was set to AMBER gene: NSDHL was marked as current diagnostic Added comment: First described in 7 males from a five-generation family, 1-bp duplication p.(Lys232del) reported by Tarpey et al. (2009). PMID:19377476. Second affected family, p.(Arg367SerFs*33) reported by Tarpey et al. (2009) and McLarren et al. (2010) (PMID:19842190; 21129721). Functional studies showed that both mutations in these families result in partial loss of the function of the NSDHL protein and cause a distinct phenotype characterized by intellectual disability, seizures, microcephaly, cerebral cortical malformations, minor facial anomalies, and thin body habitus. Third described in five- generation family (missense -p.Gly152Asp) with affected males manifesting clinical features of CK syndrome. (https://doi.org/10.1002/ajmg.a.36999). Clinical feature described in the paper similar to CK syndrome however, no mention of cortical malformation, pachygyria, polymicrogyria, features mentioned in OMIM. But one affected male has a CT scan showing atrophic changes in the brain, internal hydrocephalus, and possible subependymal gray matter heterotopia. NB: Therefore, unsure if this is the third family hence leaving as Amber. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.97 | DAG1 |
Ain Roesley gene: DAG1 was added gene: DAG1 was added to Polymicrogyria and Schizencephaly. Sources: Literature Mode of inheritance for gene: DAG1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DAG1 were set to 24052401 Phenotypes for gene: DAG1 were set to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 9 (MIM#616538) Penetrance for gene: DAG1 were set to unknown Review for gene: DAG1 was set to RED Added comment: Also known as Walker-Warburg syndrome PMID: 24052401; - two Libyan siblings - MRI showed thin cortical layer resembling diffuse polymicrogyria with frontal agyria Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.97 | NSDHL | Belinda Chong reviewed gene: NSDHL: Rating: AMBER; Mode of pathogenicity: None; Publications: 19377476, 19842190, 21129721; Phenotypes: CK syndrome 300831; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.97 | TMEM216 | Paul De Fazio reviewed gene: TMEM216: Rating: RED; Mode of pathogenicity: None; Publications: 20512146; Phenotypes: Joubert syndrome 2 (MIM#608091); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.60 | OSGEP |
Naomi Baker changed review comment from: OSGEP mutations are associated with Galloway–Mowat syndrome, MIM#617729. Six Taiwanese patients, including two siblings, examined by either congenital MRI or cranial CT had pachygyria and hypomyelination (PMID:30558655). Sources: Literature; to: OSGEP mutations are associated with Galloway–Mowat syndrome, MIM#617729. Six Taiwanese patients, including two siblings, examined by either congenital MRI or cranial CT had pachygyria and hypomyelination (PMID:30558655). Another reports describes OSGEP mutations in multiple individuals, with at least three reported as having pachygyria (PMID:28805828). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.60 | OSGEP |
Naomi Baker gene: OSGEP was added gene: OSGEP was added to Lissencephaly and Band Heterotopia. Sources: Literature Mode of inheritance for gene: OSGEP was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: OSGEP were set to PMID: 30558655 Phenotypes for gene: OSGEP were set to Galloway-Mowat syndrome 3, MIM#617729 Penetrance for gene: OSGEP were set to Complete Review for gene: OSGEP was set to GREEN Added comment: OSGEP mutations are associated with Galloway–Mowat syndrome, MIM#617729. Six Taiwanese patients, including two siblings, examined by either congenital MRI or cranial CT had pachygyria and hypomyelination (PMID:30558655). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cobblestone Malformations v0.8 | DAG1 |
Ain Roesley gene: DAG1 was added gene: DAG1 was added to Cobblestone Malformations. Sources: Literature Mode of inheritance for gene: DAG1 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: DAG1 were set to 29337005 Phenotypes for gene: DAG1 were set to Walker-Warburg syndrome associated with tectocerebellar dysraphia; Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 9 (MIM#616538) Penetrance for gene: DAG1 were set to unknown Review for gene: DAG1 was set to RED Added comment: PMID: 29337005; - 1x consanguineous Israeli-Arab kindred with Walker-Warburg syndrome - The imaging studies demonstrated: cobblestone cortex, hydrocephalus, z-shaped brainstem, and in addition occipital encephalocele, vermian agenesis, and an elongated and thick tectum (tectocerebellar dysraphia). - homozygous frameshift Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.60 | CSNK2A1 |
Ain Roesley gene: CSNK2A1 was added gene: CSNK2A1 was added to Lissencephaly and Band Heterotopia. Sources: Literature Mode of inheritance for gene: CSNK2A1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: CSNK2A1 were set to 27048600; 29240241 Phenotypes for gene: CSNK2A1 were set to Okur-Chung neurodevelopmental syndrome (MIM#617062) Penetrance for gene: CSNK2A1 were set to unknown Review for gene: CSNK2A1 was set to AMBER Added comment: PMID: 27048600; - 5 unrelated patients - 1x pachygyria + 1x simplified gyral cortication PMID: 29240241; - summary of reports thus far, no additional patients with cortical malformations * all variants reported are de novo Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2875 | PDE2A | Zornitza Stark Marked gene: PDE2A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2875 | PDE2A | Zornitza Stark Gene: pde2a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2875 | PDE2A | Zornitza Stark Classified gene: PDE2A as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2875 | PDE2A | Zornitza Stark Gene: pde2a has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2874 | PDE2A |
Zornitza Stark gene: PDE2A was added gene: PDE2A was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list Mode of inheritance for gene: PDE2A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PDE2A were set to 32467598; 32196122; 29392776 Phenotypes for gene: PDE2A were set to Paroxysmal dyskinesia Review for gene: PDE2A was set to AMBER Added comment: Four unrelated families reported with childhood-onset refractory paroxysmal dyskinesia with cognitive impairment, sometimes associated with choreodystonia and interictal baseline EEG abnormalities or epilepsy. One of the reports characterises the disorder as 'Rett-like'. Unclear at this time what proportion of affected individuals have ID as part of the phenotype. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3939 | PDE2A | Zornitza Stark Marked gene: PDE2A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3939 | PDE2A | Zornitza Stark Gene: pde2a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3939 | PDE2A | Zornitza Stark Classified gene: PDE2A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3939 | PDE2A | Zornitza Stark Gene: pde2a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3938 | PDE2A |
Zornitza Stark gene: PDE2A was added gene: PDE2A was added to Mendeliome. Sources: Literature Mode of inheritance for gene: PDE2A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PDE2A were set to 32467598; 32196122; 29392776 Phenotypes for gene: PDE2A were set to Paroxysmal dyskinesia Review for gene: PDE2A was set to GREEN Added comment: Four unrelated families reported with childhood-onset refractory paroxysmal dyskinesia with cognitive impairment, sometimes associated with choreodystonia and interictal baseline EEG abnormalities or epilepsy. One of the reports characterises the disorder as 'Rett-like'. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.39 | PDE2A | Zornitza Stark Marked gene: PDE2A as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.39 | PDE2A | Zornitza Stark Gene: pde2a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.39 | PDE2A | Zornitza Stark Classified gene: PDE2A as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.39 | PDE2A | Zornitza Stark Gene: pde2a has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.38 | PDE2A |
Zornitza Stark gene: PDE2A was added gene: PDE2A was added to Paroxysmal Dyskinesia. Sources: Literature Mode of inheritance for gene: PDE2A was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: PDE2A were set to 32467598; 32196122; 29392776 Phenotypes for gene: PDE2A were set to Paroxysmal dyskinesia Review for gene: PDE2A was set to GREEN Added comment: Four unrelated families reported with childhood-onset refractory paroxysmal dyskinesia with cognitive impairment, sometimes associated with choreodystonia and interictal baseline EEG abnormalities or epilepsy. One of the reports characterises the disorder as 'Rett-like'. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paroxysmal Dyskinesia v0.37 | Zornitza Stark Panel types changed to Victorian Clinical Genetics Services; Rare Disease | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.54 | COASY | Zornitza Stark Marked gene: COASY as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.54 | COASY | Zornitza Stark Gene: coasy has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.54 | COASY | Zornitza Stark Phenotypes for gene: COASY were changed from to Neurodegeneration with brain iron accumulation 6, MIM# 615643 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.53 | COASY | Zornitza Stark Publications for gene: COASY were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.52 | COASY | Zornitza Stark Mode of inheritance for gene: COASY was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.51 | COASY | Zornitza Stark Classified gene: COASY as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.51 | COASY | Zornitza Stark Gene: coasy has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.50 | COASY | Zornitza Stark reviewed gene: COASY: Rating: AMBER; Mode of pathogenicity: None; Publications: 28489334, 24360804; Phenotypes: Neurodegeneration with brain iron accumulation 6, MIM# 615643; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.50 | CLN3 | Zornitza Stark Marked gene: CLN3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.50 | CLN3 | Zornitza Stark Gene: cln3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.50 | CLN3 | Zornitza Stark Phenotypes for gene: CLN3 were changed from to Ceroid lipofuscinosis, neuronal, 3 MIM#204200 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.49 | CLN3 | Zornitza Stark Publications for gene: CLN3 were set to 19489875; 11342698 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.48 | CLN3 | Zornitza Stark Mode of inheritance for gene: CLN3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.48 | CLN3 | Zornitza Stark Publications for gene: CLN3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.65 | C9orf72 | Zornitza Stark Marked gene: C9orf72 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.65 | C9orf72 | Zornitza Stark Gene: c9orf72 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.65 | C9orf72 | Zornitza Stark Classified gene: C9orf72 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.65 | C9orf72 | Zornitza Stark Gene: c9orf72 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.64 | C9orf72 |
Zornitza Stark gene: C9orf72 was added gene: C9orf72 was added to Early-onset Dementia. Sources: Expert list STR tags were added to gene: C9orf72. Mode of inheritance for gene: C9orf72 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: C9orf72 were set to 31779815; 21944778; 21944779 Phenotypes for gene: C9orf72 were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550 Review for gene: C9orf72 was set to GREEN Added comment: Well established gene-disease association. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.47 | C9orf72 | Zornitza Stark Phenotypes for gene: C9orf72 were changed from to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.46 | C9orf72 | Zornitza Stark Publications for gene: C9orf72 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.45 | C9orf72 | Zornitza Stark Mode of inheritance for gene: C9orf72 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.44 | APP | Zornitza Stark Marked gene: APP as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.44 | APP | Zornitza Stark Gene: app has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.44 | APP | Zornitza Stark Phenotypes for gene: APP were changed from to Alzheimer disease 1, familial, MIM# 104300 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.43 | APP | Zornitza Stark Mode of inheritance for gene: APP was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.42 | APP | Zornitza Stark Classified gene: APP as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.42 | APP | Zornitza Stark Gene: app has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.41 | APP | Zornitza Stark reviewed gene: APP: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Alzheimer disease 1, familial, MIM# 104300; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.77 | SCA6 | Bryony Thompson Classified STR: SCA6 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.77 | SCA6 | Bryony Thompson Str: sca6 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.76 | SCA6 |
Bryony Thompson STR: SCA6 was added STR: SCA6 was added to Ataxia - adult onset. Sources: Expert list STR tags were added to STR: SCA6. Mode of inheritance for STR: SCA6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA6 were set to 20301319; 29325606 Phenotypes for STR: SCA6 were set to Spinocerebellar ataxia 6 MIM#183086; Episodic ataxia, type 2 MIM#108500 Review for STR: SCA6 was set to GREEN STR: SCA6 was marked as clinically relevant Added comment: NM_023035.2:c.6929_6931CAG[X] PolyQ expansion alters gene binding, impairs transcription factor function, and is toxic to cells expressing the α1ACT – effects consistent with a loss of function Normal: ≤18 repeats Questionable significance: 19 CAG repeats Full penetrance: ≥20 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autoinflammatory Disorders v0.93 | OTULIN | Zornitza Stark Marked gene: OTULIN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autoinflammatory Disorders v0.93 | OTULIN | Zornitza Stark Gene: otulin has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autoinflammatory Disorders v0.93 | OTULIN | Zornitza Stark Phenotypes for gene: OTULIN were changed from to Autoinflammation, panniculitis, and dermatosis syndrome, MIM# 617099 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autoinflammatory Disorders v0.92 | OTULIN | Zornitza Stark Publications for gene: OTULIN were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autoinflammatory Disorders v0.91 | OTULIN | Zornitza Stark Mode of inheritance for gene: OTULIN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Autoinflammatory Disorders v0.90 | OTULIN | Zornitza Stark reviewed gene: OTULIN: Rating: GREEN; Mode of pathogenicity: None; Publications: 27523608, 27559085; Phenotypes: Autoinflammation, panniculitis, and dermatosis syndrome, MIM# 617099; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3937 | OTULIN | Zornitza Stark Marked gene: OTULIN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3937 | OTULIN | Zornitza Stark Gene: otulin has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3937 | OTULIN | Zornitza Stark Phenotypes for gene: OTULIN were changed from to Autoinflammation, panniculitis, and dermatosis syndrome, MIM# 617099 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3936 | OTULIN | Zornitza Stark Publications for gene: OTULIN were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3935 | OTULIN | Zornitza Stark Mode of inheritance for gene: OTULIN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3934 | OTULIN | Zornitza Stark reviewed gene: OTULIN: Rating: GREEN; Mode of pathogenicity: None; Publications: 27523608, 27559085; Phenotypes: Autoinflammation, panniculitis, and dermatosis syndrome, MIM# 617099; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Inflammatory bowel disease v0.34 | OTULIN | Zornitza Stark Marked gene: OTULIN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Inflammatory bowel disease v0.34 | OTULIN | Zornitza Stark Gene: otulin has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Inflammatory bowel disease v0.34 | OTULIN | Zornitza Stark Classified gene: OTULIN as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Inflammatory bowel disease v0.34 | OTULIN | Zornitza Stark Gene: otulin has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Inflammatory bowel disease v0.34 | OTULIN | Zornitza Stark Classified gene: OTULIN as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Inflammatory bowel disease v0.34 | OTULIN | Zornitza Stark Gene: otulin has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Inflammatory bowel disease v0.33 | OTULIN |
Zornitza Stark gene: OTULIN was added gene: OTULIN was added to Inflammatory bowel disease. Sources: Expert list Mode of inheritance for gene: OTULIN was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: OTULIN were set to 27523608; 27559085 Phenotypes for gene: OTULIN were set to Autoinflammation, panniculitis, and dermatosis syndrome, MIM# 617099 Review for gene: OTULIN was set to GREEN Added comment: Autoinflammatory disorder where diarrhoea is one of the presenting features in addition to recurrent fever, erythematous rash with painful nodules, painful joints, and lipodystrophy. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Inflammatory bowel disease v0.32 | NOD2 |
Zornitza Stark changed review comment from: Variants in NOD2 (particularly bi-allelic ones) are associated with increased risk of Crohn's disease. Sources: Expert Review; to: Variants in NOD2 (particularly bi-allelic ones) are associated with increased risk of Crohn's disease. 7% of a cohort of 401 patients with Crohn's had NOD2 bi-allelic variants. Sources: Expert Review |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Inflammatory bowel disease v0.32 | NOD2 | Zornitza Stark edited their review of gene: NOD2: Changed publications: 11385576, 17804789, 32463623; Changed phenotypes: {Inflammatory bowel disease 1, Crohn disease} 266600, {Yao syndrome} 617321 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Inflammatory bowel disease v0.32 | FERMT1 | Zornitza Stark Marked gene: FERMT1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Inflammatory bowel disease v0.32 | FERMT1 | Zornitza Stark Gene: fermt1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Inflammatory bowel disease v0.32 | FERMT1 | Zornitza Stark Phenotypes for gene: FERMT1 were changed from to Kindler syndrome, MIM# 173650 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Inflammatory bowel disease v0.31 | FERMT1 | Zornitza Stark Publications for gene: FERMT1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Inflammatory bowel disease v0.30 | FERMT1 | Zornitza Stark Mode of inheritance for gene: FERMT1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Inflammatory bowel disease v0.29 | FERMT1 | Zornitza Stark Classified gene: FERMT1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Inflammatory bowel disease v0.29 | FERMT1 | Zornitza Stark Gene: fermt1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Inflammatory bowel disease v0.28 | FERMT1 | Zornitza Stark reviewed gene: FERMT1: Rating: RED; Mode of pathogenicity: None; Publications: 19057668, 27537055, 32463623; Phenotypes: Kindler syndrome, MIM# 173650; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.75 | SCA3 | Bryony Thompson Classified STR: SCA3 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.75 | SCA3 | Bryony Thompson Str: sca3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.74 | SCA3 |
Bryony Thompson STR: SCA3 was added STR: SCA3 was added to Ataxia - adult onset. Sources: Expert list STR tags were added to STR: SCA3. Mode of inheritance for STR: SCA3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA3 were set to 20301375; 29325606 Phenotypes for STR: SCA3 were set to Machado-Joseph disease MIM#109150; Spinocerebellar ataxia type 3 Review for STR: SCA3 was set to GREEN STR: SCA3 was marked as clinically relevant Added comment: NM_004993.5:c.886_888CAG[X] Toxic aggregation and mislocalization in neurons is mechanism of disease Normal: ≤44 repeats, mostly <31 repeats Intermediate: 45-59 repeats, some intermediate alleles are not associated with classic clinical features of SCA3 Pathogenic (full penetrance): ≥60 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.73 | SCA2 | Bryony Thompson Classified STR: SCA2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.73 | SCA2 | Bryony Thompson Str: sca2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.72 | SCA2 |
Bryony Thompson STR: SCA2 was added STR: SCA2 was added to Ataxia - adult onset. Sources: Expert list STR tags were added to STR: SCA2. Mode of inheritance for STR: SCA2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA2 were set to 29325606; 20301452 Phenotypes for STR: SCA2 were set to Spinocerebellar ataxia 2 MIM#183090 Review for STR: SCA2 was set to GREEN STR: SCA2 was marked as clinically relevant Added comment: NM_002973.3:c.496_498CAG[X] Toxic protein aggregation is mechanism of disease Benign: ≤31 repeats (homozygous 31/31 repeats reported for recessive SCA2) Uncertain: 32 repeats ALS risk allele: 30-32 repeats Reduced penetrance: 33-34 repeats, may not develop symptoms or only very late in life Full penetrance: ≥35 repeats Interruption of a CAG expanded allele by a CAA repeat does not mitigate the pathogenicity of the repeat size, but may enhance the meiotic stability of the repeat Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.71 | SCA1 | Bryony Thompson Classified STR: SCA1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.71 | SCA1 | Bryony Thompson Str: sca1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.70 | SCA1 |
Bryony Thompson changed review comment from: NM_000332.3:c.589_591CAG[X] Toxic protein aggregation is mechanism of disease Sources: Expert list; to: NM_000332.3:c.589_591CAG[X] Toxic protein aggregation is mechanism of disease Normal: ≤35 CAG repeats or 36-44 CAG repeats with CAT interruptions Mutable normal (intermediate): 36-38 CAG repeats without CAT interruptions Full-penetrance: ≥39 CAG repeats without CAT interruptions or ≥46 uninterrupted CAG repeats with CAT interruptions and additional CAGs Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3934 | RRAGC | Zornitza Stark Publications for gene: RRAGC were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3933 | RRAGC | Zornitza Stark Marked gene: RRAGC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3933 | RRAGC | Zornitza Stark Gene: rragc has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3933 | RRAGC | Zornitza Stark Phenotypes for gene: RRAGC were changed from to Dilated cardiomyopathy; cataract | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiomyopathy_Paediatric v0.4 | RRAGC | Zornitza Stark Marked gene: RRAGC as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiomyopathy_Paediatric v0.4 | RRAGC | Zornitza Stark Gene: rragc has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiomyopathy_Paediatric v0.4 | RRAGC | Zornitza Stark Classified gene: RRAGC as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiomyopathy_Paediatric v0.4 | RRAGC | Zornitza Stark Gene: rragc has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiomyopathy_Paediatric v0.3 | RRAGC | Zornitza Stark reviewed gene: RRAGC: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3932 | RRAGC | Zornitza Stark Mode of inheritance for gene: RRAGC was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3931 | RRAGC | Zornitza Stark Classified gene: RRAGC as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3931 | RRAGC | Zornitza Stark Gene: rragc has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3930 | RRAGC | Zornitza Stark reviewed gene: RRAGC: Rating: RED; Mode of pathogenicity: None; Publications: 27234373; Phenotypes: Dilated cardiomyopathy, cataract; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3930 | RANBP17 | Zornitza Stark Marked gene: RANBP17 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3930 | RANBP17 | Zornitza Stark Gene: ranbp17 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3930 | RANBP17 | Zornitza Stark Classified gene: RANBP17 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3930 | RANBP17 | Zornitza Stark Gene: ranbp17 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3929 | RANBP17 | Zornitza Stark reviewed gene: RANBP17: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.70 | SCA1 |
Bryony Thompson STR: SCA1 was added STR: SCA1 was added to Ataxia - adult onset. Sources: Expert list STR tags were added to STR: SCA1. Mode of inheritance for STR: SCA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: SCA1 were set to 29325606; 20301363 Phenotypes for STR: SCA1 were set to Spinocerebellar ataxia 1 MIM#164400 Review for STR: SCA1 was set to GREEN STR: SCA1 was marked as clinically relevant Added comment: NM_000332.3:c.589_591CAG[X] Toxic protein aggregation is mechanism of disease Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.69 | DRPLA | Bryony Thompson Classified STR: DRPLA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.69 | DRPLA | Bryony Thompson Str: drpla has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.68 | DRPLA |
Bryony Thompson STR: DRPLA was added STR: DRPLA was added to Ataxia - adult onset. Sources: Expert list STR tags were added to STR: DRPLA. Mode of inheritance for STR: DRPLA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: DRPLA were set to 29325606; 20301664 Phenotypes for STR: DRPLA were set to Dentatorubral-pallidoluysian atrophy MIM#125370 Review for STR: DRPLA was set to GREEN STR: DRPLA was marked as clinically relevant Added comment: NM_001007026.1:c.1462_1464CAG[X] Toxic gain of function mechanism of disease Benign: ≤35 repeats Mutable normal: 20-35 repeats Pathogenic: ≥48 repeats Age <20 years: ≥63 repeats - ataxia, myoclonus, seizures, progressive intellectual deterioration Age 21-40 years 61-69 repeats, >40 years 48-67 repeats: ataxia, choreoathetosis, dementia, psychiatric disturbance Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v0.50 | SBMA | Bryony Thompson Classified STR: SBMA as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v0.50 | SBMA | Bryony Thompson Str: sbma has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motor Neurone Disease v0.49 | SBMA |
Bryony Thompson STR: SBMA was added STR: SBMA was added to Motor Neuron Disease. Sources: Expert list STR tags were added to STR: SBMA. Mode of inheritance for STR: SBMA was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females Publications for STR: SBMA were set to 20301508; 29325606 Phenotypes for STR: SBMA were set to Spinal and bulbar muscular atrophy of Kennedy MIM#313200 Review for STR: SBMA was set to GREEN STR: SBMA was marked as clinically relevant Added comment: NM_000044.4:c.172_174CAG[X] Toxic gain of function mechanism of disease Normal: ≤34 repeats Unknown: 35 repeats, consideration of the affected individual's clinical presentation and reconciliation with repeat sizes in family members Reduced-penetrance: 36-37 repeats, interpreted within the context of family history, clinical presentation, genotype-phenotype correlations in other family members. Full-penetrance: ≥38 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.41 | HD | Bryony Thompson Classified STR: HD as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.41 | HD | Bryony Thompson Str: hd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.40 | HD |
Bryony Thompson STR: HD was added STR: HD was added to Early-onset Parkinson disease. Sources: Expert list STR tags were added to STR: HD. Mode of inheritance for STR: HD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: HD were set to 20301482; 29325606 Phenotypes for STR: HD were set to Huntington disease MIM#143100 Review for STR: HD was set to GREEN STR: HD was marked as clinically relevant Added comment: NM_002111.8:c.52_54CAG[X] Primary mechanism of disease is gain of function Normal: ≤26 repeats Intermediate: 27-35 repeats, no risk for proband but expansion possible in the next generation Pathogenic (reduced penetrance): 36-39 repeats, proband at risk for HD but may not develop symptoms Pathogenic (full penetrance): ≥40 repeats, development of HD with increased certainty assuming a normal life span Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.39 | Bryony Thompson removed STR:HD from the panel | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cardiomyopathy_Paediatric v0.3 | RRAGC |
Elena Savva gene: RRAGC was added gene: RRAGC was added to Cardiomyopathy_Paediatric. Sources: Literature Mode of inheritance for gene: RRAGC was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Publications for gene: RRAGC were set to PMID: 29367541; 27234373 Phenotypes for gene: RRAGC were set to Pediatric Dilated Cardiomyopathy Mode of pathogenicity for gene: RRAGC was set to Other Review for gene: RRAGC was set to AMBER Added comment: PMID: 29367541 - 1 de novo patient (missense) w/ paediatric cardiomyopathy PMID: 27234373 - same de novo missense as above, functional studies show a GOF mechanism MIssense variant is absent from the population (gnomAD) and in a highly constrained region (Decipher) Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.38 | HD | Bryony Thompson Classified STR: HD as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.38 | HD | Bryony Thompson Str: hd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.37 | HD |
Bryony Thompson STR: HD was added STR: HD was added to Early-onset Parkinson disease. Sources: Expert list STR tags were added to STR: HD. Mode of inheritance for STR: HD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: HD were set to 20301482; 29325606 Phenotypes for STR: HD were set to Huntington disease MIM#143100 Review for STR: HD was set to GREEN STR: HD was marked as clinically relevant Added comment: NM_002111.8:c.52_54CAG[X] Primary mechanism of disease is gain of function Normal: ≤26 repeats Intermediate: 27-35 repeats, no risk for proband but expansion possible in the next generation Pathogenic (reduced penetrance): 36-39 repeats, proband at risk for HD but may not develop symptoms Pathogenic (full penetrance): ≥40 repeats, development of HD with increased certainty assuming a normal life span Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3929 | MICA | Zornitza Stark Marked gene: MICA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3929 | MICA | Zornitza Stark Gene: mica has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3929 | MICA | Zornitza Stark Classified gene: MICA as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3929 | MICA | Zornitza Stark Gene: mica has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3928 | MICA | Zornitza Stark reviewed gene: MICA: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.67 | FXTAS |
Bryony Thompson changed review comment from: HGVS nomenclature - NM_002024.5:c.-129CGG[X] RNA-mediated toxicity may result in the FXTAS phenotype, whereas loss of function through methylation silencing of FMR1 is associated with the FXS phenotype. Intermediate (gray zone, inconclusive, borderline): ~45 to ~54 repeats Premutation - risk of FXTAS: ~55 to ~200 repeats Full mutation - fragile X syndrome (FXS): >200 repeats Sources: Expert list; to: HGVS nomenclature - NM_002024.5:c.-129_-127CGG[X] RNA-mediated toxicity may result in the FXTAS phenotype, whereas loss of function through methylation silencing of FMR1 is associated with the FXS phenotype. Intermediate (gray zone, inconclusive, borderline): ~45 to ~54 repeats Premutation - risk of FXTAS: ~55 to ~200 repeats Full mutation - fragile X syndrome (FXS): >200 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.67 | FXTAS | Bryony Thompson Tag STR tag was added to STR: FXTAS. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrops fetalis v0.189 | FLVCR2 | Zornitza Stark Marked gene: FLVCR2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrops fetalis v0.189 | FLVCR2 | Zornitza Stark Gene: flvcr2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrops fetalis v0.189 | FLVCR2 | Zornitza Stark Phenotypes for gene: FLVCR2 were changed from Cystic hygroma; hydrops; hydranencephal; arthrogryposis to Cystic hygroma; hydrops; hydranencephaly; arthrogryposis; Proliferative vasculopathy and hydranencephaly-hydrocephaly syndrome, MIM# 225790 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrops fetalis v0.188 | FLVCR2 | Zornitza Stark Publications for gene: FLVCR2 were set to PMID: 30712878 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrops fetalis v0.187 | FLVCR2 | Zornitza Stark Classified gene: FLVCR2 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrops fetalis v0.187 | FLVCR2 | Zornitza Stark Gene: flvcr2 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrops fetalis v0.186 | FLVCR2 | Zornitza Stark changed review comment from: Single case reported as part of big prenatal series.; to: Single case reported with cystic hygroma as part of big prenatal series. More typical presentation is with hydrocephalus, fetal akinesia, polyhydramnios. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrops fetalis v0.186 | FLVCR2 | Zornitza Stark edited their review of gene: FLVCR2: Changed phenotypes: Cystic hygroma, Proliferative vasculopathy and hydranencephaly-hydrocephaly syndrome, MIM# 225790 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrops fetalis v0.186 | FLVCR2 | Zornitza Stark reviewed gene: FLVCR2: Rating: RED; Mode of pathogenicity: None; Publications: 30712878; Phenotypes: Cystic hygroma; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrops fetalis v0.186 | FLVCR2 |
John Christodoulou gene: FLVCR2 was added gene: FLVCR2 was added to Hydrops fetalis. Sources: Other Mode of inheritance for gene: FLVCR2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: FLVCR2 were set to PMID: 30712878 Phenotypes for gene: FLVCR2 were set to Cystic hygroma; hydrops; hydranencephal; arthrogryposis Penetrance for gene: FLVCR2 were set to unknown Review for gene: FLVCR2 was set to RED Added comment: In this prospective cohort study, the parents of fetuses who were found to have a structural anomaly in a prenatal ultrasound were screened for possible participation in the study. DNA samples from 234 (45%) eligible trios were therefore used for analysis of the primary outcome. By use of trio sequence data, we identified diagnostic genetic variants in 24 (10%) families. Mutations with bioinformatic signatures that were indicative of pathogenicity but with insufficient evidence to be considered diagnostic were also evaluated; 46 (20%) of the 234 fetuses assessed were found to have such signatures. Sources: Other |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.60 | APC2 | Zornitza Stark edited their review of gene: APC2: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.60 | CRADD | Zornitza Stark changed review comment from: At least 5 families reported though some were from the Pennsylvania Mennonite population, and had same founder variant (but at least 4 unique variants reported).; to: At least 5 families reported though some were from the Pennsylvania Mennonite population, and had same founder variant (but at least 4 unique variants reported). Brain imaging shows a mild variant of lissencephaly with anterior-predominant pachygyria with shallow and unusually wide sulci and mildly thickened cortex. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2873 | CRADD | Zornitza Stark Marked gene: CRADD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2873 | CRADD | Zornitza Stark Gene: cradd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2873 | CRADD | Zornitza Stark Phenotypes for gene: CRADD were changed from to Mental retardation, autosomal recessive 34, with variant lissencephaly, MIM# 614499 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2872 | CRADD | Zornitza Stark Publications for gene: CRADD were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2871 | CRADD | Zornitza Stark Mode of inheritance for gene: CRADD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2870 | CRADD | Zornitza Stark reviewed gene: CRADD: Rating: GREEN; Mode of pathogenicity: None; Publications: 27773430; Phenotypes: Mental retardation, autosomal recessive 34, with variant lissencephaly, MIM# 614499; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3928 | CRADD | Zornitza Stark Marked gene: CRADD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3928 | CRADD | Zornitza Stark Gene: cradd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3928 | CRADD | Zornitza Stark Phenotypes for gene: CRADD were changed from to Mental retardation, autosomal recessive 34, with variant lissencephaly, MIM# 614499 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3927 | CRADD | Zornitza Stark Publications for gene: CRADD were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3926 | CRADD | Zornitza Stark Mode of inheritance for gene: CRADD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3925 | CRADD | Zornitza Stark reviewed gene: CRADD: Rating: GREEN; Mode of pathogenicity: None; Publications: 27773430; Phenotypes: Mental retardation, autosomal recessive 34, with variant lissencephaly, MIM# 614499; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.60 | CRADD | Zornitza Stark Marked gene: CRADD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.60 | CRADD | Zornitza Stark Gene: cradd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.60 | CRADD | Zornitza Stark Phenotypes for gene: CRADD were changed from to Mental retardation, autosomal recessive 34, with variant lissencephaly, MIM# 614499 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.59 | CRADD | Zornitza Stark Publications for gene: CRADD were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.58 | CRADD | Zornitza Stark Mode of inheritance for gene: CRADD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.57 | CRADD | Zornitza Stark reviewed gene: CRADD: Rating: GREEN; Mode of pathogenicity: None; Publications: 27773430; Phenotypes: Mental retardation, autosomal recessive 34, with variant lissencephaly, MIM# 614499; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3925 | TDGF1 | Zornitza Stark Marked gene: TDGF1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3925 | TDGF1 | Zornitza Stark Gene: tdgf1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3925 | TDGF1 | Zornitza Stark Phenotypes for gene: TDGF1 were changed from to Forebrain abnormalities | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3924 | TDGF1 | Zornitza Stark Publications for gene: TDGF1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3923 | TDGF1 | Zornitza Stark Mode of inheritance for gene: TDGF1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3922 | TDGF1 | Zornitza Stark Classified gene: TDGF1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3922 | TDGF1 | Zornitza Stark Gene: tdgf1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3921 | TDGF1 | Zornitza Stark reviewed gene: TDGF1: Rating: RED; Mode of pathogenicity: None; Publications: 12073012; Phenotypes: Forebrain abnormalities; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.43 | TDGF1 | Zornitza Stark Marked gene: TDGF1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.43 | TDGF1 | Zornitza Stark Gene: tdgf1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2870 | TDGF1 | Zornitza Stark Marked gene: TDGF1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2870 | TDGF1 | Zornitza Stark Added comment: Comment when marking as ready: Variant reported is present in 46 hets in gnomad. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2870 | TDGF1 | Zornitza Stark Gene: tdgf1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2870 | TDGF1 | Zornitza Stark Tag disputed tag was added to gene: TDGF1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.43 | TDGF1 | Zornitza Stark Phenotypes for gene: TDGF1 were changed from to Forebrain abnormalities | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.42 | TDGF1 | Zornitza Stark Publications for gene: TDGF1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.41 | TDGF1 | Zornitza Stark Mode of inheritance for gene: TDGF1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.40 | TDGF1 | Zornitza Stark Classified gene: TDGF1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.40 | TDGF1 | Zornitza Stark Gene: tdgf1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.39 | TDGF1 | Zornitza Stark Tag disputed tag was added to gene: TDGF1. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.39 | TDGF1 | Zornitza Stark reviewed gene: TDGF1: Rating: RED; Mode of pathogenicity: None; Publications: 12073012; Phenotypes: Forebrain abnormalities; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.67 | FXTAS | Bryony Thompson edited their review of STR: FXTAS: Changed publications: 23765048, 25227148, 11445641 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.67 | FMR1 | Bryony Thompson Deleted their comment | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.67 | FMR1 | Bryony Thompson Classified gene: FMR1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.67 | FMR1 | Bryony Thompson Added comment: Comment on list classification: Ataxia is caused by the premutation repeat expansion. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.67 | FMR1 | Bryony Thompson Gene: fmr1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.66 | FXTAS | Bryony Thompson Classified STR: FXTAS as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.66 | FXTAS | Bryony Thompson Str: fxtas has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Ataxia - adult onset v0.65 | FXTAS |
Bryony Thompson STR: FXTAS was added STR: FXTAS was added to Ataxia - adult onset. Sources: Expert list Mode of inheritance for STR: FXTAS was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Publications for STR: FXTAS were set to 23765048; 25227148 Phenotypes for STR: FXTAS were set to Fragile X tremor/ataxia syndrome MIM#300623 Review for STR: FXTAS was set to GREEN STR: FXTAS was marked as clinically relevant Added comment: HGVS nomenclature - NM_002024.5:c.-129CGG[X] RNA-mediated toxicity may result in the FXTAS phenotype, whereas loss of function through methylation silencing of FMR1 is associated with the FXS phenotype. Intermediate (gray zone, inconclusive, borderline): ~45 to ~54 repeats Premutation - risk of FXTAS: ~55 to ~200 repeats Full mutation - fragile X syndrome (FXS): >200 repeats Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.39 | STIL | Zornitza Stark Marked gene: STIL as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.39 | STIL | Zornitza Stark Gene: stil has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.39 | STIL | Zornitza Stark Phenotypes for gene: STIL were changed from to Microcephaly 7, primary, autosomal recessive, MIM# 612703 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.38 | STIL | Zornitza Stark Publications for gene: STIL were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.37 | STIL | Zornitza Stark Mode of inheritance for gene: STIL was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.36 | STIL | Zornitza Stark Classified gene: STIL as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.36 | STIL | Zornitza Stark Gene: stil has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.35 | STIL | Zornitza Stark reviewed gene: STIL: Rating: RED; Mode of pathogenicity: None; Publications: 25218063; Phenotypes: Microcephaly 7, primary, autosomal recessive, MIM# 612703; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.35 | HESX1 | Zornitza Stark Marked gene: HESX1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.35 | HESX1 | Zornitza Stark Gene: hesx1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.35 | HESX1 | Zornitza Stark Phenotypes for gene: HESX1 were changed from to Septooptic dysplasia, MIM# 182230 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.34 | HESX1 | Zornitza Stark Mode of inheritance for gene: HESX1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.33 | HESX1 | Zornitza Stark reviewed gene: HESX1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Septooptic dysplasia, MIM# 182230; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.33 | GLI3 | Zornitza Stark Marked gene: GLI3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.33 | GLI3 | Zornitza Stark Gene: gli3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.33 | GLI3 | Zornitza Stark Phenotypes for gene: GLI3 were changed from to Pallister-Hall syndrome, MIM# 146510 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.32 | GLI3 | Zornitza Stark Publications for gene: GLI3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.31 | GLI3 | Zornitza Stark Mode of inheritance for gene: GLI3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.30 | GLI3 | Zornitza Stark Classified gene: GLI3 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.30 | GLI3 | Zornitza Stark Gene: gli3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.29 | GLI3 | Zornitza Stark reviewed gene: GLI3: Rating: RED; Mode of pathogenicity: None; Publications: 24736735; Phenotypes: Pallister-Hall syndrome, MIM# 146510; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrocephalus_Ventriculomegaly v0.51 | DLL1 | Zornitza Stark Marked gene: DLL1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrocephalus_Ventriculomegaly v0.51 | DLL1 | Zornitza Stark Gene: dll1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrocephalus_Ventriculomegaly v0.51 | DLL1 | Zornitza Stark Classified gene: DLL1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrocephalus_Ventriculomegaly v0.51 | DLL1 | Zornitza Stark Gene: dll1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Hydrocephalus_Ventriculomegaly v0.50 | DLL1 |
Zornitza Stark gene: DLL1 was added gene: DLL1 was added to Hydrocephalus_Ventriculomegaly. Sources: Expert list Mode of inheritance for gene: DLL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: DLL1 were set to 31353024 Phenotypes for gene: DLL1 were set to Neurodevelopmental disorder with nonspecific brain abnormalities and with or without seizures, MIM# 618709 Review for gene: DLL1 was set to GREEN Added comment: 14 individuals from 11 families reported. All 11 patients who underwent brain imaging showed nonspecific and variable abnormalities, including hydrocephalus, ventriculomegaly, thin, short, or dysplastic corpus callosum, subtle cortical dysplasia, and small cerebellum or pons. One patient had periventricular nodular heterotopia. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.194 | DLL1 | Zornitza Stark Marked gene: DLL1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.194 | DLL1 | Zornitza Stark Gene: dll1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.194 | DLL1 | Zornitza Stark Classified gene: DLL1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.194 | DLL1 | Zornitza Stark Gene: dll1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Callosome v0.193 | DLL1 |
Zornitza Stark gene: DLL1 was added gene: DLL1 was added to Callosome. Sources: Expert list Mode of inheritance for gene: DLL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: DLL1 were set to 31353024 Phenotypes for gene: DLL1 were set to Neurodevelopmental disorder with nonspecific brain abnormalities and with or without seizures, MIM# 618709 Review for gene: DLL1 was set to GREEN Added comment: 14 individuals from 11 families reported. All 11 patients who underwent brain imaging showed nonspecific and variable abnormalities, including hydrocephalus, ventriculomegaly, thin, short, or dysplastic corpus callosum, subtle cortical dysplasia, and small cerebellum or pons. One patient had periventricular nodular heterotopia. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.29 | DLL1 | Zornitza Stark Marked gene: DLL1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.29 | DLL1 | Zornitza Stark Gene: dll1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.29 | DLL1 | Zornitza Stark Phenotypes for gene: DLL1 were changed from to Neurodevelopmental disorder with nonspecific brain abnormalities and with or without seizures, MIM# 618709 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.28 | DLL1 | Zornitza Stark Publications for gene: DLL1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.27 | DLL1 | Zornitza Stark Mode of inheritance for gene: DLL1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.26 | DLL1 | Zornitza Stark Classified gene: DLL1 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.26 | DLL1 | Zornitza Stark Gene: dll1 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.25 | DLL1 | Zornitza Stark reviewed gene: DLL1: Rating: RED; Mode of pathogenicity: None; Publications: 31353024; Phenotypes: Neurodevelopmental disorder with nonspecific brain abnormalities and with or without seizures, MIM# 618709; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.25 | CHD7 | Zornitza Stark Marked gene: CHD7 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.25 | CHD7 | Zornitza Stark Gene: chd7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.25 | CHD7 | Zornitza Stark Classified gene: CHD7 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.25 | CHD7 | Zornitza Stark Gene: chd7 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Holoprosencephaly and septo-optic dysplasia v0.24 | CHD7 |
Zornitza Stark gene: CHD7 was added gene: CHD7 was added to Holoprosencephaly and septo-optic dysplasia. Sources: Expert list Mode of inheritance for gene: CHD7 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: CHD7 were set to 11562938; 28805615; 20104611; 17001700 Phenotypes for gene: CHD7 were set to Smith-Lemli-Opitz syndrome, 270400; alobar holoprosencephaly (HPE) Review for gene: CHD7 was set to GREEN Added comment: Reports of HPE phenotype. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3921 | GABRA6 | Zornitza Stark Marked gene: GABRA6 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3921 | GABRA6 | Zornitza Stark Gene: gabra6 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3921 | GABRA6 |
Zornitza Stark gene: GABRA6 was added gene: GABRA6 was added to Mendeliome. Sources: Literature Mode of inheritance for gene: GABRA6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GABRA6 were set to 21930603; 29215089; 19429026 Phenotypes for gene: GABRA6 were set to Benign familial inherited epilepsy; Childhood absence epilepsy Review for gene: GABRA6 was set to RED Added comment: One report in a cohort of patients with BFIE. Potential susceptibility allele in CAE. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.798 | GABRA6 | Zornitza Stark Classified gene: GABRA6 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.798 | GABRA6 | Zornitza Stark Gene: gabra6 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.797 | GABRA6 | Zornitza Stark Classified gene: GABRA6 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.797 | GABRA6 | Zornitza Stark Gene: gabra6 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.57 | ASPM | Zornitza Stark Marked gene: ASPM as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.57 | ASPM | Zornitza Stark Gene: aspm has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.57 | ASPM | Zornitza Stark Classified gene: ASPM as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.57 | ASPM | Zornitza Stark Gene: aspm has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2870 | TMTC3 | Zornitza Stark Marked gene: TMTC3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2870 | TMTC3 | Zornitza Stark Gene: tmtc3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2870 | TMTC3 | Zornitza Stark Phenotypes for gene: TMTC3 were changed from to Lissencephaly 8 (MIM#617255) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2869 | TMTC3 | Zornitza Stark Publications for gene: TMTC3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2868 | TMTC3 | Zornitza Stark Mode of inheritance for gene: TMTC3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2867 | TMTC3 | Zornitza Stark reviewed gene: TMTC3: Rating: GREEN; Mode of pathogenicity: None; Publications: 27773428, 28973161; Phenotypes: Lissencephaly 8 (MIM#617255); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3920 | TMTC3 | Zornitza Stark Marked gene: TMTC3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3920 | TMTC3 | Zornitza Stark Gene: tmtc3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3920 | TMTC3 | Zornitza Stark Phenotypes for gene: TMTC3 were changed from to Lissencephaly 8 (MIM#617255) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3919 | TMTC3 | Zornitza Stark Publications for gene: TMTC3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3918 | TMTC3 | Zornitza Stark Mode of inheritance for gene: TMTC3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3917 | TMTC3 | Zornitza Stark reviewed gene: TMTC3: Rating: GREEN; Mode of pathogenicity: None; Publications: 27773428, 28973161; Phenotypes: Lissencephaly 8 (MIM#617255); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.14 | TMTC3 | Zornitza Stark Marked gene: TMTC3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.14 | TMTC3 | Zornitza Stark Gene: tmtc3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.14 | TMTC3 | Zornitza Stark Classified gene: TMTC3 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.14 | TMTC3 | Zornitza Stark Gene: tmtc3 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cobblestone Malformations v0.8 | TMTC3 | Zornitza Stark Marked gene: TMTC3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cobblestone Malformations v0.8 | TMTC3 | Zornitza Stark Gene: tmtc3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cobblestone Malformations v0.8 | TMTC3 | Zornitza Stark Phenotypes for gene: TMTC3 were changed from to Lissencephaly 8 (MIM#617255) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cobblestone Malformations v0.7 | TMTC3 | Zornitza Stark Publications for gene: TMTC3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cobblestone Malformations v0.6 | TMTC3 | Zornitza Stark Mode of inheritance for gene: TMTC3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tubulinopathies v0.13 | TUBGCP4 | Zornitza Stark Marked gene: TUBGCP4 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tubulinopathies v0.13 | TUBGCP4 | Zornitza Stark Gene: tubgcp4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genetic Epilepsy v0.796 | GABRA6 |
Anna Le Fevre gene: GABRA6 was added gene: GABRA6 was added to Genetic Epilepsy. Sources: Literature Mode of inheritance for gene: GABRA6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for gene: GABRA6 were set to PMID: 21930603; 29215089; 19429026 Phenotypes for gene: GABRA6 were set to BFIE; CAE Penetrance for gene: GABRA6 were set to unknown Review for gene: GABRA6 was set to RED Added comment: One report in a cohort of patients with BFIE Potential susceptibility allele in CAE Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tubulinopathies v0.13 | TUBGCP4 | Zornitza Stark Phenotypes for gene: TUBGCP4 were changed from to Microcephaly and chorioretinopathy, autosomal recessive, 3 (MIM#616335) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tubulinopathies v0.12 | TUBGCP4 | Zornitza Stark Publications for gene: TUBGCP4 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tubulinopathies v0.11 | TUBGCP4 | Zornitza Stark Mode of inheritance for gene: TUBGCP4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tubulinopathies v0.10 | TUBGCP4 | Zornitza Stark Classified gene: TUBGCP4 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tubulinopathies v0.10 | TUBGCP4 | Zornitza Stark Gene: tubgcp4 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.151 | ARFGEF2 | Zornitza Stark Marked gene: ARFGEF2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.151 | ARFGEF2 | Zornitza Stark Gene: arfgef2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.151 | ARFGEF2 | Zornitza Stark Phenotypes for gene: ARFGEF2 were changed from to Periventricular heterotopia with microcephaly (MIM#608097) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.150 | ARFGEF2 | Zornitza Stark Publications for gene: ARFGEF2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.149 | ARFGEF2 | Zornitza Stark Mode of inheritance for gene: ARFGEF2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Microcephaly v0.148 | ARFGEF2 | Zornitza Stark reviewed gene: ARFGEF2: Rating: GREEN; Mode of pathogenicity: None; Publications: 25160555, 26126837, 23812912; Phenotypes: Periventricular heterotopia with microcephaly (MIM#608097); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3917 | ARFGEF2 | Zornitza Stark Marked gene: ARFGEF2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3917 | ARFGEF2 | Zornitza Stark Gene: arfgef2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3917 | ARFGEF2 | Zornitza Stark Phenotypes for gene: ARFGEF2 were changed from to Periventricular heterotopia with microcephaly (MIM#608097) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3916 | ARFGEF2 | Zornitza Stark Publications for gene: ARFGEF2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3915 | ARFGEF2 | Zornitza Stark Mode of inheritance for gene: ARFGEF2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3914 | ARFGEF2 | Zornitza Stark reviewed gene: ARFGEF2: Rating: GREEN; Mode of pathogenicity: None; Publications: 25160555, 26126837, 23812912; Phenotypes: Periventricular heterotopia with microcephaly (MIM#608097); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.13 | ARFGEF2 | Zornitza Stark Marked gene: ARFGEF2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.13 | ARFGEF2 | Zornitza Stark Gene: arfgef2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.13 | ARFGEF2 | Zornitza Stark Phenotypes for gene: ARFGEF2 were changed from to Periventricular heterotopia with microcephaly (MIM#608097) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.12 | ARFGEF2 | Zornitza Stark Publications for gene: ARFGEF2 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.11 | ARFGEF2 | Zornitza Stark Mode of inheritance for gene: ARFGEF2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.97 | AKT3 | Zornitza Stark Marked gene: AKT3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.97 | AKT3 | Zornitza Stark Gene: akt3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.97 | AKT3 | Zornitza Stark Phenotypes for gene: AKT3 were changed from to Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 2 (MIM#615937) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.96 | AKT3 | Zornitza Stark Publications for gene: AKT3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.95 | AKT3 | Zornitza Stark Mode of inheritance for gene: AKT3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.61 | TBX1 | Zornitza Stark Marked gene: TBX1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.61 | TBX1 | Zornitza Stark Gene: tbx1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.61 | TBX1 | Zornitza Stark Phenotypes for gene: TBX1 were changed from to DiGeorge syndrome (MIM#188400) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.60 | TBX1 | Zornitza Stark Mode of pathogenicity for gene: TBX1 was changed from None to None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.59 | TBX1 | Zornitza Stark Publications for gene: TBX1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.58 | TBX1 | Zornitza Stark Mode of pathogenicity for gene: TBX1 was changed from to None | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.57 | TBX1 | Zornitza Stark Mode of inheritance for gene: TBX1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.94 | SMO | Zornitza Stark Marked gene: SMO as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.94 | SMO | Zornitza Stark Gene: smo has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.94 | SMO | Zornitza Stark Classified gene: SMO as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.94 | SMO | Zornitza Stark Gene: smo has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.93 | SMO | Zornitza Stark Tag somatic tag was added to gene: SMO. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.56 | ACTG1 | Zornitza Stark Marked gene: ACTG1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.56 | ACTG1 | Zornitza Stark Gene: actg1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.56 | ACTG1 | Zornitza Stark Phenotypes for gene: ACTG1 were changed from to Baraitser-Winter syndrome 2 (MIM#614583) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.55 | ACTG1 | Zornitza Stark Publications for gene: ACTG1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.54 | ACTG1 | Zornitza Stark Mode of inheritance for gene: ACTG1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.53 | TMX2 | Zornitza Stark Marked gene: TMX2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.53 | TMX2 | Zornitza Stark Gene: tmx2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.53 | TMX2 | Zornitza Stark Classified gene: TMX2 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.53 | TMX2 | Zornitza Stark Gene: tmx2 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.52 | ASPM |
Ain Roesley gene: ASPM was added gene: ASPM was added to Lissencephaly and Band Heterotopia. Sources: Literature Mode of inheritance for gene: ASPM was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: ASPM were set to 18452193; 19332161; 19770472; 27250695 Phenotypes for gene: ASPM were set to Microcephaly 5, primary, autosomal recessive (MIM#608716) Penetrance for gene: ASPM were set to unknown Review for gene: ASPM was set to GREEN Added comment: PMID: 18452193; Consanguineous family with 2 affecteds with simplified pattern of gyration - homozygous for a PTV PMID: 19332161; - consanguineous Algerian family in which 3/5 affecteds presented with simplified cortical gyration - cHet for 2 PTVs PMID: 19770472; - 11 families with 16 affecteds - 9/12 affecteds have simplified frontal and/or occipital gyral pattern - All PTVs reported PMID: 27250695; - 15 families with 21 affecteds - 4 had coarse gyri and 8 had simplified gyral pattern - all PTVs Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.93 | TMX2 | Zornitza Stark reviewed gene: TMX2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with microcephaly, cortical malformations, and spasticity MIM#618730; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.93 | TMX2 | Zornitza Stark Marked gene: TMX2 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.93 | TMX2 | Zornitza Stark Gene: tmx2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.93 | TMX2 | Zornitza Stark Classified gene: TMX2 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.93 | TMX2 | Zornitza Stark Gene: tmx2 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.52 | ACTB | Zornitza Stark Marked gene: ACTB as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.52 | ACTB | Zornitza Stark Gene: actb has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.52 | ACTB | Zornitza Stark Phenotypes for gene: ACTB were changed from to Baraitser-Winter syndrome 1 (MIM#243310) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.51 | ACTB | Zornitza Stark Publications for gene: ACTB were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.50 | ACTB | Zornitza Stark Mode of inheritance for gene: ACTB was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.49 | VLDLR | Zornitza Stark Marked gene: VLDLR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.49 | VLDLR | Zornitza Stark Gene: vldlr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.49 | VLDLR | Zornitza Stark Phenotypes for gene: VLDLR were changed from to Cerebellar hypoplasia and mental retardation with or without quadrupedal locomotion 1 (MIM#224050) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.48 | VLDLR | Zornitza Stark Publications for gene: VLDLR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.47 | VLDLR | Zornitza Stark Mode of inheritance for gene: VLDLR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.10 | TMTC3 |
Paul De Fazio changed review comment from: Mostly associated with cobblestone lissencephaly in (6 unrelated families with biallelic variants, PMID: 27773428). However in 3/4 siblings of another family (PMID: 28973161) biallelic variants were not associated with cobblestone lissencephaly, but periventricular hetertopia instead. The 4th sibling had a normal brain. Animal model studies (Drosophila and rat) support a role for this gene in neurodevelopment. Although I thought it worth having this gene on this panel I have rated it Red as it is a single family reported with this phenotype, with not all members affected, and it is a different phenotype to that reported previously (i.e. very much 'low evidence'). Sources: Literature; to: Mostly associated with cobblestone lissencephaly in (6 unrelated families with biallelic variants, PMID: 27773428). However in 3/4 siblings of another family (PMID: 28973161) biallelic variants were not associated with cobblestone lissencephaly, but periventricular heterotopia instead. The 4th sibling had a normal brain. Animal model studies (Drosophila and rat) support a role for this gene in neurodevelopment. Although I thought it worth having this gene on this panel I have rated it Red as it is a single family reported with this phenotype, with not all members affected, and it is a different phenotype to that reported previously (i.e. very much 'low evidence'). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.10 | TMTC3 |
Paul De Fazio gene: TMTC3 was added gene: TMTC3 was added to Periventricular Grey Matter Heterotopia. Sources: Literature Mode of inheritance for gene: TMTC3 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMTC3 were set to 27773428; 28973161 Phenotypes for gene: TMTC3 were set to Lissencephaly 8 (MIM#617255) Review for gene: TMTC3 was set to RED gene: TMTC3 was marked as current diagnostic Added comment: Mostly associated with cobblestone lissencephaly in (6 unrelated families with biallelic variants, PMID: 27773428). However in 3/4 siblings of another family (PMID: 28973161) biallelic variants were not associated with cobblestone lissencephaly, but periventricular hetertopia instead. The 4th sibling had a normal brain. Animal model studies (Drosophila and rat) support a role for this gene in neurodevelopment. Although I thought it worth having this gene on this panel I have rated it Red as it is a single family reported with this phenotype, with not all members affected, and it is a different phenotype to that reported previously (i.e. very much 'low evidence'). Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cobblestone Malformations v0.5 | TMTC3 |
Paul De Fazio changed review comment from: Associated with cobblestone lissencephaly in 6 unrelated families with biallelic variants (PMID: 27773428). Most affected individuals also showed brainstem and cerebellum hypoplasia, as well as ventriculomegaly. In 3/4 siblings of another family (PMID: 28973161) biallelic variants were not associated with cobblestone lissencephaly, but periventricular hetertopia instead. The 4th sibling had a normal brain. Animal model studies (Drosophila and rat) support a role for this gene in neurodevelopment.; to: Associated with cobblestone lissencephaly in 6 unrelated families with biallelic variants (PMID: 27773428). Most affected individuals also showed brainstem and cerebellum hypoplasia, as well as ventriculomegaly. One individual had polymicrogyria. In 3/4 siblings of another family (PMID: 28973161) biallelic variants were not associated with cobblestone lissencephaly, but periventricular hetertopia instead. The 4th sibling had a normal brain. Animal model studies (Drosophila and rat) support a role for this gene in neurodevelopment. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cobblestone Malformations v0.5 | TMTC3 | Paul De Fazio reviewed gene: TMTC3: Rating: GREEN; Mode of pathogenicity: None; Publications: 27773428, 28973161; Phenotypes: Lissencephaly 8 (MIM#617255); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.41 | ABL1 | Bryony Thompson Marked gene: ABL1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.41 | ABL1 | Bryony Thompson Gene: abl1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.41 | ABL1 | Bryony Thompson Publications for gene: ABL1 were set to 28288113 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.40 | ABL1 | Bryony Thompson Classified gene: ABL1 as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.40 | ABL1 | Bryony Thompson Gene: abl1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Skeletal dysplasia v0.39 | ABL1 | Bryony Thompson reviewed gene: ABL1: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 28288113, 30855488, 32643838; Phenotypes: Congenital heart defects and skeletal malformations syndrome MIM#617602; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Tubulinopathies v0.9 | TUBGCP4 | Paul De Fazio reviewed gene: TUBGCP4: Rating: RED; Mode of pathogenicity: None; Publications: 25817018, 32270730; Phenotypes: Microcephaly and chorioretinopathy, autosomal recessive, 3 (MIM#616335); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Periventricular Grey Matter Heterotopia v0.10 | ARFGEF2 | Ain Roesley reviewed gene: ARFGEF2: Rating: GREEN; Mode of pathogenicity: None; Publications: 25160555, 26126837, 23812912; Phenotypes: Periventricular heterotopia with microcephaly (MIM#608097); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.92 | AKT3 |
Ain Roesley changed review comment from: PMID: 28969385; - 15/20 patients with constitutional mutation in AKT3 presented with polymicrogyria; to: PMID: 28969385; - 15/20 patients with constitutional mutation in AKT3 presented with polymicrogyria - de novo and missense |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.92 | AKT3 | Ain Roesley reviewed gene: AKT3: Rating: GREEN; Mode of pathogenicity: None; Publications: 28969385; Phenotypes: Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 2 (MIM#615937); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.56 | TBX1 | Crystle Lee edited their review of gene: TBX1: Changed rating: GREEN | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Congenital Heart Defect v0.56 | TBX1 | Crystle Lee reviewed gene: TBX1: Rating: AMBER; Mode of pathogenicity: Other; Publications: 31428446, 32110744, 29250159, 30137364, 24998776, 28272434; Phenotypes: DiGeorge syndrome (MIM#188400); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.92 | SMO |
Paul De Fazio gene: SMO was added gene: SMO was added to Polymicrogyria and Schizencephaly. Sources: Literature Mode of inheritance for gene: SMO was set to Unknown Publications for gene: SMO were set to 27236920; 24859340 Phenotypes for gene: SMO were set to Curry-Jones syndrome, somatic mosaic MIM#601707 Mode of pathogenicity for gene: SMO was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments Review for gene: SMO was set to AMBER gene: SMO was marked as current diagnostic Added comment: PMID 27236920 summarises the clinical and molecular findings in 8 unrelated individuals (including individuals reported previously). All 8 had the same somatic mosaic missense variant c.1234C>T p.(Leu412Phe) (absent from gnomAD). 2 had polymicrogyria. Other brain abnormalities reported include agenesis of the corpus callosum, hemimegalencephaly, ventriculomegaly. 1 individual was reported to have a normal brain. In mouse embryonic fibroblasts, this variant results in constitutive activation (PMID: 24859340). Other, biallelic germline variants in this gene are associated with Pallister-Hall-like syndrome (MIM#241800) but the MRI findings in individuals with this syndrome don't appear to be applicable to this panel. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.46 | ACTG1 | Ain Roesley reviewed gene: ACTG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 29671837, 27240540, 25052316; Phenotypes: Baraitser-Winter syndrome 2 (MIM#614583); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.46 | TMX2 |
Paul De Fazio gene: TMX2 was added gene: TMX2 was added to Lissencephaly and Band Heterotopia. Sources: Literature Mode of inheritance for gene: TMX2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMX2 were set to 31735293; 31586943 Phenotypes for gene: TMX2 were set to Neurodevelopmental disorder with microcephaly, cortical malformations, and spasticity MIM#618730 Review for gene: TMX2 was set to AMBER gene: TMX2 was marked as current diagnostic Added comment: Summary: 14 families reported with biallelic variants and neurodevelopmental disorder, but individuals from 5 families had pachygyria/lissencephaly, and 4 of those families shared the same variant. PMID 31735293: 2 unrelated individuals (out of 14 total from 10 families) with biallelic variants had pachygyria on MRI. Other individuals had brain atrophy or polymicrogyria. One individual had a normal MRI. PMID 31586943: 8 individuals from 4 families had the same homozygous missense variant (10 heterozygotes in gnomAD.). All of the individuals had lissencephaly. This variant was also identified in one individual from PMID 31735293, who had polymicrogyria. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.92 | TMX2 |
Paul De Fazio changed review comment from: PMID 31735293: 5 unrelated individuals (out of 14 total from 10 families) with biallelic variants had polymicrogyria on MRI. Other individuals had brain atrophy or pachygyria. One individual had a normal MRI. PMID 31586943: 8 individuals from 4 families had the same homozygous missense variant (10 heterozygotes in gnomAD.). All of the individuals had lissencephaly, NOT polymycrogyria. This variant was also identified in one individual from PMID 31735293, who did have polymicrogyria. Sources: Literature; to: Summary: 14 families reported with biallelic variants and neurodevelopmental disorder, but individuals from 5 families had polymicrogyria. PMID 31735293: 5 unrelated individuals (out of 14 total from 10 families) with biallelic variants had polymicrogyria on MRI. Other individuals had brain atrophy or pachygyria. One individual had a normal MRI. PMID 31586943: 8 individuals from 4 families had the same homozygous missense variant (10 heterozygotes in gnomAD.). All of the individuals had lissencephaly, NOT polymycrogyria. This variant was also identified in one individual from PMID 31735293, who did have polymicrogyria. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Polymicrogyria and Schizencephaly v0.92 | TMX2 |
Paul De Fazio gene: TMX2 was added gene: TMX2 was added to Polymicrogyria and Schizencephaly. Sources: Literature Mode of inheritance for gene: TMX2 was set to BIALLELIC, autosomal or pseudoautosomal Publications for gene: TMX2 were set to 31735293; 31586943 Phenotypes for gene: TMX2 were set to Neurodevelopmental disorder with microcephaly, cortical malformations, and spasticity MIM#618730 Review for gene: TMX2 was set to AMBER gene: TMX2 was marked as current diagnostic Added comment: PMID 31735293: 5 unrelated individuals (out of 14 total from 10 families) with biallelic variants had polymicrogyria on MRI. Other individuals had brain atrophy or pachygyria. One individual had a normal MRI. PMID 31586943: 8 individuals from 4 families had the same homozygous missense variant (10 heterozygotes in gnomAD.). All of the individuals had lissencephaly, NOT polymycrogyria. This variant was also identified in one individual from PMID 31735293, who did have polymicrogyria. Sources: Literature |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.46 | ACTB | Ain Roesley reviewed gene: ACTB: Rating: GREEN; Mode of pathogenicity: None; Publications: 29671837, 22366783; Phenotypes: Baraitser-Winter syndrome 1 (MIM#243310); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Lissencephaly and Band Heterotopia v0.46 | VLDLR | Paul De Fazio reviewed gene: VLDLR: Rating: GREEN; Mode of pathogenicity: None; Publications: 16080122, 18364738, 18326629, 22700954, 22973972; Phenotypes: Cerebellar hypoplasia and mental retardation with or without quadrupedal locomotion 1 (MIM#224050); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Malformations of cortical development_Superpanel v0.110 | Zornitza Stark Panel types changed to Victorian Clinical Genetics Services; Royal Melbourne Hospital; Rare Disease | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.83 | QDPR | Zornitza Stark Marked gene: QDPR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.83 | QDPR | Zornitza Stark Gene: qdpr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.83 | QDPR | Zornitza Stark Phenotypes for gene: QDPR were changed from to Hyperphenylalaninemia, BH4-deficient, C, MIM# 261630 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.82 | QDPR | Zornitza Stark Publications for gene: QDPR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.81 | QDPR | Zornitza Stark Mode of inheritance for gene: QDPR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.80 | QDPR | Zornitza Stark reviewed gene: QDPR: Rating: GREEN; Mode of pathogenicity: None; Publications: 11153907; Phenotypes: Hyperphenylalaninemia, BH4-deficient, C, MIM# 261630; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.80 | GLRA1 | Zornitza Stark Marked gene: GLRA1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.80 | GLRA1 | Zornitza Stark Gene: glra1 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.80 | TH | Zornitza Stark Marked gene: TH as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.80 | TH | Zornitza Stark Gene: th has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.80 | TH | Zornitza Stark Phenotypes for gene: TH were changed from to Segawa syndrome, recessive , MIM#605407 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.79 | TH | Zornitza Stark Publications for gene: TH were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.78 | TH | Zornitza Stark Mode of inheritance for gene: TH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.77 | TH | Zornitza Stark reviewed gene: TH: Rating: GREEN; Mode of pathogenicity: None; Publications: 17696123, 11246459, 10585338; Phenotypes: Segawa syndrome, recessive , MIM#605407; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.77 | SPR | Zornitza Stark Marked gene: SPR as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.77 | SPR | Zornitza Stark Gene: spr has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.77 | SPR | Zornitza Stark Phenotypes for gene: SPR were changed from to Dystonia, dopa-responsive, due to sepiapterin reductase deficiency 612716 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.76 | SPR | Zornitza Stark Publications for gene: SPR were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.75 | SPR | Zornitza Stark Mode of inheritance for gene: SPR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.74 | SPR | Zornitza Stark reviewed gene: SPR: Rating: GREEN; Mode of pathogenicity: None; Publications: 22522443; Phenotypes: Dystonia, dopa-responsive, due to sepiapterin reductase deficiency 612716; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.74 | SLC6A5 | Zornitza Stark Marked gene: SLC6A5 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.74 | SLC6A5 | Zornitza Stark Gene: slc6a5 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.74 | SLC6A5 | Zornitza Stark Phenotypes for gene: SLC6A5 were changed from to Hyperekplexia 3, MIM# 614618 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.73 | SLC6A5 | Zornitza Stark Publications for gene: SLC6A5 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.72 | SLC6A5 | Zornitza Stark Mode of inheritance for gene: SLC6A5 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.71 | SLC6A5 | Zornitza Stark reviewed gene: SLC6A5: Rating: GREEN; Mode of pathogenicity: None; Publications: 16751771; Phenotypes: Hyperekplexia 3, MIM# 614618; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3914 | SLC6A3 | Zornitza Stark Marked gene: SLC6A3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3914 | SLC6A3 | Zornitza Stark Gene: slc6a3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3914 | SLC6A3 | Zornitza Stark Phenotypes for gene: SLC6A3 were changed from to Parkinsonism-dystonia, infantile, 1, MIM# 613135 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3913 | SLC6A3 | Zornitza Stark Publications for gene: SLC6A3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3912 | SLC6A3 | Zornitza Stark Mode of inheritance for gene: SLC6A3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.36 | SLC6A3 | Zornitza Stark Marked gene: SLC6A3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.36 | SLC6A3 | Zornitza Stark Gene: slc6a3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3911 | SLC6A3 | Zornitza Stark reviewed gene: SLC6A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 21112253; Phenotypes: Parkinsonism-dystonia, infantile, 1, MIM# 613135; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.36 | SLC6A3 | Zornitza Stark Phenotypes for gene: SLC6A3 were changed from Parkinsonism-dystonia, infantile, 1, MIM# 613135 to Parkinsonism-dystonia, infantile, 1, MIM# 613135 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.36 | SLC6A3 | Zornitza Stark Phenotypes for gene: SLC6A3 were changed from to Parkinsonism-dystonia, infantile, 1, MIM# 613135 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.35 | SLC6A3 | Zornitza Stark Publications for gene: SLC6A3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.34 | SLC6A3 | Zornitza Stark Mode of inheritance for gene: SLC6A3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Parkinson disease v0.33 | SLC6A3 | Zornitza Stark reviewed gene: SLC6A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 21112253; Phenotypes: Parkinsonism-dystonia, infantile, 1, MIM# 613135; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.71 | SLC6A3 | Zornitza Stark Marked gene: SLC6A3 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.71 | SLC6A3 | Zornitza Stark Gene: slc6a3 has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.71 | SLC6A3 | Zornitza Stark Phenotypes for gene: SLC6A3 were changed from to Parkinsonism-dystonia, infantile, 1, MIM# 613135 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.70 | SLC6A3 | Zornitza Stark Publications for gene: SLC6A3 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.69 | SLC6A3 | Zornitza Stark Mode of inheritance for gene: SLC6A3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.68 | SLC6A3 | Zornitza Stark reviewed gene: SLC6A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 21112253; Phenotypes: Parkinsonism-dystonia, infantile, 1, MIM# 613135; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.68 | SLC25A22 | Zornitza Stark Marked gene: SLC25A22 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.68 | SLC25A22 | Zornitza Stark Gene: slc25a22 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.68 | SLC25A22 | Zornitza Stark Phenotypes for gene: SLC25A22 were changed from to Epileptic encephalopathy, early infantile, 3, MIM# 609304 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.67 | SLC25A22 | Zornitza Stark Mode of inheritance for gene: SLC25A22 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.66 | SLC25A22 | Zornitza Stark Classified gene: SLC25A22 as Red List (low evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.66 | SLC25A22 | Zornitza Stark Gene: slc25a22 has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.65 | SLC25A22 | Zornitza Stark reviewed gene: SLC25A22: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Epileptic encephalopathy, early infantile, 3, MIM# 609304; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.65 | PTS | Zornitza Stark Marked gene: PTS as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.65 | PTS | Zornitza Stark Gene: pts has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.65 | PTS | Zornitza Stark Phenotypes for gene: PTS were changed from to Hyperphenylalaninemia, BH4-deficient, A, MIM# 261640 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.64 | PTS | Zornitza Stark Publications for gene: PTS were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.63 | PTS | Zornitza Stark Mode of inheritance for gene: PTS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.62 | PTS | Zornitza Stark reviewed gene: PTS: Rating: GREEN; Mode of pathogenicity: None; Publications: 9222755; Phenotypes: Hyperphenylalaninemia, BH4-deficient, A, MIM# 261640; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.62 | PNPO | Zornitza Stark Marked gene: PNPO as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.62 | PNPO | Zornitza Stark Gene: pnpo has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.62 | PNPO | Zornitza Stark Phenotypes for gene: PNPO were changed from to Pyridoxamine 5'-phosphate oxidase deficiency, MIM# 610090 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.61 | PNPO | Zornitza Stark Mode of inheritance for gene: PNPO was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.60 | PNPO | Zornitza Stark reviewed gene: PNPO: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Pyridoxamine 5'-phosphate oxidase deficiency, MIM# 610090; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.60 | PCBD1 | Zornitza Stark Marked gene: PCBD1 as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.60 | PCBD1 | Zornitza Stark Gene: pcbd1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.60 | PCBD1 | Zornitza Stark Phenotypes for gene: PCBD1 were changed from to Hyperphenylalaninemia, BH4-deficient, D, MIM# 264070 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.59 | PCBD1 | Zornitza Stark Publications for gene: PCBD1 were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.58 | PCBD1 | Zornitza Stark Mode of inheritance for gene: PCBD1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.57 | PCBD1 | Zornitza Stark Classified gene: PCBD1 as Amber List (moderate evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.57 | PCBD1 | Zornitza Stark Gene: pcbd1 has been classified as Amber List (Moderate Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.56 | PCBD1 | Zornitza Stark reviewed gene: PCBD1: Rating: AMBER; Mode of pathogenicity: None; Publications: 9585615; Phenotypes: Hyperphenylalaninemia, BH4-deficient, D, MIM# 264070; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2867 | MAOA | Zornitza Stark Marked gene: MAOA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2867 | MAOA | Zornitza Stark Gene: maoa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2867 | MAOA | Zornitza Stark Phenotypes for gene: MAOA were changed from to Brunner syndrome, MIM# 300615 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2866 | MAOA | Zornitza Stark Publications for gene: MAOA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2865 | MAOA | Zornitza Stark Mode of inheritance for gene: MAOA was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Intellectual disability syndromic and non-syndromic v0.2864 | MAOA | Zornitza Stark reviewed gene: MAOA: Rating: GREEN; Mode of pathogenicity: None; Publications: 25807999, 24169519; Phenotypes: Brunner syndrome, MIM# 300615; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3911 | MAOA | Zornitza Stark Marked gene: MAOA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3911 | MAOA | Zornitza Stark Gene: maoa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3911 | MAOA | Zornitza Stark Phenotypes for gene: MAOA were changed from to Brunner syndrome, MIM# 300615 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3910 | MAOA | Zornitza Stark Publications for gene: MAOA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3909 | MAOA | Zornitza Stark Mode of inheritance for gene: MAOA was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mendeliome v0.3908 | MAOA | Zornitza Stark reviewed gene: MAOA: Rating: GREEN; Mode of pathogenicity: None; Publications: 25807999, 24169519; Phenotypes: Brunner syndrome, MIM# 300615; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.56 | MAOA | Zornitza Stark Marked gene: MAOA as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.56 | MAOA | Zornitza Stark Gene: maoa has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.56 | MAOA | Zornitza Stark Phenotypes for gene: MAOA were changed from to Brunner syndrome, MIM# 300615 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.55 | MAOA | Zornitza Stark Publications for gene: MAOA were set to | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.54 | MAOA | Zornitza Stark Mode of inheritance for gene: MAOA was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.53 | MAOA | Zornitza Stark reviewed gene: MAOA: Rating: GREEN; Mode of pathogenicity: None; Publications: 25807999, 24169519; Phenotypes: Brunner syndrome, MIM# 300615; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.53 | GPHN | Zornitza Stark changed review comment from: Well established gene-disease association, but indirect link to neurotransmitter defects: gephryn interacts with glycine and GABA receptors.; to: Indirect link to neurotransmitter defects: gephryn interacts with glycine and GABA receptors. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.53 | GPHN | Zornitza Stark Marked gene: GPHN as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Neurotransmitter Defects v0.53 | GPHN | Zornitza Stark Gene: gphn has been classified as Red List (Low Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||