Activity

Filter

Cancel
Date Panel Item Activity
3000 actions
Mendeliome v0.3990 PAFAH1B1 Zornitza Stark Publications for gene: PAFAH1B1 were set to
Mendeliome v0.3989 PAFAH1B1 Zornitza Stark Mode of inheritance for gene: PAFAH1B1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3988 PAFAH1B1 Zornitza Stark reviewed gene: PAFAH1B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 11754098, 18285425; Phenotypes: Lissencephaly 1, MIM# 607432, Subcortical laminar heterotopia, MIM# 607432, MONDO:0011830; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.104 PAFAH1B1 Zornitza Stark changed review comment from: Lissencephaly due to PAFAH1B1 (prev known as LIS1) mutation is a cerebral malformation with epilepsy characterised predominantly by posterior isolated lissencephaly with developmental delay, intellectual disability and epilepsy that usually evolves from West syndrome to Lennox-Gastaut syndrome. Additional features include muscular hypotonia, acquired microcephaly, failure to thrive and poor control of airways leading to aspiration pneumonia.; to: Lissencephaly due to PAFAH1B1 (prev known as LIS1) mutation is a cerebral malformation with epilepsy characterised predominantly by posterior isolated lissencephaly with developmental delay, intellectual disability and epilepsy that usually evolves from West syndrome to Lennox-Gastaut syndrome. Additional features include muscular hypotonia, acquired microcephaly, failure to thrive and poor control of airways leading to aspiration pneumonia. Note deletions are common.
Lissencephaly and Band Heterotopia v0.104 PAFAH1B1 Zornitza Stark Marked gene: PAFAH1B1 as ready
Lissencephaly and Band Heterotopia v0.104 PAFAH1B1 Zornitza Stark Gene: pafah1b1 has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.104 PAFAH1B1 Zornitza Stark Tag SV/CNV tag was added to gene: PAFAH1B1.
Lissencephaly and Band Heterotopia v0.104 PAFAH1B1 Zornitza Stark Phenotypes for gene: PAFAH1B1 were changed from to Lissencephaly 1, MIM# 607432; Subcortical laminar heterotopia, MIM# 607432; MONDO:0011830
Lissencephaly and Band Heterotopia v0.103 PAFAH1B1 Zornitza Stark Publications for gene: PAFAH1B1 were set to
Lissencephaly and Band Heterotopia v0.102 PAFAH1B1 Zornitza Stark Mode of inheritance for gene: PAFAH1B1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.101 PAFAH1B1 Zornitza Stark reviewed gene: PAFAH1B1: Rating: GREEN; Mode of pathogenicity: None; Publications: 11754098, 18285425; Phenotypes: Lissencephaly 1, MIM# 607432, Subcortical laminar heterotopia, MIM# 607432, MONDO:0011830; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.101 LARGE1 Zornitza Stark Marked gene: LARGE1 as ready
Lissencephaly and Band Heterotopia v0.101 LARGE1 Zornitza Stark Gene: large1 has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.101 LARGE1 Zornitza Stark Phenotypes for gene: LARGE1 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 6, MIM# 613154; Muscular dystrophy-dystroglycanopathy (congenital with mental retardation), type B, 6, MIM# 608840
Lissencephaly and Band Heterotopia v0.100 LARGE1 Zornitza Stark Mode of inheritance for gene: LARGE1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.99 LARGE1 Zornitza Stark reviewed gene: LARGE1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 6, MIM# 613154, Muscular dystrophy-dystroglycanopathy (congenital with mental retardation), type B, 6, MIM# 608840; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3988 LAMB1 Zornitza Stark Marked gene: LAMB1 as ready
Mendeliome v0.3988 LAMB1 Zornitza Stark Gene: lamb1 has been classified as Green List (High Evidence).
Mendeliome v0.3988 LAMB1 Zornitza Stark Phenotypes for gene: LAMB1 were changed from to Lissencephaly 5, MIM# 615191; Cystic leukoencephalopathy
Mendeliome v0.3987 LAMB1 Zornitza Stark Publications for gene: LAMB1 were set to
Mendeliome v0.3986 LAMB1 Zornitza Stark Mode of inheritance for gene: LAMB1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3985 LAMB1 Zornitza Stark reviewed gene: LAMB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23472759, 25925986, 29888467, 25925986, 32548278; Phenotypes: Lissencephaly 5, MIM# 615191, Cystic leukoencephalopathy; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.99 LAMB1 Zornitza Stark Phenotypes for gene: LAMB1 were changed from to Lissencephaly 5, MIM# 615191
Lissencephaly and Band Heterotopia v0.98 LAMB1 Zornitza Stark Publications for gene: LAMB1 were set to
Lissencephaly and Band Heterotopia v0.97 LAMB1 Zornitza Stark Mode of inheritance for gene: LAMB1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.96 LAMB1 Zornitza Stark reviewed gene: LAMB1: Rating: GREEN; Mode of pathogenicity: None; Publications: 23472759, 25925986, 29888467; Phenotypes: Lissencephaly 5, MIM# 615191; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Muscular dystrophy and myopathy_Paediatric v0.73 TMEM5 Zornitza Stark Marked gene: TMEM5 as ready
Muscular dystrophy and myopathy_Paediatric v0.73 TMEM5 Zornitza Stark Gene: tmem5 has been classified as Green List (High Evidence).
Muscular dystrophy and myopathy_Paediatric v0.73 TMEM5 Zornitza Stark Phenotypes for gene: TMEM5 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041
Muscular dystrophy and myopathy_Paediatric v0.72 TMEM5 Zornitza Stark Publications for gene: TMEM5 were set to
Muscular dystrophy and myopathy_Paediatric v0.71 TMEM5 Zornitza Stark Mode of inheritance for gene: TMEM5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Muscular dystrophy and myopathy_Paediatric v0.70 TMEM5 Zornitza Stark reviewed gene: TMEM5: Rating: GREEN; Mode of pathogenicity: None; Publications: 23217329, 23519211; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3985 TMEM5 Zornitza Stark Marked gene: TMEM5 as ready
Mendeliome v0.3985 TMEM5 Zornitza Stark Gene: tmem5 has been classified as Green List (High Evidence).
Mendeliome v0.3985 TMEM5 Zornitza Stark Phenotypes for gene: TMEM5 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041
Mendeliome v0.3984 TMEM5 Zornitza Stark Publications for gene: TMEM5 were set to
Mendeliome v0.3983 TMEM5 Zornitza Stark Mode of inheritance for gene: TMEM5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3982 TMEM5 Zornitza Stark reviewed gene: TMEM5: Rating: GREEN; Mode of pathogenicity: None; Publications: 23217329, 23519211; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Cobblestone Malformations v0.12 TMEM5 Zornitza Stark Marked gene: TMEM5 as ready
Cobblestone Malformations v0.12 TMEM5 Zornitza Stark Gene: tmem5 has been classified as Green List (High Evidence).
Cobblestone Malformations v0.12 TMEM5 Zornitza Stark Phenotypes for gene: TMEM5 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041
Cobblestone Malformations v0.11 TMEM5 Zornitza Stark Publications for gene: TMEM5 were set to
Cobblestone Malformations v0.10 TMEM5 Zornitza Stark Mode of inheritance for gene: TMEM5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Cobblestone Malformations v0.9 TMEM5 Zornitza Stark reviewed gene: TMEM5: Rating: GREEN; Mode of pathogenicity: None; Publications: 23217329, 23519211; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.96 TMEM5 Zornitza Stark Marked gene: TMEM5 as ready
Lissencephaly and Band Heterotopia v0.96 TMEM5 Zornitza Stark Gene: tmem5 has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.96 TMEM5 Zornitza Stark Phenotypes for gene: TMEM5 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041
Lissencephaly and Band Heterotopia v0.95 TMEM5 Zornitza Stark Publications for gene: TMEM5 were set to
Lissencephaly and Band Heterotopia v0.94 TMEM5 Zornitza Stark Mode of inheritance for gene: TMEM5 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.93 TMEM5 Zornitza Stark edited their review of gene: TMEM5: Changed publications: 23217329, 23519211
Lissencephaly and Band Heterotopia v0.93 TMEM5 Zornitza Stark reviewed gene: TMEM5: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Callosome v0.201 KIF5C Zornitza Stark Marked gene: KIF5C as ready
Callosome v0.201 KIF5C Zornitza Stark Gene: kif5c has been classified as Green List (High Evidence).
Callosome v0.201 KIF5C Zornitza Stark Phenotypes for gene: KIF5C were changed from to Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282
Callosome v0.200 KIF5C Zornitza Stark Publications for gene: KIF5C were set to
Callosome v0.199 KIF5C Zornitza Stark Mode of inheritance for gene: KIF5C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Callosome v0.198 KIF5C Zornitza Stark reviewed gene: KIF5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 23033978, 32562872; Phenotypes: Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2891 KIF5C Zornitza Stark Marked gene: KIF5C as ready
Intellectual disability syndromic and non-syndromic v0.2891 KIF5C Zornitza Stark Gene: kif5c has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2891 KIF5C Zornitza Stark Phenotypes for gene: KIF5C were changed from to Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282
Intellectual disability syndromic and non-syndromic v0.2890 KIF5C Zornitza Stark Publications for gene: KIF5C were set to
Genetic Epilepsy v0.816 KIF5C Zornitza Stark Marked gene: KIF5C as ready
Genetic Epilepsy v0.816 KIF5C Zornitza Stark Gene: kif5c has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2889 KIF5C Zornitza Stark Mode of inheritance for gene: KIF5C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.816 KIF5C Zornitza Stark Phenotypes for gene: KIF5C were changed from to Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282
Intellectual disability syndromic and non-syndromic v0.2888 KIF5C Zornitza Stark reviewed gene: KIF5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 23033978, 32562872; Phenotypes: Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.815 KIF5C Zornitza Stark Publications for gene: KIF5C were set to
Genetic Epilepsy v0.814 KIF5C Zornitza Stark Mode of inheritance for gene: KIF5C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3982 KIF5C Zornitza Stark Marked gene: KIF5C as ready
Mendeliome v0.3982 KIF5C Zornitza Stark Gene: kif5c has been classified as Green List (High Evidence).
Genetic Epilepsy v0.813 KIF5C Zornitza Stark reviewed gene: KIF5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 23033978, 32562872; Phenotypes: Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3982 KIF5C Zornitza Stark Phenotypes for gene: KIF5C were changed from to Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282
Mendeliome v0.3981 KIF5C Zornitza Stark Publications for gene: KIF5C were set to
Mendeliome v0.3980 KIF5C Zornitza Stark Mode of inheritance for gene: KIF5C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Polymicrogyria and Schizencephaly v0.142 KIF5C Zornitza Stark Marked gene: KIF5C as ready
Polymicrogyria and Schizencephaly v0.142 KIF5C Zornitza Stark Gene: kif5c has been classified as Green List (High Evidence).
Polymicrogyria and Schizencephaly v0.142 KIF5C Zornitza Stark Phenotypes for gene: KIF5C were changed from to Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282
Mendeliome v0.3979 KIF5C Zornitza Stark reviewed gene: KIF5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 23033978, 32562872; Phenotypes: Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Polymicrogyria and Schizencephaly v0.141 KIF5C Zornitza Stark Publications for gene: KIF5C were set to
Polymicrogyria and Schizencephaly v0.140 KIF5C Zornitza Stark Mode of inheritance for gene: KIF5C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Polymicrogyria and Schizencephaly v0.139 KIF5C Zornitza Stark reviewed gene: KIF5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 23033978, 32562872; Phenotypes: Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.93 KIF5C Zornitza Stark Marked gene: KIF5C as ready
Lissencephaly and Band Heterotopia v0.93 KIF5C Zornitza Stark Gene: kif5c has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.93 KIF5C Zornitza Stark Phenotypes for gene: KIF5C were changed from to Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282
Lissencephaly and Band Heterotopia v0.92 KIF5C Zornitza Stark Publications for gene: KIF5C were set to
Lissencephaly and Band Heterotopia v0.91 KIF5C Zornitza Stark Mode of inheritance for gene: KIF5C was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.90 KIF5C Zornitza Stark reviewed gene: KIF5C: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 23033978, 32562872; Phenotypes: Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Callosome v0.198 KIF2A Zornitza Stark Marked gene: KIF2A as ready
Callosome v0.198 KIF2A Zornitza Stark Gene: kif2a has been classified as Red List (Low Evidence).
Callosome v0.198 KIF2A Zornitza Stark Phenotypes for gene: KIF2A were changed from to Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411
Callosome v0.197 KIF2A Zornitza Stark Publications for gene: KIF2A were set to
Callosome v0.196 KIF2A Zornitza Stark Mode of inheritance for gene: KIF2A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Callosome v0.195 KIF2A Zornitza Stark Classified gene: KIF2A as Red List (low evidence)
Callosome v0.195 KIF2A Zornitza Stark Gene: kif2a has been classified as Red List (Low Evidence).
Callosome v0.194 KIF2A Zornitza Stark reviewed gene: KIF2A: Rating: RED; Mode of pathogenicity: None; Publications: 23603762, 27896282, 27747449, 29077851, 31919497; Phenotypes: Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Microcephaly v0.153 KIF2A Zornitza Stark Marked gene: KIF2A as ready
Microcephaly v0.153 KIF2A Zornitza Stark Gene: kif2a has been classified as Green List (High Evidence).
Microcephaly v0.153 KIF2A Zornitza Stark Classified gene: KIF2A as Green List (high evidence)
Microcephaly v0.153 KIF2A Zornitza Stark Gene: kif2a has been classified as Green List (High Evidence).
Microcephaly v0.152 KIF2A Zornitza Stark gene: KIF2A was added
gene: KIF2A was added to Microcephaly. Sources: Expert Review
Mode of inheritance for gene: KIF2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: KIF2A were set to 23603762; 27896282; 27747449; 29077851; 31919497
Phenotypes for gene: KIF2A were set to Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411
Review for gene: KIF2A was set to GREEN
Added comment: At least five unrelated families reported, with various malformations of cortical development including lissencephaly, agyria, posterior or frontal pachygyria, subcortical band heterotopia, and thin corpus callosum; microcephaly, intellectual disability and seizures. Microcephaly is in the range of -2SD -4.5SD, described as progressive in at least one individual. Some normocephalic but lower end of normal range. Some recurrent missense at p.Ser317 and p.His321. Functional data supports gene-disease association.
Sources: Expert Review
Genetic Epilepsy v0.813 KIF2A Zornitza Stark Marked gene: KIF2A as ready
Genetic Epilepsy v0.813 KIF2A Zornitza Stark Gene: kif2a has been classified as Green List (High Evidence).
Genetic Epilepsy v0.813 KIF2A Zornitza Stark Phenotypes for gene: KIF2A were changed from to Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411
Genetic Epilepsy v0.812 KIF2A Zornitza Stark Publications for gene: KIF2A were set to
Genetic Epilepsy v0.811 KIF2A Zornitza Stark Mode of inheritance for gene: KIF2A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.810 KIF2A Zornitza Stark reviewed gene: KIF2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 27896282, 27747449, 29077851, 31919497; Phenotypes: Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.90 KIF2A Zornitza Stark Marked gene: KIF2A as ready
Lissencephaly and Band Heterotopia v0.90 KIF2A Zornitza Stark Gene: kif2a has been classified as Green List (High Evidence).
Mendeliome v0.3979 KIF2A Zornitza Stark Marked gene: KIF2A as ready
Mendeliome v0.3979 KIF2A Zornitza Stark Gene: kif2a has been classified as Green List (High Evidence).
Mendeliome v0.3979 KIF2A Zornitza Stark Phenotypes for gene: KIF2A were changed from to Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411
Mendeliome v0.3978 KIF2A Zornitza Stark Publications for gene: KIF2A were set to
Mendeliome v0.3977 KIF2A Zornitza Stark Mode of inheritance for gene: KIF2A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3976 KIF2A Zornitza Stark reviewed gene: KIF2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 27896282, 27747449, 29077851, 31919497; Phenotypes: Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.90 KIF2A Zornitza Stark Phenotypes for gene: KIF2A were changed from to Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411
Lissencephaly and Band Heterotopia v0.89 KIF2A Zornitza Stark Publications for gene: KIF2A were set to
Lissencephaly and Band Heterotopia v0.88 KIF2A Zornitza Stark Mode of inheritance for gene: KIF2A was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.87 KIF2A Zornitza Stark reviewed gene: KIF2A: Rating: GREEN; Mode of pathogenicity: None; Publications: 23603762, 27896282, 27747449, 29077851, 31919497; Phenotypes: Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.87 DCX Zornitza Stark Marked gene: DCX as ready
Lissencephaly and Band Heterotopia v0.87 DCX Zornitza Stark Gene: dcx has been classified as Green List (High Evidence).
Limb-Girdle Muscular Dystrophy and Distal Myopathy v0.53 ISPD Zornitza Stark Marked gene: ISPD as ready
Limb-Girdle Muscular Dystrophy and Distal Myopathy v0.53 ISPD Zornitza Stark Gene: ispd has been classified as Green List (High Evidence).
Limb-Girdle Muscular Dystrophy and Distal Myopathy v0.53 ISPD Zornitza Stark Publications for gene: ISPD were set to
Limb-Girdle Muscular Dystrophy and Distal Myopathy v0.52 ISPD Zornitza Stark reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 23390185, 30060766, 28688748, 26404900; Phenotypes: Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Muscular dystrophy and myopathy_Paediatric v0.70 ISPD Zornitza Stark Marked gene: ISPD as ready
Muscular dystrophy and myopathy_Paediatric v0.70 ISPD Zornitza Stark Gene: ispd has been classified as Green List (High Evidence).
Muscular dystrophy and myopathy_Paediatric v0.70 ISPD Zornitza Stark Phenotypes for gene: ISPD were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052
Hydrocephalus_Ventriculomegaly v0.55 ISPD Zornitza Stark Phenotypes for gene: ISPD were changed from Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052 to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643
Hydrocephalus_Ventriculomegaly v0.54 ISPD Zornitza Stark Phenotypes for gene: ISPD were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052
Mendeliome v0.3976 ISPD Zornitza Stark Marked gene: ISPD as ready
Mendeliome v0.3976 ISPD Zornitza Stark Gene: ispd has been classified as Green List (High Evidence).
Mendeliome v0.3976 ISPD Zornitza Stark Phenotypes for gene: ISPD were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052
Mendeliome v0.3975 ISPD Zornitza Stark Publications for gene: ISPD were set to
Mendeliome v0.3974 ISPD Zornitza Stark Mode of inheritance for gene: ISPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Muscular dystrophy and myopathy_Paediatric v0.69 ISPD Zornitza Stark Publications for gene: ISPD were set to
Muscular dystrophy and myopathy_Paediatric v0.68 ISPD Zornitza Stark Mode of inheritance for gene: ISPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Muscular dystrophy and myopathy_Paediatric v0.67 ISPD Zornitza Stark reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 22522421, 23217329, 23390185, 30060766, 28688748, 26404900; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643, Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Muscular dystrophy and myopathy_Paediatric v0.67 Zornitza Stark Panel name changed from Muscular dystrophy to Muscular dystrophy_Paediatric
Hydrocephalus_Ventriculomegaly v0.53 ISPD Zornitza Stark Marked gene: ISPD as ready
Hydrocephalus_Ventriculomegaly v0.53 ISPD Zornitza Stark Gene: ispd has been classified as Green List (High Evidence).
Mendeliome v0.3973 ISPD Zornitza Stark reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 22522421, 23217329, 23390185, 30060766, 28688748, 26404900; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643, Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.87 ISPD Zornitza Stark edited their review of gene: ISPD: Changed publications: 22522421, 23217329
Hydrocephalus_Ventriculomegaly v0.53 ISPD Zornitza Stark Publications for gene: ISPD were set to
Hydrocephalus_Ventriculomegaly v0.52 ISPD Zornitza Stark Mode of inheritance for gene: ISPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Hydrocephalus_Ventriculomegaly v0.51 ISPD Zornitza Stark reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 22522421, 23217329; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.87 ISPD Zornitza Stark Publications for gene: ISPD were set to 22522421
Lissencephaly and Band Heterotopia v0.86 ISPD Zornitza Stark Marked gene: ISPD as ready
Lissencephaly and Band Heterotopia v0.86 ISPD Zornitza Stark Gene: ispd has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.86 ISPD Zornitza Stark Phenotypes for gene: ISPD were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643
Lissencephaly and Band Heterotopia v0.85 ISPD Zornitza Stark Publications for gene: ISPD were set to
Lissencephaly and Band Heterotopia v0.84 ISPD Zornitza Stark Mode of inheritance for gene: ISPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.83 ISPD Zornitza Stark reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 22522421; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.83 DYNC1H1 Zornitza Stark Marked gene: DYNC1H1 as ready
Lissencephaly and Band Heterotopia v0.83 DYNC1H1 Zornitza Stark Gene: dync1h1 has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.83 DYNC1H1 Zornitza Stark Phenotypes for gene: DYNC1H1 were changed from to Mental retardation, autosomal dominant 13, MIM# 614563
Lissencephaly and Band Heterotopia v0.82 DYNC1H1 Zornitza Stark Publications for gene: DYNC1H1 were set to
Lissencephaly and Band Heterotopia v0.81 DYNC1H1 Zornitza Stark Mode of inheritance for gene: DYNC1H1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.80 DYNC1H1 Zornitza Stark changed review comment from: Variable neuronal migration defects resulting in cortical malformations, including pachygyria, nodular heterotopias, and PMG.; to: Variable neuronal migration defects resulting in cortical malformations, including pachygyria, lissencephaly, nodular heterotopias, and PMG.
Lissencephaly and Band Heterotopia v0.80 DYNC1H1 Zornitza Stark edited their review of gene: DYNC1H1: Changed publications: 23603762, 29671837, 32570172, 27331017
Lissencephaly and Band Heterotopia v0.80 DYNC1H1 Zornitza Stark edited their review of gene: DYNC1H1: Changed publications: 23603762
Lissencephaly and Band Heterotopia v0.80 DYNC1H1 Zornitza Stark reviewed gene: DYNC1H1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mental retardation, autosomal dominant 13, MIM# 614563; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3973 DCX Zornitza Stark Marked gene: DCX as ready
Mendeliome v0.3973 DCX Zornitza Stark Gene: dcx has been classified as Green List (High Evidence).
Mendeliome v0.3973 DCX Zornitza Stark Phenotypes for gene: DCX were changed from to Lissencephaly, X-linked, MIM# 300067; Subcortical laminal heterotopia, X-linked 300067
Mendeliome v0.3972 DCX Zornitza Stark Publications for gene: DCX were set to
Mendeliome v0.3971 DCX Zornitza Stark Mode of inheritance for gene: DCX was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Lissencephaly and Band Heterotopia v0.80 DCX Zornitza Stark Phenotypes for gene: DCX were changed from to Lissencephaly, X-linked, MIM# 300067; Subcortical laminal heterotopia, X-linked 300067
Mendeliome v0.3970 DCX Zornitza Stark reviewed gene: DCX: Rating: GREEN; Mode of pathogenicity: None; Publications: 10915612, 9489699, 12552055; Phenotypes: Lissencephaly, X-linked, MIM# 300067, Subcortical laminal heterotopia, X-linked 300067; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Lissencephaly and Band Heterotopia v0.79 DCX Zornitza Stark Publications for gene: DCX were set to
Lissencephaly and Band Heterotopia v0.78 DCX Zornitza Stark Mode of inheritance for gene: DCX was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Lissencephaly and Band Heterotopia v0.77 DCX Zornitza Stark reviewed gene: DCX: Rating: GREEN; Mode of pathogenicity: None; Publications: 10915612, 9489699, 12552055; Phenotypes: Lissencephaly, X-linked, MIM# 300067, Subcortical laminal heterotopia, X-linked 300067; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Lissencephaly and Band Heterotopia v0.77 B3GALNT2 Zornitza Stark Marked gene: B3GALNT2 as ready
Lissencephaly and Band Heterotopia v0.77 B3GALNT2 Zornitza Stark Gene: b3galnt2 has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.77 B3GALNT2 Zornitza Stark Phenotypes for gene: B3GALNT2 were changed from to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 11, MIM# 615181
Lissencephaly and Band Heterotopia v0.76 B3GALNT2 Zornitza Stark Publications for gene: B3GALNT2 were set to
Lissencephaly and Band Heterotopia v0.75 B3GALNT2 Zornitza Stark Mode of inheritance for gene: B3GALNT2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.74 B3GALNT2 Zornitza Stark reviewed gene: B3GALNT2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23453667; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 11, MIM# 615181; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.74 ARX Zornitza Stark Marked gene: ARX as ready
Lissencephaly and Band Heterotopia v0.74 ARX Zornitza Stark Gene: arx has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.74 ARX Zornitza Stark Phenotypes for gene: ARX were changed from to Lissencephaly, X-linked 2, MIM# 300215
Lissencephaly and Band Heterotopia v0.73 ARX Zornitza Stark Publications for gene: ARX were set to
Lissencephaly and Band Heterotopia v0.72 ARX Zornitza Stark Mode of inheritance for gene: ARX was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Lissencephaly and Band Heterotopia v0.71 ARX Zornitza Stark reviewed gene: ARX: Rating: GREEN; Mode of pathogenicity: None; Publications: 14722918; Phenotypes: Lissencephaly, X-linked 2, MIM# 300215; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.2888 DPM3 Zornitza Stark edited their review of gene: DPM3: Changed phenotypes: Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 15 612937, Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 15 618992
Susceptibility to Viral Infections v0.65 TLR7 Zornitza Stark Marked gene: TLR7 as ready
Susceptibility to Viral Infections v0.65 TLR7 Zornitza Stark Gene: tlr7 has been classified as Green List (High Evidence).
Susceptibility to Viral Infections v0.65 TLR7 Zornitza Stark Classified gene: TLR7 as Green List (high evidence)
Susceptibility to Viral Infections v0.65 TLR7 Zornitza Stark Gene: tlr7 has been classified as Green List (High Evidence).
Susceptibility to Viral Infections v0.64 TLR7 Zornitza Stark gene: TLR7 was added
gene: TLR7 was added to Susceptibility to Viral Infections. Sources: Expert list
Mode of inheritance for gene: TLR7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TLR7 were set to 32706371
Phenotypes for gene: TLR7 were set to Immunodeficiency 74, COVID19-related, X-linked, MIM# 301051
Review for gene: TLR7 was set to GREEN
Added comment: Four affected individuals from two unrelated families and some functional data.
Sources: Expert list
Mendeliome v0.3970 TLR7 Zornitza Stark reviewed gene: TLR7: Rating: GREEN; Mode of pathogenicity: None; Publications: 32706371; Phenotypes: Immunodeficiency 74, COVID19-related, X-linked, MIM# 301051; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Palmoplantar Keratoderma and Erythrokeratoderma v0.94 ASPRV1 Zornitza Stark Phenotypes for gene: ASPRV1 were changed from palmoplantar keratoderma; lamellar ichthyosis to Ichthyosis, lamellar, autosomal dominant, MIM# 146750; palmoplantar keratoderma; lamellar ichthyosis
Palmoplantar Keratoderma and Erythrokeratoderma v0.93 ASPRV1 Zornitza Stark reviewed gene: ASPRV1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ichthyosis, lamellar, autosomal dominant, MIM# 146750; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3970 ASPRV1 Zornitza Stark Phenotypes for gene: ASPRV1 were changed from palmoplantar keratoderma; lamellar ichthyosis to Ichthyosis, lamellar, autosomal dominant, MIM# 146750; palmoplantar keratoderma; lamellar ichthyosis
Mendeliome v0.3969 ASPRV1 Zornitza Stark reviewed gene: ASPRV1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ichthyosis, lamellar, autosomal dominant, MIM# 146750; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Ichthyosis v0.97 ASPRV1 Zornitza Stark Phenotypes for gene: ASPRV1 were changed from palmoplantar keratoderma; lamellar ichthyosis to Ichthyosis, lamellar, autosomal dominant, MIM# 146750; palmoplantar keratoderma; lamellar ichthyosis
Ichthyosis v0.96 ASPRV1 Zornitza Stark edited their review of gene: ASPRV1: Changed rating: GREEN; Changed phenotypes: Ichthyosis, lamellar, autosomal dominant, MIM# 146750; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Ichthyosis v0.96 ASPRV1 Zornitza Stark reviewed gene: ASPRV1: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Ichthyosis, lamellar, autosomal dominant, M 146750; Mode of inheritance: None
Cardiomyopathy_Paediatric v0.7 MRPL44 Zornitza Stark Marked gene: MRPL44 as ready
Cardiomyopathy_Paediatric v0.7 MRPL44 Zornitza Stark Gene: mrpl44 has been classified as Green List (High Evidence).
Cardiomyopathy_Paediatric v0.7 MRPL44 Zornitza Stark Phenotypes for gene: MRPL44 were changed from Combined oxidative phosphorylation deficiency 16, 615395; Multiple respiratory chain complex deficiencies (disorders of protein synthesis) to Combined oxidative phosphorylation deficiency 16, 615395
Cardiomyopathy_Paediatric v0.6 MRPL44 Zornitza Stark Phenotypes for gene: MRPL44 were changed from ?Combined oxidative phosphorylation deficiency 16, 615395; Multiple respiratory chain complex deficiencies (disorders of protein synthesis) to Combined oxidative phosphorylation deficiency 16, 615395; Multiple respiratory chain complex deficiencies (disorders of protein synthesis)
Cardiomyopathy_Paediatric v0.5 MRPL44 Zornitza Stark Publications for gene: MRPL44 were set to
Cardiomyopathy_Paediatric v0.4 MRPL44 Zornitza Stark reviewed gene: MRPL44: Rating: GREEN; Mode of pathogenicity: None; Publications: 23315540, 25797485; Phenotypes: Combined oxidative phosphorylation deficiency 16, MIM# 615395; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3969 MRPL44 Zornitza Stark Marked gene: MRPL44 as ready
Mendeliome v0.3969 MRPL44 Zornitza Stark Gene: mrpl44 has been classified as Green List (High Evidence).
Mendeliome v0.3969 MRPL44 Zornitza Stark Phenotypes for gene: MRPL44 were changed from to Combined oxidative phosphorylation deficiency 16, MIM# 615395
Mendeliome v0.3968 MRPL44 Zornitza Stark Publications for gene: MRPL44 were set to
Mendeliome v0.3967 MRPL44 Zornitza Stark Mode of inheritance for gene: MRPL44 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3966 MRPL44 Zornitza Stark reviewed gene: MRPL44: Rating: GREEN; Mode of pathogenicity: None; Publications: 23315540, 25797485; Phenotypes: Combined oxidative phosphorylation deficiency 16, MIM# 615395; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mitochondrial disease v0.468 MRPL44 Zornitza Stark Marked gene: MRPL44 as ready
Mitochondrial disease v0.468 MRPL44 Zornitza Stark Gene: mrpl44 has been classified as Green List (High Evidence).
Mitochondrial disease v0.468 MRPL44 Zornitza Stark Phenotypes for gene: MRPL44 were changed from to Combined oxidative phosphorylation deficiency 16, MIM# 615395
Mitochondrial disease v0.467 MRPL44 Zornitza Stark Publications for gene: MRPL44 were set to
Mitochondrial disease v0.466 MRPL44 Zornitza Stark Mode of inheritance for gene: MRPL44 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mitochondrial disease v0.465 MRPL44 Zornitza Stark edited their review of gene: MRPL44: Changed rating: GREEN
Mitochondrial disease v0.465 MRPL44 Zornitza Stark reviewed gene: MRPL44: Rating: ; Mode of pathogenicity: None; Publications: 23315540, 25797485; Phenotypes: Combined oxidative phosphorylation deficiency 16, MIM# 615395; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.32 FANCL Bryony Thompson Marked gene: FANCL as ready
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.32 FANCL Bryony Thompson Gene: fancl has been classified as Red List (Low Evidence).
Primary Ovarian Insufficiency_Premature Ovarian Failure v0.32 FANCL Bryony Thompson gene: FANCL was added
gene: FANCL was added to Amenorrhoea. Sources: Literature
Mode of inheritance for gene: FANCL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: FANCL were set to 32048394; 32851770; 11823446
Phenotypes for gene: FANCL were set to Primary ovarian insufficiency
Review for gene: FANCL was set to AMBER
Added comment: 2 independent cases reported with heterozygous loss of function variants and primary ovarian insufficiency. However, there is no reported evidence of POI in female carriers of FANCL pathogenic variants for fanconi anemia. Null mouse model is less fertile and has defective proliferation of germ cells.
Sources: Literature
Ataxia - adult onset v0.103 LMNB1 Bryony Thompson changed review comment from: Four unrelated families reported with adult onset cerebellar ataxia as a feature of the condition.
Sources: Expert list; to: Four unrelated families reported with adult onset cerebellar ataxia as a feature of the condition. CNV is the only reported cause of the condition.
Sources: Expert list
Ataxia - adult onset v0.103 LMNB1 Bryony Thompson Tag SV/CNV tag was added to gene: LMNB1.
Early-onset Dementia v0.72 PRNP Bryony Thompson Classified STR: PRNP as Green List (high evidence)
Early-onset Dementia v0.72 PRNP Bryony Thompson Str: prnp has been classified as Green List (High Evidence).
Early-onset Dementia v0.71 PRNP Bryony Thompson STR: PRNP was added
STR: PRNP was added to Early-onset Dementia. Sources: Expert list
STR tags were added to STR: PRNP.
Mode of inheritance for STR: PRNP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: PRNP were set to 20301407
Phenotypes for STR: PRNP were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440
Review for STR: PRNP was set to GREEN
STR: PRNP was marked as clinically relevant
Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X]
Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat.
Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype.
Sources: Expert list
Ataxia - adult onset v0.103 SCA31 Bryony Thompson Classified STR: SCA31 as Green List (high evidence)
Ataxia - adult onset v0.103 SCA31 Bryony Thompson Str: sca31 has been classified as Green List (High Evidence).
Ataxia - adult onset v0.102 SCA31 Bryony Thompson STR: SCA31 was added
STR: SCA31 was added to Ataxia - adult onset. Sources: Literature
STR tags were added to STR: SCA31.
Mode of inheritance for STR: SCA31 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA31 were set to 19878914; 31755042
Phenotypes for STR: SCA31 were set to Spinocerebellar ataxia 31 MIM#117210
Review for STR: SCA31 was set to GREEN
Added comment: Complex repeat insertion (TGGAA)n, (TAGAA)n, (TAAAA)n, (TAAAATAGAA)n, TGGAA is present only in affected cases. Sequencing showed that the insertion consisted of a preceding TCAC sequence, and 3 pentanucleotide repeat components (TGGAA)n, (TAGAA)n, and (TAAAA)n in all patients tested.
2.5-3.8 KB insertion is associated with disease and RNA toxicity expected to be mechanism of disease
Normal and pathogenic cut-offs are based on animal model experiments (PMID: 31755042)
Sources: Literature
Mendeliome v0.3966 KBTBD13 Zornitza Stark Marked gene: KBTBD13 as ready
Mendeliome v0.3966 KBTBD13 Zornitza Stark Gene: kbtbd13 has been classified as Green List (High Evidence).
Mendeliome v0.3966 KBTBD13 Zornitza Stark Phenotypes for gene: KBTBD13 were changed from to Nemaline myopathy 6, autosomal dominant, MIM# 609273; Hereditary motor neuropathy; late-onset limb girdle muscular dystrophy
Mendeliome v0.3965 KBTBD13 Zornitza Stark Publications for gene: KBTBD13 were set to
Mendeliome v0.3964 KBTBD13 Zornitza Stark Mode of inheritance for gene: KBTBD13 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.3963 KBTBD13 Zornitza Stark edited their review of gene: KBTBD13: Changed rating: GREEN
Mendeliome v0.3963 KBTBD13 Zornitza Stark reviewed gene: KBTBD13: Rating: ; Mode of pathogenicity: None; Publications: 11731279, 21104864; Phenotypes: Nemaline myopathy 6, autosomal dominant, MIM# 609273, Hereditary motor neuropathy, late-onset limb girdle muscular dystrophy; Mode of inheritance: None
Mitochondrial disease v0.465 NDUFA13 Zornitza Stark Publications for gene: NDUFA13 were set to 25901006
Mendeliome v0.3963 NDUFA13 Zornitza Stark Publications for gene: NDUFA13 were set to 25901006
Mendeliome v0.3962 NDUFA13 Zornitza Stark Classified gene: NDUFA13 as Amber List (moderate evidence)
Mendeliome v0.3962 NDUFA13 Zornitza Stark Gene: ndufa13 has been classified as Amber List (Moderate Evidence).
Mendeliome v0.3961 NDUFA13 Zornitza Stark edited their review of gene: NDUFA13: Added comment: Second family reported with some supportive functional data.; Changed rating: AMBER; Changed publications: 25901006, 32722639
Mitochondrial disease v0.464 NDUFA13 Zornitza Stark Classified gene: NDUFA13 as Amber List (moderate evidence)
Mitochondrial disease v0.464 NDUFA13 Zornitza Stark Gene: ndufa13 has been classified as Amber List (Moderate Evidence).
Mitochondrial disease v0.463 NDUFA13 Zornitza Stark edited their review of gene: NDUFA13: Added comment: Second family reported with some supportive functional data.; Changed rating: AMBER; Changed publications: 25901006, 32722639
Mendeliome v0.3961 KBTBD13 Elena Savva reviewed gene: KBTBD13: Rating: GREEN; Mode of pathogenicity: Other; Publications: PMID: 28403181, 31167812, 31671076, 30208948; Phenotypes: Nemaline myopathy 6, autosomal dominant, 609273, Hereditary motor neuropathy, late-onset limb girdle muscular dystrophy; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Ataxia - adult onset v0.101 SCA37 Bryony Thompson Classified STR: SCA37 as Green List (high evidence)
Ataxia - adult onset v0.101 SCA37 Bryony Thompson Str: sca37 has been classified as Green List (High Evidence).
Ataxia - adult onset v0.100 SCA37 Bryony Thompson STR: SCA37 was added
STR: SCA37 was added to Ataxia - adult onset. Sources: Literature
STR tags were added to STR: SCA37.
Mode of inheritance for STR: SCA37 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA37 were set to 28686858; 31145571
Phenotypes for STR: SCA37 were set to Spinocerebellar ataxia 37 MIM#615945
Review for STR: SCA37 was set to GREEN
STR: SCA37 was marked as clinically relevant
Added comment: NC_000001.10:g.57832716_57832797ins[(ATTTT)60-79(ATTTC)31-75(ATTTT)58-90]
Located in a 5'UTR intron, flanked by (ATTTT)n on both sides
Non-pathogenic allele: (ATTTT)7–400
Pathogenic allele: [(ATTTT)60–79(ATTTC)31–75(ATTTT)58–90]
Sources: Literature
Ataxia - adult onset v0.99 CANVAS Bryony Thompson Classified STR: CANVAS as Green List (high evidence)
Ataxia - adult onset v0.99 CANVAS Bryony Thompson Str: canvas has been classified as Green List (High Evidence).
Ataxia - adult onset v0.98 CANVAS Bryony Thompson STR: CANVAS was added
STR: CANVAS was added to Ataxia - adult onset. Sources: Expert list
STR tags were added to STR: CANVAS.
Mode of inheritance for STR: CANVAS was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: CANVAS were set to 30926972
Phenotypes for STR: CANVAS were set to Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575
Review for STR: CANVAS was set to GREEN
STR: CANVAS was marked as clinically relevant
Added comment: Simple tandem repeat (AAAAG)11 replaced with (AAGGG)n in intron 2 of RFC1. Loss of function is not the mechanism of disease.
Sources: Expert list
Early-onset Dementia v0.70 C9orf72 Bryony Thompson Classified STR: C9orf72 as Green List (high evidence)
Early-onset Dementia v0.70 C9orf72 Bryony Thompson Str: c9orf72 has been classified as Green List (High Evidence).
Early-onset Dementia v0.69 C9orf72 Bryony Thompson STR: C9orf72 was added
STR: C9orf72 was added to Early-onset Dementia. Sources: Expert list
STR tags were added to STR: C9orf72.
Mode of inheritance for STR: C9orf72 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: C9orf72 were set to 25577942
Phenotypes for STR: C9orf72 were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550
Review for STR: C9orf72 was set to GREEN
STR: C9orf72 was marked as clinically relevant
Added comment: NG_031977​.1:g.5321GGGGCC[X]
Repeat expansion affects the protein degradation pathways and may contribute to TDP‐43 accumulation
Normal alleles: ≤25 G4C2 hexanucleotide repeat units generally considered normal
Pathogenic high-penetrance alleles: ≥60 G4C2 hexanucleotide repeat units are considered pathogenic
Note: The minimal size of a G4C2 pathogenic repeat is under debate: some studies consider repeats of >30 G4C2 hexanucleotide repeat units as pathogenic, whereas others use a cutoff of 60 G4C2 hexanucleotide repeat units.
Sources: Expert list
Arthrogryposis v0.207 LAMA2 Zornitza Stark Marked gene: LAMA2 as ready
Arthrogryposis v0.207 LAMA2 Zornitza Stark Gene: lama2 has been classified as Green List (High Evidence).
Arthrogryposis v0.207 LAMA2 Zornitza Stark Phenotypes for gene: LAMA2 were changed from to Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855; Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138
Arthrogryposis v0.206 LAMA2 Zornitza Stark Publications for gene: LAMA2 were set to
Arthrogryposis v0.205 LAMA2 Zornitza Stark Mode of inheritance for gene: LAMA2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Arthrogryposis v0.204 LAMA2 Zornitza Stark reviewed gene: LAMA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30055037; Phenotypes: Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855, Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Muscular dystrophy and myopathy_Paediatric v0.66 LAMA2 Zornitza Stark Marked gene: LAMA2 as ready
Muscular dystrophy and myopathy_Paediatric v0.66 LAMA2 Zornitza Stark Gene: lama2 has been classified as Green List (High Evidence).
Muscular dystrophy and myopathy_Paediatric v0.66 LAMA2 Zornitza Stark Phenotypes for gene: LAMA2 were changed from to Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855; Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138
Muscular dystrophy and myopathy_Paediatric v0.65 LAMA2 Zornitza Stark Publications for gene: LAMA2 were set to
Muscular dystrophy and myopathy_Paediatric v0.64 LAMA2 Zornitza Stark Mode of inheritance for gene: LAMA2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Muscular dystrophy and myopathy_Paediatric v0.63 LAMA2 Zornitza Stark reviewed gene: LAMA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30055037; Phenotypes: Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855, Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3961 LAMA2 Zornitza Stark Marked gene: LAMA2 as ready
Mendeliome v0.3961 LAMA2 Zornitza Stark Gene: lama2 has been classified as Green List (High Evidence).
Mendeliome v0.3961 LAMA2 Zornitza Stark Phenotypes for gene: LAMA2 were changed from to Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855; Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138
Mendeliome v0.3960 LAMA2 Zornitza Stark Publications for gene: LAMA2 were set to
Mendeliome v0.3959 LAMA2 Zornitza Stark Mode of inheritance for gene: LAMA2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3958 LAMA2 Zornitza Stark reviewed gene: LAMA2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30055037; Phenotypes: Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855, Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.71 LAMA2 Zornitza Stark Phenotypes for gene: LAMA2 were changed from LAMA2-related muscular dystrophy to LAMA2-related muscular dystrophy; Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855
Lissencephaly and Band Heterotopia v0.70 LAMA2 Zornitza Stark reviewed gene: LAMA2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Autism v0.107 GRIN2B Zornitza Stark Marked gene: GRIN2B as ready
Autism v0.107 GRIN2B Zornitza Stark Gene: grin2b has been classified as Green List (High Evidence).
Autism v0.107 GRIN2B Zornitza Stark Phenotypes for gene: GRIN2B were changed from to Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139
Autism v0.106 GRIN2B Zornitza Stark Publications for gene: GRIN2B were set to
Autism v0.105 GRIN2B Zornitza Stark Mode of inheritance for gene: GRIN2B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Autism v0.104 GRIN2B Zornitza Stark reviewed gene: GRIN2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28377535; Phenotypes: Mental retardation, autosomal dominant 6, MIM# 613970, Epileptic encephalopathy, early infantile, 27, MIM# 616139; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.810 GRIN2B Zornitza Stark Marked gene: GRIN2B as ready
Genetic Epilepsy v0.810 GRIN2B Zornitza Stark Gene: grin2b has been classified as Green List (High Evidence).
Genetic Epilepsy v0.810 GRIN2B Zornitza Stark Phenotypes for gene: GRIN2B were changed from to Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139
Genetic Epilepsy v0.809 GRIN2B Zornitza Stark Publications for gene: GRIN2B were set to
Genetic Epilepsy v0.808 GRIN2B Zornitza Stark Mode of inheritance for gene: GRIN2B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.807 GRIN2B Zornitza Stark reviewed gene: GRIN2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28377535; Phenotypes: Mental retardation, autosomal dominant 6, MIM# 613970, Epileptic encephalopathy, early infantile, 27, MIM# 616139; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3958 GRIN2B Zornitza Stark Marked gene: GRIN2B as ready
Mendeliome v0.3958 GRIN2B Zornitza Stark Gene: grin2b has been classified as Green List (High Evidence).
Mendeliome v0.3958 GRIN2B Zornitza Stark Phenotypes for gene: GRIN2B were changed from to Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139
Mendeliome v0.3957 GRIN2B Zornitza Stark Publications for gene: GRIN2B were set to
Mendeliome v0.3956 GRIN2B Zornitza Stark Mode of inheritance for gene: GRIN2B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3955 GRIN2B Zornitza Stark reviewed gene: GRIN2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28377535; Phenotypes: Mental retardation, autosomal dominant 6, MIM# 613970, Epileptic encephalopathy, early infantile, 27, MIM# 616139; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2888 GRIN2B Zornitza Stark Marked gene: GRIN2B as ready
Intellectual disability syndromic and non-syndromic v0.2888 GRIN2B Zornitza Stark Gene: grin2b has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2888 GRIN2B Zornitza Stark Phenotypes for gene: GRIN2B were changed from Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139 to Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139
Intellectual disability syndromic and non-syndromic v0.2888 GRIN2B Zornitza Stark Phenotypes for gene: GRIN2B were changed from to Mental retardation, autosomal dominant 6, MIM# 613970; Epileptic encephalopathy, early infantile, 27, MIM# 616139
Intellectual disability syndromic and non-syndromic v0.2887 GRIN2B Zornitza Stark Publications for gene: GRIN2B were set to
Intellectual disability syndromic and non-syndromic v0.2886 GRIN2B Zornitza Stark Mode of inheritance for gene: GRIN2B was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2885 GRIN2B Zornitza Stark reviewed gene: GRIN2B: Rating: GREEN; Mode of pathogenicity: None; Publications: 28377535; Phenotypes: Mental retardation, autosomal dominant 6, MIM# 613970, Epileptic encephalopathy, early infantile, 27, MIM# 616139; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Polymicrogyria and Schizencephaly v0.139 GRIN2B Zornitza Stark Phenotypes for gene: GRIN2B were changed from GRIN2B-related neurodevelopmental disorder to GRIN2B-related neurodevelopmental disorder; Mental retardation, autosomal dominant 6, MIM# 613970
Polymicrogyria and Schizencephaly v0.138 GRIN2B Zornitza Stark reviewed gene: GRIN2B: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mental retardation, autosomal dominant 6, MIM# 613970; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Dystonia - complex v0.72 GRIN1 Zornitza Stark Marked gene: GRIN1 as ready
Dystonia - complex v0.72 GRIN1 Zornitza Stark Gene: grin1 has been classified as Green List (High Evidence).
Dystonia - complex v0.72 GRIN1 Zornitza Stark Classified gene: GRIN1 as Green List (high evidence)
Dystonia - complex v0.72 GRIN1 Zornitza Stark Gene: grin1 has been classified as Green List (High Evidence).
Dystonia - complex v0.71 GRIN1 Zornitza Stark gene: GRIN1 was added
gene: GRIN1 was added to Dystonia - complex. Sources: Expert list
Mode of inheritance for gene: GRIN1 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Publications for gene: GRIN1 were set to 29365063; 27164704; 27164704; 28051072
Phenotypes for gene: GRIN1 were set to Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254; Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820
Review for gene: GRIN1 was set to GREEN
Added comment: Over 20 individuals reported with de novo missense variants in GRIN1 and severe neurodevelopmental phenotype, comprising ID, seizures, and a movement disorder, in particular dystonia. Two families reported with bi-allelic variants: different mechanism postulated (LOF vs affecting channel functioning or hypomorphic alleles), parents were carriers and unaffected. Movement disorder, in particular dystonia also reported in bi-allelic cases.
Sources: Expert list
Mendeliome v0.3955 GRIN1 Zornitza Stark Marked gene: GRIN1 as ready
Mendeliome v0.3955 GRIN1 Zornitza Stark Gene: grin1 has been classified as Green List (High Evidence).
Mendeliome v0.3955 GRIN1 Zornitza Stark Phenotypes for gene: GRIN1 were changed from to Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254; Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820
Mendeliome v0.3954 GRIN1 Zornitza Stark Publications for gene: GRIN1 were set to
Mendeliome v0.3953 GRIN1 Zornitza Stark Mode of inheritance for gene: GRIN1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.3952 GRIN1 Zornitza Stark reviewed gene: GRIN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 29365063, 27164704, 27164704, 28051072; Phenotypes: Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254, Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Genetic Epilepsy v0.807 GRIN1 Zornitza Stark Marked gene: GRIN1 as ready
Genetic Epilepsy v0.807 GRIN1 Zornitza Stark Gene: grin1 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.807 GRIN1 Zornitza Stark Phenotypes for gene: GRIN1 were changed from to Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254
Genetic Epilepsy v0.806 GRIN1 Zornitza Stark Publications for gene: GRIN1 were set to
Genetic Epilepsy v0.805 GRIN1 Zornitza Stark Mode of inheritance for gene: GRIN1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.804 GRIN1 Zornitza Stark reviewed gene: GRIN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 29365063, 27164704; Phenotypes: Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Intellectual disability syndromic and non-syndromic v0.2885 GRIN1 Zornitza Stark Marked gene: GRIN1 as ready
Intellectual disability syndromic and non-syndromic v0.2885 GRIN1 Zornitza Stark Gene: grin1 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2885 GRIN1 Zornitza Stark Phenotypes for gene: GRIN1 were changed from to Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254; Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820
Intellectual disability syndromic and non-syndromic v0.2884 GRIN1 Zornitza Stark Publications for gene: GRIN1 were set to
Intellectual disability syndromic and non-syndromic v0.2883 GRIN1 Zornitza Stark Mode of inheritance for gene: GRIN1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2882 GRIN1 Zornitza Stark reviewed gene: GRIN1: Rating: GREEN; Mode of pathogenicity: None; Publications: 29365063, 27164704, 27164704, 28051072; Phenotypes: Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254, Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Polymicrogyria and Schizencephaly v0.138 GRIN1 Zornitza Stark Marked gene: GRIN1 as ready
Polymicrogyria and Schizencephaly v0.138 GRIN1 Zornitza Stark Added comment: Comment when marking as ready: All variants occurred between residues 559 and 828, and there may be an association between variant location and PMG.
Polymicrogyria and Schizencephaly v0.138 GRIN1 Zornitza Stark Gene: grin1 has been classified as Green List (High Evidence).
Polymicrogyria and Schizencephaly v0.138 GRIN1 Zornitza Stark Phenotypes for gene: GRIN1 were changed from GRIN1-related neurodevelopmental disorder to Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254
Intellectual disability syndromic and non-syndromic v0.2882 HARS Zornitza Stark Publications for gene: HARS were set to 32296180
Intellectual disability syndromic and non-syndromic v0.2881 HARS Zornitza Stark commented on gene: HARS: Please note this is the correct PMID for this disease association
Intellectual disability syndromic and non-syndromic v0.2881 HARS Zornitza Stark reviewed gene: HARS: Rating: AMBER; Mode of pathogenicity: None; Publications: 32333447; Phenotypes: multisystem ataxic syndrome, mild-severe intellectual disability; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Ataxia - paediatric v0.222 HARS Zornitza Stark Publications for gene: HARS were set to 32296180
Ataxia - paediatric v0.221 HARS Zornitza Stark reviewed gene: HARS: Rating: AMBER; Mode of pathogenicity: None; Publications: 32333447; Phenotypes: multisystem ataxic syndrome; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Additional findings_Paediatric v0.2 ZNF674 Zornitza Stark gene: ZNF674 was added
gene: ZNF674 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ZNF674 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: ZNF674 were set to Mental retardation
Additional findings_Paediatric v0.2 ZNF252P Zornitza Stark gene: ZNF252P was added
gene: ZNF252P was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ZNF252P was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ZNF252P were set to Hypothyroidism
Additional findings_Paediatric v0.2 ZFPM2 Zornitza Stark gene: ZFPM2 was added
gene: ZFPM2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ZFPM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ZFPM2 were set to Tetralogy of Fallot
Additional findings_Paediatric v0.2 YARS2 Zornitza Stark gene: YARS2 was added
gene: YARS2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: YARS2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: YARS2 were set to Myopathy, lactic acidosis, and sideroblastic anemia
Additional findings_Paediatric v0.2 WRAP53 Zornitza Stark gene: WRAP53 was added
gene: WRAP53 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: WRAP53 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WRAP53 were set to Dyskeratosis congenita
Additional findings_Paediatric v0.2 WNT7A Zornitza Stark gene: WNT7A was added
gene: WNT7A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: WNT7A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WNT7A were set to Ulna and fibula absence of with severe limb deficiency
Additional findings_Paediatric v0.2 WNT5A Zornitza Stark gene: WNT5A was added
gene: WNT5A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: WNT5A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: WNT5A were set to Robinow syndrome
Additional findings_Paediatric v0.2 WNT3 Zornitza Stark gene: WNT3 was added
gene: WNT3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: WNT3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WNT3 were set to Tetra-amelia, autosomal recessive
Additional findings_Paediatric v0.2 WNK1 Zornitza Stark gene: WNK1 was added
gene: WNK1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: WNK1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WNK1 were set to Neuropathy, hereditary sensory and autonomic, type I
Additional findings_Paediatric v0.2 WDR36 Zornitza Stark gene: WDR36 was added
gene: WDR36 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: WDR36 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: WDR36 were set to Glaucoma
Additional findings_Paediatric v0.2 WDR35 Zornitza Stark gene: WDR35 was added
gene: WDR35 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: WDR35 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WDR35 were set to Cranioectodermal dysplasia
Additional findings_Paediatric v0.2 WDR19 Zornitza Stark gene: WDR19 was added
gene: WDR19 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: WDR19 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WDR19 were set to Nephronophthisis
Additional findings_Paediatric v0.2 VSX1 Zornitza Stark gene: VSX1 was added
gene: VSX1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: VSX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: VSX1 were set to Keratoconus
Additional findings_Paediatric v0.2 VPS53 Zornitza Stark gene: VPS53 was added
gene: VPS53 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: VPS53 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: VPS53 were set to Progressive cerebello-cerebral atrophy
Additional findings_Paediatric v0.2 VAMP1 Zornitza Stark gene: VAMP1 was added
gene: VAMP1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: VAMP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: VAMP1 were set to Spastic ataxia
Additional findings_Paediatric v0.2 UQCRQ Zornitza Stark gene: UQCRQ was added
gene: UQCRQ was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: UQCRQ was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: UQCRQ were set to Mitochondrial complex III deficiency
Additional findings_Paediatric v0.2 UQCRB Zornitza Stark gene: UQCRB was added
gene: UQCRB was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: UQCRB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: UQCRB were set to Mitochondrial complex III deficiency
Additional findings_Paediatric v0.2 UGT1A5 Zornitza Stark gene: UGT1A5 was added
gene: UGT1A5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: UGT1A5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: UGT1A5 were set to UDP glucuronosyltransferase deficiency
Additional findings_Paediatric v0.2 UGT1A4 Zornitza Stark gene: UGT1A4 was added
gene: UGT1A4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: UGT1A4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: UGT1A4 were set to Crigler-Najjar syndrome
Additional findings_Paediatric v0.2 UCP2 Zornitza Stark gene: UCP2 was added
gene: UCP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: UCP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: UCP2 were set to Hyperinsulinism
Additional findings_Paediatric v0.2 UBA1 Zornitza Stark gene: UBA1 was added
gene: UBA1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: UBA1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: UBA1 were set to Spinal muscular atrophy, X-linked infantile
Additional findings_Paediatric v0.2 TUBA8 Zornitza Stark gene: TUBA8 was added
gene: TUBA8 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TUBA8 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TUBA8 were set to Polymicrogyria with optic nerve hypoplasia
Additional findings_Paediatric v0.2 TTC21B Zornitza Stark gene: TTC21B was added
gene: TTC21B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TTC21B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TTC21B were set to Bardet-Biedl syndrome
Additional findings_Paediatric v0.2 TSPYL1 Zornitza Stark gene: TSPYL1 was added
gene: TSPYL1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TSPYL1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TSPYL1 were set to Sudden infant death with dysgenesis of the testes syndrome
Additional findings_Paediatric v0.2 TSPEAR Zornitza Stark gene: TSPEAR was added
gene: TSPEAR was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TSPEAR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TSPEAR were set to Sensorineural deafness
Additional findings_Paediatric v0.2 TSFM Zornitza Stark gene: TSFM was added
gene: TSFM was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TSFM was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TSFM were set to Combined oxidative phosphorylation deficiency
Additional findings_Paediatric v0.2 TRPM2 Zornitza Stark gene: TRPM2 was added
gene: TRPM2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TRPM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TRPM2 were set to ALS and Parkinson's disease
Additional findings_Paediatric v0.2 TRIP11 Zornitza Stark gene: TRIP11 was added
gene: TRIP11 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TRIP11 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TRIP11 were set to Achondrogenesis type 1A
Additional findings_Paediatric v0.2 TRHR Zornitza Stark gene: TRHR was added
gene: TRHR was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TRHR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TRHR were set to Thyrotropin-releasing hormone resistance, generalized
Additional findings_Paediatric v0.2 TRH Zornitza Stark gene: TRH was added
gene: TRH was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TRH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TRH were set to Thyrotropin-releasing hormone deficiency
Additional findings_Paediatric v0.2 TRDN Zornitza Stark gene: TRDN was added
gene: TRDN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TRDN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TRDN were set to Catecholaminergic polymorphic ventricular tachycardia
Additional findings_Paediatric v0.2 TPRN Zornitza Stark gene: TPRN was added
gene: TPRN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TPRN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TPRN were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 TNXB Zornitza Stark gene: TNXB was added
gene: TNXB was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TNXB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TNXB were set to Ehlers-Danlos syndrome due to tenascin X deficiency
Additional findings_Paediatric v0.2 TMPO Zornitza Stark gene: TMPO was added
gene: TMPO was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TMPO was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TMPO were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 TMEM237 Zornitza Stark gene: TMEM237 was added
gene: TMEM237 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TMEM237 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TMEM237 were set to Joubert syndrome
Additional findings_Paediatric v0.2 TMEM216 Zornitza Stark Added phenotypes Meckel syndrome for gene: TMEM216
Additional findings_Paediatric v0.2 TMEM216 Zornitza Stark gene: TMEM216 was added
gene: TMEM216 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TMEM216 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TMEM216 were set to Joubert syndrome
Additional findings_Paediatric v0.2 TMC8 Zornitza Stark gene: TMC8 was added
gene: TMC8 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TMC8 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TMC8 were set to Epidermodysplasia verruciformi
Additional findings_Paediatric v0.2 TJP2 Zornitza Stark gene: TJP2 was added
gene: TJP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TJP2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TJP2 were set to Hypercholanemia, familial
Additional findings_Paediatric v0.2 THBS1 Zornitza Stark gene: THBS1 was added
gene: THBS1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: THBS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: THBS1 were set to Pulmonary hypertension
Additional findings_Paediatric v0.2 THBD Zornitza Stark gene: THBD was added
gene: THBD was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: THBD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: THBD were set to Haemolytic uraemic syndrome
Additional findings_Paediatric v0.2 TGIF1 Zornitza Stark gene: TGIF1 was added
gene: TGIF1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TGIF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TGIF1 were set to Holoprosencephaly-4
Additional findings_Paediatric v0.2 TGFBR3 Zornitza Stark gene: TGFBR3 was added
gene: TGFBR3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TGFBR3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TGFBR3 were set to Premature ovarian failure
Additional findings_Paediatric v0.2 TGFB3 Zornitza Stark gene: TGFB3 was added
gene: TGFB3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TGFB3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TGFB3 were set to Arrhythmogenic right ventricular dysplasia
Additional findings_Paediatric v0.2 TGFB1 Zornitza Stark gene: TGFB1 was added
gene: TGFB1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TGFB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TGFB1 were set to Camurati-Engelmann disease
Additional findings_Paediatric v0.2 TFR2 Zornitza Stark gene: TFR2 was added
gene: TFR2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TFR2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TFR2 were set to Hemochromatosis type 3
Additional findings_Paediatric v0.2 TCTN3 Zornitza Stark gene: TCTN3 was added
gene: TCTN3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TCTN3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TCTN3 were set to Joubert syndrome
Additional findings_Paediatric v0.2 TCTN1 Zornitza Stark gene: TCTN1 was added
gene: TCTN1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TCTN1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TCTN1 were set to Joubert syndrome
Additional findings_Paediatric v0.2 TCAP Zornitza Stark Source BabySeq Category C gene was added to TCAP.
Source Expert Review Red was added to TCAP.
Added phenotypes Cardiomyopathy, dilated for gene: TCAP
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 TBX20 Zornitza Stark gene: TBX20 was added
gene: TBX20 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TBX20 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TBX20 were set to Congenital heart disease
Additional findings_Paediatric v0.2 TBCE Zornitza Stark gene: TBCE was added
gene: TBCE was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TBCE was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TBCE were set to Hypoparathyroidism retardation dysmorphism syndrome
Additional findings_Paediatric v0.2 TARDBP Zornitza Stark gene: TARDBP was added
gene: TARDBP was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TARDBP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TARDBP were set to Amyotrophic lateral sclerosis type 10
Additional findings_Paediatric v0.2 TAB2 Zornitza Stark gene: TAB2 was added
gene: TAB2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: TAB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TAB2 were set to Congenital heart disease, nonsyndromic
Additional findings_Paediatric v0.2 SYT14 Zornitza Stark gene: SYT14 was added
gene: SYT14 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SYT14 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SYT14 were set to Spinocerebellar ataxia, autosomal recessive 11
Additional findings_Paediatric v0.2 SYNE4 Zornitza Stark gene: SYNE4 was added
gene: SYNE4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SYNE4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SYNE4 were set to Hearing loss
Additional findings_Paediatric v0.2 STAC3 Zornitza Stark gene: STAC3 was added
gene: STAC3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: STAC3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: STAC3 were set to Myopathy, Native American
Additional findings_Paediatric v0.2 ST3GAL5 Zornitza Stark gene: ST3GAL5 was added
gene: ST3GAL5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ST3GAL5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ST3GAL5 were set to Amish infantile epilepsy syndrome
Additional findings_Paediatric v0.2 ST14 Zornitza Stark gene: ST14 was added
gene: ST14 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ST14 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ST14 were set to Ichthyosis hypotrichosis syndrome
Additional findings_Paediatric v0.2 SPTLC2 Zornitza Stark gene: SPTLC2 was added
gene: SPTLC2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SPTLC2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SPTLC2 were set to Neuropathy, hereditary sensory and autonomic, type IC
Additional findings_Paediatric v0.2 SPEG Zornitza Stark gene: SPEG was added
gene: SPEG was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SPEG was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SPEG were set to Centronuclear myopathy with dilated cardiomyopathy
Additional findings_Paediatric v0.2 SP7 Zornitza Stark gene: SP7 was added
gene: SP7 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SP7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SP7 were set to Osteogenesis imperfecta, type XII
Additional findings_Paediatric v0.2 SOX18 Zornitza Stark gene: SOX18 was added
gene: SOX18 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SOX18 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SOX18 were set to Hypotrichosis-lymphedema-telangiectasia syndrome
Additional findings_Paediatric v0.2 SOD1 Zornitza Stark gene: SOD1 was added
gene: SOD1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SOD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SOD1 were set to Amyotrophic lateral sclerosis
Additional findings_Paediatric v0.2 SNAP29 Zornitza Stark gene: SNAP29 was added
gene: SNAP29 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SNAP29 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SNAP29 were set to Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome
Additional findings_Paediatric v0.2 SMO Zornitza Stark gene: SMO was added
gene: SMO was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SMO was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SMO were set to Medulloblastoma
Additional findings_Paediatric v0.2 SMAD9 Zornitza Stark gene: SMAD9 was added
gene: SMAD9 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SMAD9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SMAD9 were set to Pulmonary arterial hypertension
Additional findings_Paediatric v0.2 SMAD6 Zornitza Stark gene: SMAD6 was added
gene: SMAD6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SMAD6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SMAD6 were set to Cardiovascular malformation, congenital
Additional findings_Paediatric v0.2 SMAD1 Zornitza Stark gene: SMAD1 was added
gene: SMAD1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SMAD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SMAD1 were set to Pulmonary arterial hypertension
Additional findings_Paediatric v0.2 SLCO1B3 Zornitza Stark gene: SLCO1B3 was added
gene: SLCO1B3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLCO1B3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLCO1B3 were set to Hyperbilirubinemia, Rotor type, digenic
Additional findings_Paediatric v0.2 SLCO1B1 Zornitza Stark gene: SLCO1B1 was added
gene: SLCO1B1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLCO1B1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLCO1B1 were set to Hyperbilirubinemia, Rotor type, digenic
Additional findings_Paediatric v0.2 SLC9A3R1 Zornitza Stark gene: SLC9A3R1 was added
gene: SLC9A3R1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC9A3R1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SLC9A3R1 were set to Nephrolithiasis/osteoporosis, hypophosphatemic, 2
Additional findings_Paediatric v0.2 SLC6A2 Zornitza Stark gene: SLC6A2 was added
gene: SLC6A2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC6A2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SLC6A2 were set to Orthostatic intolerance
Additional findings_Paediatric v0.2 SLC6A19 Zornitza Stark gene: SLC6A19 was added
gene: SLC6A19 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC6A19 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC6A19 were set to Hartnup disorder
Additional findings_Paediatric v0.2 SLC4A4 Zornitza Stark gene: SLC4A4 was added
gene: SLC4A4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC4A4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC4A4 were set to Renal tubular acidosis, proximal, with ocular abnormalities
Additional findings_Paediatric v0.2 SLC4A10 Zornitza Stark gene: SLC4A10 was added
gene: SLC4A10 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC4A10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SLC4A10 were set to Epilepsy & mental retardation
Additional findings_Paediatric v0.2 SLC41A1 Zornitza Stark gene: SLC41A1 was added
gene: SLC41A1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC41A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SLC41A1 were set to Parkinson disease, idiopathic
Additional findings_Paediatric v0.2 SLC35C1 Zornitza Stark gene: SLC35C1 was added
gene: SLC35C1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC35C1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC35C1 were set to Congenital disorder of glycosylation 2c
Additional findings_Paediatric v0.2 SLC35A2 Zornitza Stark gene: SLC35A2 was added
gene: SLC35A2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC35A2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: SLC35A2 were set to Early-onset epileptic encephalopathy
Additional findings_Paediatric v0.2 SLC35A1 Zornitza Stark gene: SLC35A1 was added
gene: SLC35A1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC35A1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC35A1 were set to CDG syndrome type IIf
Additional findings_Paediatric v0.2 SLC33A1 Zornitza Stark Mode of inheritance for gene SLC33A1 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Spastic paraplegia, autosomal dominant for gene: SLC33A1
Additional findings_Paediatric v0.2 SLC33A1 Zornitza Stark gene: SLC33A1 was added
gene: SLC33A1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC33A1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC33A1 were set to Congenital cataracts, hearing loss and low serum copper and ceruloplasmin
Additional findings_Paediatric v0.2 SLC27A5 Zornitza Stark gene: SLC27A5 was added
gene: SLC27A5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC27A5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC27A5 were set to Bile acid amidation defect
Additional findings_Paediatric v0.2 SLC25A22 Zornitza Stark gene: SLC25A22 was added
gene: SLC25A22 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC25A22 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC25A22 were set to Early myoclonic encephalopathy
Additional findings_Paediatric v0.2 SLC25A12 Zornitza Stark gene: SLC25A12 was added
gene: SLC25A12 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC25A12 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC25A12 were set to Hypomyelination, global cerebral
Additional findings_Paediatric v0.2 SLC16A12 Zornitza Stark gene: SLC16A12 was added
gene: SLC16A12 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC16A12 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SLC16A12 were set to Cataract, juvenile with microcornea and renal glucosuria
Additional findings_Paediatric v0.2 SLC16A1 Zornitza Stark gene: SLC16A1 was added
gene: SLC16A1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC16A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SLC16A1 were set to Monocarboxylate transporter 1 deficiency
Additional findings_Paediatric v0.2 SLC12A5 Zornitza Stark gene: SLC12A5 was added
gene: SLC12A5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC12A5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SLC12A5 were set to Febrile seizures
Additional findings_Paediatric v0.2 SLC11A2 Zornitza Stark gene: SLC11A2 was added
gene: SLC11A2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SLC11A2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC11A2 were set to Anemia, hypochromic microcytic
Additional findings_Paediatric v0.2 SIX5 Zornitza Stark gene: SIX5 was added
gene: SIX5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SIX5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SIX5 were set to Branchiootorenal syndrome
Additional findings_Paediatric v0.2 SIX2 Zornitza Stark gene: SIX2 was added
gene: SIX2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SIX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SIX2 were set to Renal hypodysplasia
Additional findings_Paediatric v0.2 SHOC2 Zornitza Stark gene: SHOC2 was added
gene: SHOC2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SHOC2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SHOC2 were set to Noonan-like syndrome with loose anagen hair
Additional findings_Paediatric v0.2 SH3BP2 Zornitza Stark gene: SH3BP2 was added
gene: SH3BP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SH3BP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SH3BP2 were set to Cherubism
Additional findings_Paediatric v0.2 SGCD Zornitza Stark Source BabySeq Category C gene was added to SGCD.
Source Expert Review Red was added to SGCD.
Added phenotypes Cardiomyopathy, dilated for gene: SGCD
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 SFTPC Zornitza Stark gene: SFTPC was added
gene: SFTPC was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SFTPC was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SFTPC were set to Interstitial lung disease
Additional findings_Paediatric v0.2 SFTPA2 Zornitza Stark gene: SFTPA2 was added
gene: SFTPA2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SFTPA2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SFTPA2 were set to Pulmonary fibrosis, idiopathic
Additional findings_Paediatric v0.2 SERPIND1 Zornitza Stark gene: SERPIND1 was added
gene: SERPIND1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SERPIND1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SERPIND1 were set to Heparin cofactor 2 deficiency
Additional findings_Paediatric v0.2 SERPINC1 Zornitza Stark gene: SERPINC1 was added
gene: SERPINC1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SERPINC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SERPINC1 were set to Thrombophilia due to antithrombin III deficiency
Additional findings_Paediatric v0.2 SERPINB6 Zornitza Stark gene: SERPINB6 was added
gene: SERPINB6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SERPINB6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SERPINB6 were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 SERPINA1 Zornitza Stark gene: SERPINA1 was added
gene: SERPINA1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SERPINA1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SERPINA1 were set to Antitrypsin alpha 1 deficiency
Additional findings_Paediatric v0.2 SEMA3A Zornitza Stark gene: SEMA3A was added
gene: SEMA3A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SEMA3A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SEMA3A were set to Kallmann syndrome 1
Additional findings_Paediatric v0.2 SEC63 Zornitza Stark gene: SEC63 was added
gene: SEC63 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SEC63 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SEC63 were set to Polycystic liver disease
Additional findings_Paediatric v0.2 SCP2 Zornitza Stark gene: SCP2 was added
gene: SCP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SCP2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SCP2 were set to Leukoencephalopathy - dystonia - motor neuropathy
Additional findings_Paediatric v0.2 SCO1 Zornitza Stark gene: SCO1 was added
gene: SCO1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SCO1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SCO1 were set to Hepatic failure, early onset, and neurologic disorder
Additional findings_Paediatric v0.2 SCNN1G Zornitza Stark gene: SCNN1G was added
gene: SCNN1G was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SCNN1G was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SCNN1G were set to Pseudohypoaldosteronism
Additional findings_Paediatric v0.2 SCNN1B Zornitza Stark Source BabySeq Category C gene was added to SCNN1B.
Source Expert Review Red was added to SCNN1B.
Mode of inheritance for gene SCNN1B was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Liddle syndrome for gene: SCNN1B
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 SCN4B Zornitza Stark gene: SCN4B was added
gene: SCN4B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SCN4B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SCN4B were set to Long QT syndrome
Additional findings_Paediatric v0.2 SCN4A Zornitza Stark Source BabySeq Category C gene was added to SCN4A.
Source Expert Review Red was added to SCN4A.
Added phenotypes Hypokalemic periodic paralysis, type 2 for gene: SCN4A
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 SCN3B Zornitza Stark gene: SCN3B was added
gene: SCN3B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SCN3B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SCN3B were set to Brugada syndrome
Additional findings_Paediatric v0.2 SCN2B Zornitza Stark gene: SCN2B was added
gene: SCN2B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SCN2B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SCN2B were set to Atrial fibrillation
Additional findings_Paediatric v0.2 SCN1B Zornitza Stark gene: SCN1B was added
gene: SCN1B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SCN1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SCN1B were set to Brugada syndrome
Additional findings_Paediatric v0.2 SC5D Zornitza Stark gene: SC5D was added
gene: SC5D was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: SC5D was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SC5D were set to Lathosterolosis
Additional findings_Paediatric v0.2 RYR1 Zornitza Stark Source BabySeq Category C gene was added to RYR1.
Source Expert Review Red was added to RYR1.
Mode of inheritance for gene RYR1 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BIALLELIC, autosomal or pseudoautosomal
Added phenotypes Congenital fiber type disproportion for gene: RYR1
Rating Changed from Amber List (moderate evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 RPS7 Zornitza Stark gene: RPS7 was added
gene: RPS7 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: RPS7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RPS7 were set to Diamond-Blackfan anemia
Additional findings_Paediatric v0.2 RPS10 Zornitza Stark gene: RPS10 was added
gene: RPS10 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: RPS10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RPS10 were set to Diamond-Blackfan anemia
Additional findings_Paediatric v0.2 RPL35A Zornitza Stark gene: RPL35A was added
gene: RPL35A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: RPL35A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RPL35A were set to Diamond-Blackfan anemia
Additional findings_Paediatric v0.2 RHAG Zornitza Stark gene: RHAG was added
gene: RHAG was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: RHAG was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RHAG were set to Rh-deficiency syndrome
Additional findings_Paediatric v0.2 RFX6 Zornitza Stark gene: RFX6 was added
gene: RFX6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: RFX6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RFX6 were set to Diabetes, neonatal, with intestinal atresia
Additional findings_Paediatric v0.2 RELN Zornitza Stark gene: RELN was added
gene: RELN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: RELN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RELN were set to Lissencephaly syndrome
Additional findings_Paediatric v0.2 RDX Zornitza Stark gene: RDX was added
gene: RDX was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: RDX was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RDX were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 RANGRF Zornitza Stark gene: RANGRF was added
gene: RANGRF was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: RANGRF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RANGRF were set to Brugada syndrome
Additional findings_Paediatric v0.2 RAD51B Zornitza Stark gene: RAD51B was added
gene: RAD51B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: RAD51B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RAD51B were set to Breast and/or ovarian cancer
Additional findings_Paediatric v0.2 RAB3GAP2 Zornitza Stark gene: RAB3GAP2 was added
gene: RAB3GAP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: RAB3GAP2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RAB3GAP2 were set to Warburg micro syndrome
Additional findings_Paediatric v0.2 RAB10 Zornitza Stark gene: RAB10 was added
gene: RAB10 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: RAB10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RAB10 were set to Congenital heart disease
Additional findings_Paediatric v0.2 NECTIN1 Zornitza Stark gene: NECTIN1 was added
gene: NECTIN1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NECTIN1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NECTIN1 were set to Cleft lip / palate
Additional findings_Paediatric v0.2 PSEN2 Zornitza Stark gene: PSEN2 was added
gene: PSEN2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PSEN2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PSEN2 were set to Alzheimer disease, type 4
Additional findings_Paediatric v0.2 PSEN1 Zornitza Stark gene: PSEN1 was added
gene: PSEN1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PSEN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PSEN1 were set to Alzheimer disease, type 3
Additional findings_Paediatric v0.2 PSAT1 Zornitza Stark gene: PSAT1 was added
gene: PSAT1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PSAT1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PSAT1 were set to Phosphoserine aminotransferase deficiency
Additional findings_Paediatric v0.2 PRRX1 Zornitza Stark gene: PRRX1 was added
gene: PRRX1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PRRX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PRRX1 were set to Agnathia-otocephaly complex
Additional findings_Paediatric v0.2 PRPS1 Zornitza Stark Added phenotypes Charcot-Marie-Tooth disease for gene: PRPS1
Additional findings_Paediatric v0.2 PRPS1 Zornitza Stark gene: PRPS1 was added
gene: PRPS1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PRPS1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: PRPS1 were set to Arts syndrome
Additional findings_Paediatric v0.2 PRODH Zornitza Stark gene: PRODH was added
gene: PRODH was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PRODH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PRODH were set to Hyperprolinemia, type I
Additional findings_Paediatric v0.2 PRKCSH Zornitza Stark gene: PRKCSH was added
gene: PRKCSH was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PRKCSH was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PRKCSH were set to Polycystic liver disease
Additional findings_Paediatric v0.2 PRKAG2 Zornitza Stark Source BabySeq Category C gene was added to PRKAG2.
Source Expert Review Red was added to PRKAG2.
Added phenotypes Glycogen storage disease of heart, lethal congenital for gene: PRKAG2
Rating Changed from Amber List (moderate evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 PRICKLE1 Zornitza Stark gene: PRICKLE1 was added
gene: PRICKLE1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PRICKLE1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PRICKLE1 were set to Epilepsy, progressive myoclonic 1B
Additional findings_Paediatric v0.2 PREPL Zornitza Stark gene: PREPL was added
gene: PREPL was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PREPL was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PREPL were set to Hypotonia - cystinuria syndrome
Additional findings_Paediatric v0.2 PRDM16 Zornitza Stark gene: PRDM16 was added
gene: PRDM16 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PRDM16 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PRDM16 were set to Left ventricular noncompaction
Additional findings_Paediatric v0.2 PPOX Zornitza Stark gene: PPOX was added
gene: PPOX was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PPOX was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PPOX were set to Porphyria variegata
Additional findings_Paediatric v0.2 POMC Zornitza Stark gene: POMC was added
gene: POMC was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: POMC was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: POMC were set to Proopiomelanocortin deficiency
Additional findings_Paediatric v0.2 PODXL Zornitza Stark gene: PODXL was added
gene: PODXL was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PODXL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PODXL were set to Focal and segmental glomerulosclerosis
Additional findings_Paediatric v0.2 PNPLA1 Zornitza Stark gene: PNPLA1 was added
gene: PNPLA1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PNPLA1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PNPLA1 were set to Ichthyosis, autosomal recessive congenital
Additional findings_Paediatric v0.2 PMS2 Zornitza Stark gene: PMS2 was added
gene: PMS2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PMS2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PMS2 were set to Lynch syndrome
Additional findings_Paediatric v0.2 PLOD2 Zornitza Stark gene: PLOD2 was added
gene: PLOD2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PLOD2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PLOD2 were set to Bruck syndrome
Additional findings_Paediatric v0.2 PLN Zornitza Stark Source BabySeq Category C gene was added to PLN.
Source Expert Review Red was added to PLN.
Added phenotypes Cardiomyopathy, familial hypertrophic for gene: PLN
Rating Changed from Amber List (moderate evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 PIGA Zornitza Stark gene: PIGA was added
gene: PIGA was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PIGA was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: PIGA were set to Epileptic encephalopathy, early-onset
Additional findings_Paediatric v0.2 PHOX2A Zornitza Stark gene: PHOX2A was added
gene: PHOX2A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PHOX2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PHOX2A were set to Fibrosis of extraocular muscles, congenital
Additional findings_Paediatric v0.2 PHKA1 Zornitza Stark gene: PHKA1 was added
gene: PHKA1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PHKA1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: PHKA1 were set to Phosphorylase kinase deficiency
Additional findings_Paediatric v0.2 PEX19 Zornitza Stark gene: PEX19 was added
gene: PEX19 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PEX19 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PEX19 were set to Zellweger syndrome
Additional findings_Paediatric v0.2 PEX16 Zornitza Stark gene: PEX16 was added
gene: PEX16 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PEX16 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PEX16 were set to Zellweger syndrome
Additional findings_Paediatric v0.2 PEX14 Zornitza Stark gene: PEX14 was added
gene: PEX14 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PEX14 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PEX14 were set to Zellweger syndrome
Additional findings_Paediatric v0.2 PEX11B Zornitza Stark gene: PEX11B was added
gene: PEX11B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PEX11B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PEX11B were set to Peroxisome biogenesis disorder
Additional findings_Paediatric v0.2 PDSS2 Zornitza Stark gene: PDSS2 was added
gene: PDSS2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PDSS2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PDSS2 were set to Leigh syndrome with nephropathy and COQ10 deficiency
Additional findings_Paediatric v0.2 PDSS1 Zornitza Stark gene: PDSS1 was added
gene: PDSS1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PDSS1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PDSS1 were set to Deafness - encephaloneuropathy - obesity - valvulopathy Neonatal
Additional findings_Paediatric v0.2 PDP1 Zornitza Stark gene: PDP1 was added
gene: PDP1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PDP1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PDP1 were set to Pyruvate dehydrogenase phosphatase deficiency
Additional findings_Paediatric v0.2 PDLIM3 Zornitza Stark gene: PDLIM3 was added
gene: PDLIM3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PDLIM3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PDLIM3 were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 PDE11A Zornitza Stark gene: PDE11A was added
gene: PDE11A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PDE11A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PDE11A were set to Adrenocortical hyperplasia
Additional findings_Paediatric v0.2 PALB2 Zornitza Stark gene: PALB2 was added
gene: PALB2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PALB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PALB2 were set to Breast cancer
Additional findings_Paediatric v0.2 PABPN1 Zornitza Stark gene: PABPN1 was added
gene: PABPN1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: PABPN1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PABPN1 were set to Oculopharyngeal muscular dystrophy
Additional findings_Paediatric v0.2 P2RX2 Zornitza Stark gene: P2RX2 was added
gene: P2RX2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: P2RX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: P2RX2 were set to Hearing loss
Additional findings_Paediatric v0.2 OTUD4 Zornitza Stark gene: OTUD4 was added
gene: OTUD4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: OTUD4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: OTUD4 were set to Hypogonadotropic hypogonadism, ataxia & dementia
Additional findings_Paediatric v0.2 OTOG Zornitza Stark gene: OTOG was added
gene: OTOG was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: OTOG was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: OTOG were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 ORC6 Zornitza Stark gene: ORC6 was added
gene: ORC6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ORC6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ORC6 were set to Meier-Gorlin syndrome
Additional findings_Paediatric v0.2 ORC4 Zornitza Stark gene: ORC4 was added
gene: ORC4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ORC4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ORC4 were set to Meier-Gorlin syndrome
Additional findings_Paediatric v0.2 OPA3 Zornitza Stark Source BabySeq Category C gene was added to OPA3.
Source Expert Review Red was added to OPA3.
Mode of inheritance for gene OPA3 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Optic atrophy 3 with cataract for gene: OPA3
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 NUP62 Zornitza Stark gene: NUP62 was added
gene: NUP62 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NUP62 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NUP62 were set to Striatonigral degeneration, infantile
Additional findings_Paediatric v0.2 NUP155 Zornitza Stark gene: NUP155 was added
gene: NUP155 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NUP155 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NUP155 were set to Atrial fibrillation
Additional findings_Paediatric v0.2 NUB1 Zornitza Stark gene: NUB1 was added
gene: NUB1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NUB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NUB1 were set to Congenital heart disease
Additional findings_Paediatric v0.2 NTRK1 Zornitza Stark Source BabySeq Category C gene was added to NTRK1.
Source Expert Review Red was added to NTRK1.
Mode of inheritance for gene NTRK1 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Medullary thyroid carcinoma, familial for gene: NTRK1
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 NSDHL Zornitza Stark Source BabySeq Category C gene was added to NSDHL.
Source Expert Review Red was added to NSDHL.
Added phenotypes CK syndrome for gene: NSDHL
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 NRXN1 Zornitza Stark gene: NRXN1 was added
gene: NRXN1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NRXN1 was set to Unknown
Phenotypes for gene: NRXN1 were set to Autism
Additional findings_Paediatric v0.2 NRG1 Zornitza Stark gene: NRG1 was added
gene: NRG1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NRG1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NRG1 were set to Hirschsprung disease
Additional findings_Paediatric v0.2 NR1H4 Zornitza Stark gene: NR1H4 was added
gene: NR1H4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NR1H4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NR1H4 were set to Cholestasis, infantile
Additional findings_Paediatric v0.2 NPPA Zornitza Stark gene: NPPA was added
gene: NPPA was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NPPA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NPPA were set to Atrial fibrillation
Additional findings_Paediatric v0.2 NOTCH1 Zornitza Stark gene: NOTCH1 was added
gene: NOTCH1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NOTCH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NOTCH1 were set to Aortic valve disease
Additional findings_Paediatric v0.2 NOP10 Zornitza Stark gene: NOP10 was added
gene: NOP10 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NOP10 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NOP10 were set to Dyskeratosis congenita
Additional findings_Paediatric v0.2 NME8 Zornitza Stark gene: NME8 was added
gene: NME8 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NME8 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NME8 were set to Ciliary dyskinesia, primary
Additional findings_Paediatric v0.2 NLRP7 Zornitza Stark gene: NLRP7 was added
gene: NLRP7 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NLRP7 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NLRP7 were set to Hydatidiform mole
Additional findings_Paediatric v0.2 NLGN4X Zornitza Stark gene: NLGN4X was added
gene: NLGN4X was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NLGN4X was set to Unknown
Phenotypes for gene: NLGN4X were set to Autism
Additional findings_Paediatric v0.2 NLGN3 Zornitza Stark gene: NLGN3 was added
gene: NLGN3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NLGN3 was set to Unknown
Phenotypes for gene: NLGN3 were set to Autism
Additional findings_Paediatric v0.2 NKX3-2 Zornitza Stark gene: NKX3-2 was added
gene: NKX3-2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NKX3-2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NKX3-2 were set to Spondylo-megaepiphyseal-metaphyseal dysplasia
Additional findings_Paediatric v0.2 NIN Zornitza Stark gene: NIN was added
gene: NIN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NIN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NIN were set to Seckel syndrome
Additional findings_Paediatric v0.2 NHP2 Zornitza Stark gene: NHP2 was added
gene: NHP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NHP2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NHP2 were set to Dyskeratosis congenita
Additional findings_Paediatric v0.2 NFATC1 Zornitza Stark gene: NFATC1 was added
gene: NFATC1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NFATC1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NFATC1 were set to Congenital heart disease
Additional findings_Paediatric v0.2 NEXN Zornitza Stark Added phenotypes Cardiomyopathy, familial hypertrophic for gene: NEXN
Additional findings_Paediatric v0.2 NEXN Zornitza Stark gene: NEXN was added
gene: NEXN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NEXN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NEXN were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 NEUROG3 Zornitza Stark gene: NEUROG3 was added
gene: NEUROG3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NEUROG3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NEUROG3 were set to Diarrhea 4, malabsorptive, congenital
Additional findings_Paediatric v0.2 NEK8 Zornitza Stark gene: NEK8 was added
gene: NEK8 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NEK8 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NEK8 were set to Nephronophthisis
Additional findings_Paediatric v0.2 NEK1 Zornitza Stark gene: NEK1 was added
gene: NEK1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NEK1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NEK1 were set to Short rib-polydactyly syndorme, type II
Additional findings_Paediatric v0.2 NEDD4L Zornitza Stark gene: NEDD4L was added
gene: NEDD4L was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NEDD4L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NEDD4L were set to Epilepsy, photosensitive generalised
Additional findings_Paediatric v0.2 NEBL Zornitza Stark gene: NEBL was added
gene: NEBL was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NEBL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NEBL were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 NCF4 Zornitza Stark gene: NCF4 was added
gene: NCF4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NCF4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NCF4 were set to Chronic granulomatous disease
Additional findings_Paediatric v0.2 NAA15 Zornitza Stark gene: NAA15 was added
gene: NAA15 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NAA15 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NAA15 were set to Congenital heart disease
Additional findings_Paediatric v0.2 NAA10 Zornitza Stark gene: NAA10 was added
gene: NAA10 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: NAA10 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: NAA10 were set to N-terminal acetyltransferase deficiency
Additional findings_Paediatric v0.2 MYPN Zornitza Stark Added phenotypes Cardiomyopathy, hypertrophic for gene: MYPN
Additional findings_Paediatric v0.2 MYPN Zornitza Stark gene: MYPN was added
gene: MYPN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MYPN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYPN were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 MYOZ2 Zornitza Stark gene: MYOZ2 was added
gene: MYOZ2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MYOZ2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYOZ2 were set to Cardiomyopathy, hypertrophic
Additional findings_Paediatric v0.2 MYOT Zornitza Stark gene: MYOT was added
gene: MYOT was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MYOT was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYOT were set to Myofibrillar myopathy
Additional findings_Paediatric v0.2 MYOM1 Zornitza Stark gene: MYOM1 was added
gene: MYOM1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MYOM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYOM1 were set to Cardiomyopathy, hypertrophic
Additional findings_Paediatric v0.2 MYO5A Zornitza Stark gene: MYO5A was added
gene: MYO5A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MYO5A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MYO5A were set to Griscelli syndrome
Additional findings_Paediatric v0.2 MYO1F Zornitza Stark gene: MYO1F was added
gene: MYO1F was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MYO1F was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MYO1F were set to Sensorineural hearing loss
Additional findings_Paediatric v0.2 MYO1E Zornitza Stark gene: MYO1E was added
gene: MYO1E was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MYO1E was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MYO1E were set to Focal segmental glomerulosclerosis
Additional findings_Paediatric v0.2 MYO1C Zornitza Stark gene: MYO1C was added
gene: MYO1C was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MYO1C was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MYO1C were set to Sensorineural hearing loss
Additional findings_Paediatric v0.2 MYLK2 Zornitza Stark gene: MYLK2 was added
gene: MYLK2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MYLK2 was set to Unknown
Phenotypes for gene: MYLK2 were set to Cardiomyopathy, hypertrophic
Additional findings_Paediatric v0.2 MYH7 Zornitza Stark Added phenotypes Congenital fiber type disproportion for gene: MYH7
Additional findings_Paediatric v0.2 MYH7 Zornitza Stark Source BabySeq Category C gene was added to MYH7.
Source Expert Review Red was added to MYH7.
Added phenotypes Scapuloperoneal syndrome, myopathic type for gene: MYH7
Rating Changed from Amber List (moderate evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 MYH6 Zornitza Stark Added phenotypes Cardiomyopathy, familial hypertrophic for gene: MYH6
Additional findings_Paediatric v0.2 MYH6 Zornitza Stark Added phenotypes Cardiomyopathy, dilated for gene: MYH6
Additional findings_Paediatric v0.2 MYH6 Zornitza Stark gene: MYH6 was added
gene: MYH6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MYH6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYH6 were set to Atrial septal defect
Additional findings_Paediatric v0.2 MYBPC3 Zornitza Stark Source BabySeq Category C gene was added to MYBPC3.
Source Expert Review Red was added to MYBPC3.
Added phenotypes Cardiomyopathy, dilated for gene: MYBPC3
Rating Changed from Amber List (moderate evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 MYBPC1 Zornitza Stark gene: MYBPC1 was added
gene: MYBPC1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MYBPC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYBPC1 were set to Distal arthrogryposis type I
Additional findings_Paediatric v0.2 CAVIN4 Zornitza Stark gene: CAVIN4 was added
gene: CAVIN4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CAVIN4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CAVIN4 were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 MUC5B Zornitza Stark gene: MUC5B was added
gene: MUC5B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MUC5B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MUC5B were set to Pulmonary fibrosis, idiopathic
Additional findings_Paediatric v0.2 MTO1 Zornitza Stark gene: MTO1 was added
gene: MTO1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MTO1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MTO1 were set to Hypertrophic cardiomyopathy & lactic acidosis
Additional findings_Paediatric v0.2 MT-ND6 Zornitza Stark gene: MT-ND6 was added
gene: MT-ND6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene gene: MT-ND6 was set to MITOCHONDRIAL
Phenotypes for gene: MT-ND6 were set to Leber hereditary optic neuropathy
Additional findings_Paediatric v0.2 MT-ND4 Zornitza Stark gene: MT-ND4 was added
gene: MT-ND4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene gene: MT-ND4 was set to MITOCHONDRIAL
Phenotypes for gene: MT-ND4 were set to Leber hereditary optic neuropathy
Additional findings_Paediatric v0.2 MT-ND1 Zornitza Stark gene: MT-ND1 was added
gene: MT-ND1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene gene: MT-ND1 was set to MITOCHONDRIAL
Phenotypes for gene: MT-ND1 were set to Leber hereditary optic neuropathy
Additional findings_Paediatric v0.2 MSRB3 Zornitza Stark gene: MSRB3 was added
gene: MSRB3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MSRB3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MSRB3 were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 MSH6 Zornitza Stark gene: MSH6 was added
gene: MSH6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MSH6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MSH6 were set to Lynch syndrome
Additional findings_Paediatric v0.2 MSH2 Zornitza Stark gene: MSH2 was added
gene: MSH2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MSH2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MSH2 were set to Lynch syndrome
Additional findings_Paediatric v0.2 MRPS22 Zornitza Stark gene: MRPS22 was added
gene: MRPS22 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MRPS22 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MRPS22 were set to Mitochondrial respiratory chain disorder
Additional findings_Paediatric v0.2 MRPS16 Zornitza Stark gene: MRPS16 was added
gene: MRPS16 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MRPS16 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MRPS16 were set to Mitochondrial respiratory chain disorder
Additional findings_Paediatric v0.2 MPDU1 Zornitza Stark gene: MPDU1 was added
gene: MPDU1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MPDU1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MPDU1 were set to Congenital disorder of glycosylation, type If
Additional findings_Paediatric v0.2 MOGS Zornitza Stark gene: MOGS was added
gene: MOGS was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MOGS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MOGS were set to Glucosidase 1 deficiency
Additional findings_Paediatric v0.2 MLPH Zornitza Stark gene: MLPH was added
gene: MLPH was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MLPH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MLPH were set to Griscelli syndrome type 3
Additional findings_Paediatric v0.2 MLH1 Zornitza Stark gene: MLH1 was added
gene: MLH1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MLH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MLH1 were set to Lynch syndrome
Additional findings_Paediatric v0.2 MIR96 Zornitza Stark gene: MIR96 was added
gene: MIR96 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MIR96 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MIR96 were set to Hearing loss
Additional findings_Paediatric v0.2 MIB1 Zornitza Stark gene: MIB1 was added
gene: MIB1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MIB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MIB1 were set to Left ventricular noncompaction
Additional findings_Paediatric v0.2 MGAT2 Zornitza Stark gene: MGAT2 was added
gene: MGAT2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MGAT2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MGAT2 were set to CDG syndrome type IIa
Additional findings_Paediatric v0.2 MESP2 Zornitza Stark gene: MESP2 was added
gene: MESP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MESP2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MESP2 were set to Spondylocostal dysostosis, autosomal recessive 2
Additional findings_Paediatric v0.2 MED25 Zornitza Stark gene: MED25 was added
gene: MED25 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MED25 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MED25 were set to Charcot-Marie-Tooth disease
Additional findings_Paediatric v0.2 MED20 Zornitza Stark gene: MED20 was added
gene: MED20 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MED20 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MED20 were set to Congenital heart disease
Additional findings_Paediatric v0.2 MED13L Zornitza Stark gene: MED13L was added
gene: MED13L was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MED13L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MED13L were set to Transposition of great arteries
Additional findings_Paediatric v0.2 MCEE Zornitza Stark gene: MCEE was added
gene: MCEE was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MCEE was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MCEE were set to Methylmalonyl-CoA epimerase deficiency
Additional findings_Paediatric v0.2 MATN4 Zornitza Stark gene: MATN4 was added
gene: MATN4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MATN4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MATN4 were set to Multiple anomalies
Additional findings_Paediatric v0.2 MAT1A Zornitza Stark gene: MAT1A was added
gene: MAT1A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MAT1A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MAT1A were set to Methionine adenosyltransferase deficiency
Additional findings_Paediatric v0.2 MAPT Zornitza Stark gene: MAPT was added
gene: MAPT was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MAPT was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MAPT were set to Dementia, frontotemporal, with or without parkinsonism
Additional findings_Paediatric v0.2 MAPK10 Zornitza Stark gene: MAPK10 was added
gene: MAPK10 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: MAPK10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MAPK10 were set to Epileptic encephalopathy
Additional findings_Paediatric v0.2 LYZ Zornitza Stark gene: LYZ was added
gene: LYZ was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: LYZ was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: LYZ were set to Amyloidosis, systemic
Additional findings_Paediatric v0.2 LUM Zornitza Stark gene: LUM was added
gene: LUM was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: LUM was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: LUM were set to Amyotrophic lateral sclerosis
Additional findings_Paediatric v0.2 LRRK2 Zornitza Stark gene: LRRK2 was added
gene: LRRK2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: LRRK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: LRRK2 were set to Parkinson disease
Additional findings_Paediatric v0.2 LPP Zornitza Stark gene: LPP was added
gene: LPP was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: LPP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: LPP were set to Tetralogy of Fallot
Additional findings_Paediatric v0.2 LPIN2 Zornitza Stark gene: LPIN2 was added
gene: LPIN2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: LPIN2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LPIN2 were set to Majeed syndrome
Additional findings_Paediatric v0.2 LMNB2 Zornitza Stark gene: LMNB2 was added
gene: LMNB2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: LMNB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: LMNB2 were set to Lipodystrophy, partial
Additional findings_Paediatric v0.2 LHB Zornitza Stark gene: LHB was added
gene: LHB was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: LHB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LHB were set to Hypogonadism
Additional findings_Paediatric v0.2 LGI1 Zornitza Stark gene: LGI1 was added
gene: LGI1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: LGI1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: LGI1 were set to Epilepsy, familial temporal lobe, 1
Additional findings_Paediatric v0.2 LDB3 Zornitza Stark gene: LDB3 was added
gene: LDB3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: LDB3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: LDB3 were set to Myofibrillar myopathy
Additional findings_Paediatric v0.2 LBR Zornitza Stark Source BabySeq Category C gene was added to LBR.
Source Expert Review Red was added to LBR.
Mode of inheritance for gene LBR was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Reynolds syndrome for gene: LBR
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 LARS2 Zornitza Stark gene: LARS2 was added
gene: LARS2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: LARS2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LARS2 were set to Perrault syndrome
Additional findings_Paediatric v0.2 LARS Zornitza Stark gene: LARS was added
gene: LARS was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: LARS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LARS were set to Infantile liver failure syndrome
Additional findings_Paediatric v0.2 LAMA4 Zornitza Stark gene: LAMA4 was added
gene: LAMA4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: LAMA4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: LAMA4 were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 KRT8 Zornitza Stark gene: KRT8 was added
gene: KRT8 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KRT8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KRT8 were set to Cirrhosis, cryptogenic
Additional findings_Paediatric v0.2 KRT6B Zornitza Stark gene: KRT6B was added
gene: KRT6B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KRT6B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KRT6B were set to Pachyonychia congenita
Additional findings_Paediatric v0.2 KRT18 Zornitza Stark gene: KRT18 was added
gene: KRT18 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KRT18 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KRT18 were set to Cirrhosis, cryptogenic
Additional findings_Paediatric v0.2 KPTN Zornitza Stark gene: KPTN was added
gene: KPTN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KPTN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: KPTN were set to Macrocephaly, neurodevelopmental delay, and seizures
Additional findings_Paediatric v0.2 KLF1 Zornitza Stark gene: KLF1 was added
gene: KLF1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KLF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KLF1 were set to Anemia, dyserythropoietic congenital, type IV
Additional findings_Paediatric v0.2 KIF22 Zornitza Stark gene: KIF22 was added
gene: KIF22 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KIF22 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KIF22 were set to Spondyloepimetaphyseal dysplasia with joint laxity, type 2
Additional findings_Paediatric v0.2 KIF1B Zornitza Stark gene: KIF1B was added
gene: KIF1B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KIF1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KIF1B were set to Charcot-Marie-Tooth disease
Additional findings_Paediatric v0.2 KIF1BP Zornitza Stark gene: KIF1BP was added
gene: KIF1BP was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KIF1BP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: KIF1BP were set to Goldberg-Shprintzen megacolon syndrome
Additional findings_Paediatric v0.2 KDM5B Zornitza Stark gene: KDM5B was added
gene: KDM5B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KDM5B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KDM5B were set to Congenital heart disease
Additional findings_Paediatric v0.2 KCNQ3 Zornitza Stark gene: KCNQ3 was added
gene: KCNQ3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KCNQ3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KCNQ3 were set to Epilepsy, benign neonatal
Additional findings_Paediatric v0.2 KCNQ2 Zornitza Stark gene: KCNQ2 was added
gene: KCNQ2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KCNQ2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KCNQ2 were set to Epilepsy, benign neonatal
Additional findings_Paediatric v0.2 KCNQ1OT1 Zornitza Stark gene: KCNQ1OT1 was added
gene: KCNQ1OT1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KCNQ1OT1 was set to Unknown
Phenotypes for gene: KCNQ1OT1 were set to Beckwith-Wiedemann syndrome
Additional findings_Paediatric v0.2 KCNJ8 Zornitza Stark gene: KCNJ8 was added
gene: KCNJ8 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KCNJ8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KCNJ8 were set to Sudden infant death syndrom
Additional findings_Paediatric v0.2 KCNJ5 Zornitza Stark gene: KCNJ5 was added
gene: KCNJ5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KCNJ5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KCNJ5 were set to Long QT syndrome
Additional findings_Paediatric v0.2 KCNJ18 Zornitza Stark gene: KCNJ18 was added
gene: KCNJ18 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KCNJ18 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KCNJ18 were set to Hypokalaemic periodic paralysis
Additional findings_Paediatric v0.2 KCNE3 Zornitza Stark gene: KCNE3 was added
gene: KCNE3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KCNE3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KCNE3 were set to Brugada syndrome
Additional findings_Paediatric v0.2 KCNE5 Zornitza Stark gene: KCNE5 was added
gene: KCNE5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KCNE5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KCNE5 were set to Atrial fibrillation
Additional findings_Paediatric v0.2 KCND3 Zornitza Stark gene: KCND3 was added
gene: KCND3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KCND3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KCND3 were set to Brugada syndrome
Additional findings_Paediatric v0.2 KARS Zornitza Stark Added phenotypes Hearing loss for gene: KARS
Additional findings_Paediatric v0.2 KARS Zornitza Stark gene: KARS was added
gene: KARS was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: KARS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: KARS were set to Charcot-Marie-Tooth disease, recessive intermediate
Additional findings_Paediatric v0.2 JPH2 Zornitza Stark gene: JPH2 was added
gene: JPH2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: JPH2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: JPH2 were set to Cardiomyopathy, hypertrophic
Additional findings_Paediatric v0.2 IYD Zornitza Stark gene: IYD was added
gene: IYD was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: IYD was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: IYD were set to Thyroid dyshormonogenesis
Additional findings_Paediatric v0.2 ITGA7 Zornitza Stark gene: ITGA7 was added
gene: ITGA7 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ITGA7 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ITGA7 were set to Congenital muscular dystrophy with integrin deficiency
Additional findings_Paediatric v0.2 ITGA6 Zornitza Stark gene: ITGA6 was added
gene: ITGA6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ITGA6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ITGA6 were set to Epidermolysis bullosa, junctional, with pyloric stenosis
Additional findings_Paediatric v0.2 ITGA3 Zornitza Stark gene: ITGA3 was added
gene: ITGA3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ITGA3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ITGA3 were set to Interstitial lung disease, nephrotic syndrome, and epidermolysis bullosa, congenital
Additional findings_Paediatric v0.2 ISL1 Zornitza Stark gene: ISL1 was added
gene: ISL1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ISL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ISL1 were set to Diabetes, type 2
Additional findings_Paediatric v0.2 ISCU Zornitza Stark gene: ISCU was added
gene: ISCU was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ISCU was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ISCU were set to Myopathy with defiency of succinate dehydrogenase
Additional findings_Paediatric v0.2 IRS1 Zornitza Stark gene: IRS1 was added
gene: IRS1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: IRS1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: IRS1 were set to Diabetes mellitus, noninsulin dependent
Additional findings_Paediatric v0.2 IRF6 Zornitza Stark Source BabySeq Category C gene was added to IRF6.
Source Expert Review Red was added to IRF6.
Added phenotypes Popliteal pterygium syndrome for gene: IRF6
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 ILK Zornitza Stark gene: ILK was added
gene: ILK was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ILK was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ILK were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 IL10RB Zornitza Stark gene: IL10RB was added
gene: IL10RB was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: IL10RB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: IL10RB were set to Inflammatory bowel disease
Additional findings_Paediatric v0.2 IGF1 Zornitza Stark gene: IGF1 was added
gene: IGF1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: IGF1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: IGF1 were set to Insulin-like growth factor deficiency
Additional findings_Paediatric v0.2 IGBP1 Zornitza Stark gene: IGBP1 was added
gene: IGBP1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: IGBP1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: IGBP1 were set to Agenesis of the corpus callosum - intellectual deficit - coloboma - micrognathia
Additional findings_Paediatric v0.2 IFT80 Zornitza Stark gene: IFT80 was added
gene: IFT80 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: IFT80 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: IFT80 were set to Asphyxiating thoracic dystrophy 2
Additional findings_Paediatric v0.2 IFT43 Zornitza Stark gene: IFT43 was added
gene: IFT43 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: IFT43 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: IFT43 were set to Cranioectodermal dysplasia
Additional findings_Paediatric v0.2 IFT122 Zornitza Stark gene: IFT122 was added
gene: IFT122 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: IFT122 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: IFT122 were set to Cranioectodermal dysplasia
Additional findings_Paediatric v0.2 HYLS1 Zornitza Stark gene: HYLS1 was added
gene: HYLS1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HYLS1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HYLS1 were set to Hydrolethalus syndrome
Additional findings_Paediatric v0.2 HYDIN Zornitza Stark gene: HYDIN was added
gene: HYDIN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HYDIN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HYDIN were set to Primary ciliary dyskinesia
Additional findings_Paediatric v0.2 HPS6 Zornitza Stark gene: HPS6 was added
gene: HPS6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HPS6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HPS6 were set to Hermansky-Pudlak syndrome 6
Additional findings_Paediatric v0.2 HPD Zornitza Stark gene: HPD was added
gene: HPD was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HPD was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HPD were set to Tyrosinemia, type III
Additional findings_Paediatric v0.2 HOXA1 Zornitza Stark gene: HOXA1 was added
gene: HOXA1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HOXA1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HOXA1 were set to Athabaskan brainstem dysgenesis syndrome
Additional findings_Paediatric v0.2 HOMEZ Zornitza Stark gene: HOMEZ was added
gene: HOMEZ was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HOMEZ was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: HOMEZ were set to Congenital heart disease
Additional findings_Paediatric v0.2 HNF4A Zornitza Stark gene: HNF4A was added
gene: HNF4A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HNF4A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: HNF4A were set to Hypoglycaemia, hyperinsulinaemic
Additional findings_Paediatric v0.2 HNF1B Zornitza Stark gene: HNF1B was added
gene: HNF1B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HNF1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: HNF1B were set to Renal cysts and diabetes syndrome
Additional findings_Paediatric v0.2 HMBS Zornitza Stark gene: HMBS was added
gene: HMBS was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HMBS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: HMBS were set to Porphyria, acute intermittent
Additional findings_Paediatric v0.2 HK1 Zornitza Stark gene: HK1 was added
gene: HK1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HK1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HK1 were set to Hemolytic anemia due to hexokinase deficiency
Additional findings_Paediatric v0.2 HIBCH Zornitza Stark gene: HIBCH was added
gene: HIBCH was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HIBCH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HIBCH were set to Neurodegeneration, progressive infantile
Additional findings_Paediatric v0.2 HGF Zornitza Stark gene: HGF was added
gene: HGF was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HGF was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HGF were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 HFE2 Zornitza Stark gene: HFE2 was added
gene: HFE2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HFE2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HFE2 were set to Haemochromatosis
Additional findings_Paediatric v0.2 HFE Zornitza Stark gene: HFE was added
gene: HFE was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HFE was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HFE were set to Hemochromatosis
Additional findings_Paediatric v0.2 HESX1 Zornitza Stark gene: HESX1 was added
gene: HESX1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HESX1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HESX1 were set to Pituitary hypoplasia
Additional findings_Paediatric v0.2 HERC2 Zornitza Stark gene: HERC2 was added
gene: HERC2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HERC2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HERC2 were set to Autism spectrum disorder
Additional findings_Paediatric v0.2 DNAAF5 Zornitza Stark gene: DNAAF5 was added
gene: DNAAF5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DNAAF5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DNAAF5 were set to Primary ciliary dyskinesia
Additional findings_Paediatric v0.2 HCN4 Zornitza Stark gene: HCN4 was added
gene: HCN4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HCN4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: HCN4 were set to Brugada syndrome
Additional findings_Paediatric v0.2 HCCS Zornitza Stark gene: HCCS was added
gene: HCCS was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HCCS was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: HCCS were set to Microphthalmia
Additional findings_Paediatric v0.2 HAS2 Zornitza Stark gene: HAS2 was added
gene: HAS2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HAS2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: HAS2 were set to Congenital heart disease
Additional findings_Paediatric v0.2 HARS2 Zornitza Stark gene: HARS2 was added
gene: HARS2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HARS2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HARS2 were set to Perrault syndrome
Additional findings_Paediatric v0.2 HARS Zornitza Stark gene: HARS was added
gene: HARS was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HARS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HARS were set to Usher syndrome type 3B
Additional findings_Paediatric v0.2 HAMP Zornitza Stark gene: HAMP was added
gene: HAMP was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: HAMP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HAMP were set to Haemochromatosis
Additional findings_Paediatric v0.2 HADH Zornitza Stark Source BabySeq Category C gene was added to HADH.
Source Expert Review Red was added to HADH.
Added phenotypes 3-hydroxyacyl-CoA dehydrogenase deficiency for gene: HADH
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 GYG1 Zornitza Stark gene: GYG1 was added
gene: GYG1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GYG1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GYG1 were set to Glycogen storage disease XV
Additional findings_Paediatric v0.2 GUCY2C Zornitza Stark gene: GUCY2C was added
gene: GUCY2C was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GUCY2C was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GUCY2C were set to Meconium ileus
Additional findings_Paediatric v0.2 GTF2H5 Zornitza Stark gene: GTF2H5 was added
gene: GTF2H5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GTF2H5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GTF2H5 were set to Trichothiodystrophy
Additional findings_Paediatric v0.2 GRXCR1 Zornitza Stark gene: GRXCR1 was added
gene: GRXCR1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GRXCR1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GRXCR1 were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 GRIN2A Zornitza Stark gene: GRIN2A was added
gene: GRIN2A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GRIN2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GRIN2A were set to Epilepsy with neurodevelopmental defects
Additional findings_Paediatric v0.2 GRHL2 Zornitza Stark gene: GRHL2 was added
gene: GRHL2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GRHL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GRHL2 were set to Hearing loss
Additional findings_Paediatric v0.2 GPX1 Zornitza Stark gene: GPX1 was added
gene: GPX1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GPX1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GPX1 were set to Hemolytic anemia due to glutathione peroxidase deficiency
Additional findings_Paediatric v0.2 GPHN Zornitza Stark gene: GPHN was added
gene: GPHN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GPHN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GPHN were set to Hyperekplexia
Additional findings_Paediatric v0.2 GPC6 Zornitza Stark gene: GPC6 was added
gene: GPC6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GPC6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GPC6 were set to Omodysplasia
Additional findings_Paediatric v0.2 GPC4 Zornitza Stark gene: GPC4 was added
gene: GPC4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GPC4 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: GPC4 were set to Simpson-Golabi-Behmel syndrome
Additional findings_Paediatric v0.2 GMPPA Zornitza Stark gene: GMPPA was added
gene: GMPPA was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GMPPA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GMPPA were set to Congenital disorder of glycosylation
Additional findings_Paediatric v0.2 GLUL Zornitza Stark gene: GLUL was added
gene: GLUL was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GLUL was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GLUL were set to Congenital brain dysgenesis due to glutamine synthetase deficiency
Additional findings_Paediatric v0.2 GLRB Zornitza Stark gene: GLRB was added
gene: GLRB was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GLRB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GLRB were set to Hyperekplexia 2, autosomal recessive
Additional findings_Paediatric v0.2 GLIS3 Zornitza Stark gene: GLIS3 was added
gene: GLIS3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GLIS3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GLIS3 were set to Diabetes mellitus, neonatal, with congenital hypothyroidism
Additional findings_Paediatric v0.2 GLI2 Zornitza Stark gene: GLI2 was added
gene: GLI2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GLI2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GLI2 were set to Holoprosencephaly-9
Additional findings_Paediatric v0.2 GLE1 Zornitza Stark gene: GLE1 was added
gene: GLE1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GLE1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GLE1 were set to Lethal arthrogryposis with anterior horn cell disease
Additional findings_Paediatric v0.2 GFER Zornitza Stark gene: GFER was added
gene: GFER was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GFER was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GFER were set to Myopathy, mitochondrial progressive, with congenital cataract, hearing loss, and developmental delay
Additional findings_Paediatric v0.2 GDNF Zornitza Stark Added phenotypes Central hypoventilation syndrome for gene: GDNF
Additional findings_Paediatric v0.2 GDNF Zornitza Stark gene: GDNF was added
gene: GDNF was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GDNF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GDNF were set to Hirschsprung disease
Additional findings_Paediatric v0.2 GDF1 Zornitza Stark gene: GDF1 was added
gene: GDF1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GDF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GDF1 were set to Congenital heart defects
Additional findings_Paediatric v0.2 GCSH Zornitza Stark gene: GCSH was added
gene: GCSH was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GCSH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GCSH were set to Glycine encephalopathy
Additional findings_Paediatric v0.2 GCLC Zornitza Stark gene: GCLC was added
gene: GCLC was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GCLC was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GCLC were set to Hemolytic anemia due to gamma-glutamylcysteine synthetase deficiency
Additional findings_Paediatric v0.2 GBE1 Zornitza Stark Source BabySeq Category C gene was added to GBE1.
Source Expert Review Red was added to GBE1.
Added phenotypes Polyglucosan body disease, adult form for gene: GBE1
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 GATAD1 Zornitza Stark gene: GATAD1 was added
gene: GATAD1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GATAD1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GATAD1 were set to Cardiomyopathy, dilated, 2B
Additional findings_Paediatric v0.2 GATA6 Zornitza Stark gene: GATA6 was added
gene: GATA6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GATA6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GATA6 were set to Atrial fibrillation
Additional findings_Paediatric v0.2 GATA5 Zornitza Stark gene: GATA5 was added
gene: GATA5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GATA5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GATA5 were set to Familial atrial fibrillation
Additional findings_Paediatric v0.2 GATA1 Zornitza Stark Source BabySeq Category C gene was added to GATA1.
Source Expert Review Red was added to GATA1.
Added phenotypes Porphyria, congenital erythropoietic for gene: GATA1
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 GABRG2 Zornitza Stark gene: GABRG2 was added
gene: GABRG2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GABRG2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GABRG2 were set to Epilepsy, childhood absence with febrile seizure
Additional findings_Paediatric v0.2 GABRA1 Zornitza Stark gene: GABRA1 was added
gene: GABRA1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: GABRA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GABRA1 were set to Epilepsy, idiopathic generalised
Additional findings_Paediatric v0.2 FTCD Zornitza Stark gene: FTCD was added
gene: FTCD was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FTCD was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FTCD were set to Glutamate formiminotransferase deficiency
Additional findings_Paediatric v0.2 FSCN2 Zornitza Stark gene: FSCN2 was added
gene: FSCN2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FSCN2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: FSCN2 were set to Retinitis pigmentosa
Additional findings_Paediatric v0.2 FREM2 Zornitza Stark gene: FREM2 was added
gene: FREM2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FREM2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FREM2 were set to Fraser syndrome
Additional findings_Paediatric v0.2 FREM1 Zornitza Stark gene: FREM1 was added
gene: FREM1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FREM1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FREM1 were set to Manitoba oculotrichoanal syndrome
Additional findings_Paediatric v0.2 FOXN1 Zornitza Stark gene: FOXN1 was added
gene: FOXN1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FOXN1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FOXN1 were set to Congenital alopecia with T-cell immunodeficiency
Additional findings_Paediatric v0.2 FOXH1 Zornitza Stark gene: FOXH1 was added
gene: FOXH1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FOXH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: FOXH1 were set to Congenital heart defects
Additional findings_Paediatric v0.2 FOXF2 Zornitza Stark gene: FOXF2 was added
gene: FOXF2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FOXF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: FOXF2 were set to Disorders of sex development with cleft palate
Additional findings_Paediatric v0.2 FOXE1 Zornitza Stark gene: FOXE1 was added
gene: FOXE1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FOXE1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FOXE1 were set to Bamforth-Lazarus syndrome
Additional findings_Paediatric v0.2 FMO3 Zornitza Stark gene: FMO3 was added
gene: FMO3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FMO3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FMO3 were set to Trimethylaminuria
Additional findings_Paediatric v0.2 FLNC Zornitza Stark gene: FLNC was added
gene: FLNC was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FLNC was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: FLNC were set to Myofibrillar myopathy
Additional findings_Paediatric v0.2 FLG Zornitza Stark gene: FLG was added
gene: FLG was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FLG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: FLG were set to Ichthyosis vulgaris
Additional findings_Paediatric v0.2 FKBPL Zornitza Stark gene: FKBPL was added
gene: FKBPL was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FKBPL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: FKBPL were set to Infertility
Additional findings_Paediatric v0.2 FHL2 Zornitza Stark gene: FHL2 was added
gene: FHL2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FHL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: FHL2 were set to Cardiomyopathy, hypertrophic
Additional findings_Paediatric v0.2 FHL1 Zornitza Stark Source BabySeq Category C gene was added to FHL1.
Source Expert Review Red was added to FHL1.
Added phenotypes Myofibrillar myopathy for gene: FHL1
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 FH Zornitza Stark Source BabySeq Category C gene was added to FH.
Source Expert Review Red was added to FH.
Mode of inheritance for gene FH was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Leiomyomatosis and renal cell cancer for gene: FH
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 FGFR3 Zornitza Stark Added phenotypes LADD syndrome for gene: FGFR3
Additional findings_Paediatric v0.2 FGFR3 Zornitza Stark Source BabySeq Category C gene was added to FGFR3.
Source Expert Review Red was added to FGFR3.
Added phenotypes CATSHL syndrome for gene: FGFR3
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 FBN1 Zornitza Stark Added phenotypes Shprintzen-Goldberg syndrome for gene: FBN1
Additional findings_Paediatric v0.2 FBN1 Zornitza Stark Source BabySeq Category C gene was added to FBN1.
Source Expert Review Red was added to FBN1.
Added phenotypes Weill-Marchesani syndrome 2, dominant for gene: FBN1
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 FBLN5 Zornitza Stark Source BabySeq Category C gene was added to FBLN5.
Source Expert Review Red was added to FBLN5.
Mode of inheritance for gene FBLN5 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Age-related macular degeneration for gene: FBLN5
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 FANCM Zornitza Stark gene: FANCM was added
gene: FANCM was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FANCM was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FANCM were set to Fanconi anaemia
Additional findings_Paediatric v0.2 FANCL Zornitza Stark gene: FANCL was added
gene: FANCL was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FANCL was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FANCL were set to Fanconi anaemia
Additional findings_Paediatric v0.2 FANCF Zornitza Stark gene: FANCF was added
gene: FANCF was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FANCF was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FANCF were set to Fanconi anaemia
Additional findings_Paediatric v0.2 FANCE Zornitza Stark gene: FANCE was added
gene: FANCE was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FANCE was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FANCE were set to Fanconi anaemia
Additional findings_Paediatric v0.2 RETREG1 Zornitza Stark gene: RETREG1 was added
gene: RETREG1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: RETREG1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RETREG1 were set to Neuropathy, hereditary sensory and autonomic, type IIB
Additional findings_Paediatric v0.2 FAM111B Zornitza Stark gene: FAM111B was added
gene: FAM111B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FAM111B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: FAM111B were set to Hereditary fibrosing poikiloderma with tendon contracture, myopathy, and pulmonary fibrosis
Additional findings_Paediatric v0.2 FAAH2 Zornitza Stark gene: FAAH2 was added
gene: FAAH2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: FAAH2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: FAAH2 were set to Autism spectrum disorder
Additional findings_Paediatric v0.2 F5 Zornitza Stark gene: F5 was added
gene: F5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: F5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: F5 were set to Risk for deep vein thrombosis
Additional findings_Paediatric v0.2 ESPN Zornitza Stark gene: ESPN was added
gene: ESPN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ESPN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ESPN were set to Hearing loss
Additional findings_Paediatric v0.2 ERCC4 Zornitza Stark gene: ERCC4 was added
gene: ERCC4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ERCC4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ERCC4 were set to Xeroderma pigmentosum
Additional findings_Paediatric v0.2 ERCC3 Zornitza Stark gene: ERCC3 was added
gene: ERCC3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ERCC3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ERCC3 were set to Xeroderma pigmentosum
Additional findings_Paediatric v0.2 ERCC1 Zornitza Stark gene: ERCC1 was added
gene: ERCC1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ERCC1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ERCC1 were set to Xeroderma pigmentosum
Additional findings_Paediatric v0.2 ERBB3 Zornitza Stark gene: ERBB3 was added
gene: ERBB3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ERBB3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ERBB3 were set to Lethal congenital contractural syndrome 2
Additional findings_Paediatric v0.2 EPHX1 Zornitza Stark gene: EPHX1 was added
gene: EPHX1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: EPHX1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: EPHX1 were set to Hypercholanemia, familial
Additional findings_Paediatric v0.2 EPCAM Zornitza Stark gene: EPCAM was added
gene: EPCAM was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: EPCAM was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: EPCAM were set to Lynch syndrome
Additional findings_Paediatric v0.2 EPB42 Zornitza Stark gene: EPB42 was added
gene: EPB42 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: EPB42 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: EPB42 were set to Spherocytosis
Additional findings_Paediatric v0.2 EIF2B1 Zornitza Stark gene: EIF2B1 was added
gene: EIF2B1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: EIF2B1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: EIF2B1 were set to Leukoencephalopathy with vanishing white matter
Additional findings_Paediatric v0.2 EFEMP2 Zornitza Stark gene: EFEMP2 was added
gene: EFEMP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: EFEMP2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: EFEMP2 were set to Cutis laxa, autosomal recessive, type IB
Additional findings_Paediatric v0.2 EDNRB Zornitza Stark Added phenotypes Waardenburg syndrome for gene: EDNRB
Additional findings_Paediatric v0.2 EDNRB Zornitza Stark gene: EDNRB was added
gene: EDNRB was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: EDNRB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: EDNRB were set to Hirschsprung disease
Additional findings_Paediatric v0.2 EDN3 Zornitza Stark Added phenotypes Waardenburg syndrome for gene: EDN3
Additional findings_Paediatric v0.2 EDN3 Zornitza Stark gene: EDN3 was added
gene: EDN3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: EDN3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: EDN3 were set to Hirschsprung disease
Additional findings_Paediatric v0.2 ECE1 Zornitza Stark gene: ECE1 was added
gene: ECE1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ECE1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ECE1 were set to Hirschsprung disease
Additional findings_Paediatric v0.2 DUOXA2 Zornitza Stark gene: DUOXA2 was added
gene: DUOXA2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DUOXA2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DUOXA2 were set to Thyroid dyshormonogenesis
Additional findings_Paediatric v0.2 DTNBP1 Zornitza Stark gene: DTNBP1 was added
gene: DTNBP1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DTNBP1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DTNBP1 were set to Hermansky-Pudlak syndrome 7
Additional findings_Paediatric v0.2 DTNA Zornitza Stark gene: DTNA was added
gene: DTNA was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DTNA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DTNA were set to Left ventricular noncompaction 1
Additional findings_Paediatric v0.2 DTHD1 Zornitza Stark gene: DTHD1 was added
gene: DTHD1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DTHD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DTHD1 were set to Leber congenital amaurosis with myopathy
Additional findings_Paediatric v0.2 DPYD Zornitza Stark gene: DPYD was added
gene: DPYD was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DPYD was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DPYD were set to Dihydropyrimidine dehydrogenase deficiency
Additional findings_Paediatric v0.2 DPP6 Zornitza Stark gene: DPP6 was added
gene: DPP6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DPP6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DPP6 were set to Ventricular fibrillation, paroxysmal familial, 2
Additional findings_Paediatric v0.2 DPM1 Zornitza Stark gene: DPM1 was added
gene: DPM1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DPM1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DPM1 were set to Congenital disorder of glycosylation, type Ie
Additional findings_Paediatric v0.2 DOLK Zornitza Stark gene: DOLK was added
gene: DOLK was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DOLK was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DOLK were set to Congenital disorder of glycosylation, type Im
Additional findings_Paediatric v0.2 DNAL1 Zornitza Stark gene: DNAL1 was added
gene: DNAL1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DNAL1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DNAL1 were set to Primary ciliary dyskinesia
Additional findings_Paediatric v0.2 DNAJC5 Zornitza Stark gene: DNAJC5 was added
gene: DNAJC5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DNAJC5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DNAJC5 were set to Neuronal ceroid lipofuscinosis, adult-onset
Additional findings_Paediatric v0.2 DNAJC19 Zornitza Stark gene: DNAJC19 was added
gene: DNAJC19 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DNAJC19 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DNAJC19 were set to 3-methylglutaconic aciduria, type V
Additional findings_Paediatric v0.2 DNAI2 Zornitza Stark gene: DNAI2 was added
gene: DNAI2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DNAI2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DNAI2 were set to Primary ciliary dyskinesia
Additional findings_Paediatric v0.2 DNAAF3 Zornitza Stark gene: DNAAF3 was added
gene: DNAAF3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DNAAF3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DNAAF3 were set to Primary ciliary dyskinesia
Additional findings_Paediatric v0.2 DNAAF2 Zornitza Stark gene: DNAAF2 was added
gene: DNAAF2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DNAAF2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DNAAF2 were set to Primary ciliary dyskinesia
Additional findings_Paediatric v0.2 DLC1 Zornitza Stark gene: DLC1 was added
gene: DLC1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DLC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DLC1 were set to Congenital heart disease
Additional findings_Paediatric v0.2 DIAPH1 Zornitza Stark gene: DIAPH1 was added
gene: DIAPH1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DIAPH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DIAPH1 were set to Hearing loss
Additional findings_Paediatric v0.2 DIABLO Zornitza Stark gene: DIABLO was added
gene: DIABLO was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DIABLO was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DIABLO were set to Deafness, autosomal dominant
Additional findings_Paediatric v0.2 DHCR24 Zornitza Stark gene: DHCR24 was added
gene: DHCR24 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DHCR24 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DHCR24 were set to Desmosterolosis
Additional findings_Paediatric v0.2 DGKE Zornitza Stark gene: DGKE was added
gene: DGKE was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DGKE was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DGKE were set to Haemolytic uraemic syndrome, atypical
Additional findings_Paediatric v0.2 WHRN Zornitza Stark gene: WHRN was added
gene: WHRN was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: WHRN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WHRN were set to Hearing loss
Additional findings_Paediatric v0.2 DECR1 Zornitza Stark gene: DECR1 was added
gene: DECR1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DECR1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DECR1 were set to 2,4-Dienoyl-CoA reductase deficiency
Additional findings_Paediatric v0.2 DDR2 Zornitza Stark gene: DDR2 was added
gene: DDR2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DDR2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DDR2 were set to Spondylometaepiphyseal dysplasia, short limb-hand type
Additional findings_Paediatric v0.2 DDOST Zornitza Stark gene: DDOST was added
gene: DDOST was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DDOST was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DDOST were set to Congenital disorder of glycosylation, type Ir
Additional findings_Paediatric v0.2 DDHD1 Zornitza Stark gene: DDHD1 was added
gene: DDHD1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DDHD1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DDHD1 were set to Spastic paraplegia
Additional findings_Paediatric v0.2 DCX Zornitza Stark Source BabySeq Category C gene was added to DCX.
Source Expert Review Red was added to DCX.
Added phenotypes Lennox-Gastaut syndrome for gene: DCX
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 DCTN1 Zornitza Stark gene: DCTN1 was added
gene: DCTN1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DCTN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DCTN1 were set to Amyotrophic lateral sclerosis
Additional findings_Paediatric v0.2 DBH Zornitza Stark gene: DBH was added
gene: DBH was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DBH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DBH were set to Dopamine beta-hydroxylase deficiency
Additional findings_Paediatric v0.2 DAPK3 Zornitza Stark gene: DAPK3 was added
gene: DAPK3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DAPK3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DAPK3 were set to Congenital heart disease
Additional findings_Paediatric v0.2 DAG1 Zornitza Stark gene: DAG1 was added
gene: DAG1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: DAG1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DAG1 were set to Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 9
Additional findings_Paediatric v0.2 CYP7B1 Zornitza Stark gene: CYP7B1 was added
gene: CYP7B1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CYP7B1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CYP7B1 were set to Cholestasis, severe
Additional findings_Paediatric v0.2 CYP7A1 Zornitza Stark gene: CYP7A1 was added
gene: CYP7A1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CYP7A1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CYP7A1 were set to Hypercholesterolemia due to cholesterol 7alpha-hydroxylase deficiency
Additional findings_Paediatric v0.2 CYCS Zornitza Stark gene: CYCS was added
gene: CYCS was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CYCS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CYCS were set to Thrombocytopenia 4
Additional findings_Paediatric v0.2 CTF1 Zornitza Stark gene: CTF1 was added
gene: CTF1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CTF1 was set to Unknown
Phenotypes for gene: CTF1 were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 CTDP1 Zornitza Stark gene: CTDP1 was added
gene: CTDP1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CTDP1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CTDP1 were set to Congenital cataracts - facial dysmorphism - neuropathy
Additional findings_Paediatric v0.2 CSTA Zornitza Stark gene: CSTA was added
gene: CSTA was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CSTA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CSTA were set to Exfoliative ichthyosis
Additional findings_Paediatric v0.2 CSRP3 Zornitza Stark Source BabySeq Category C gene was added to CSRP3.
Source Expert Review Red was added to CSRP3.
Added phenotypes Cardiomyopathy, dilated, 1M for gene: CSRP3
Rating Changed from Amber List (moderate evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 CSF2RB Zornitza Stark gene: CSF2RB was added
gene: CSF2RB was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CSF2RB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CSF2RB were set to Pulmonary alveolar proteinosis
Additional findings_Paediatric v0.2 CSF1R Zornitza Stark gene: CSF1R was added
gene: CSF1R was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CSF1R was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CSF1R were set to Leukoencephalopathy, diffuse hereditary, with spheroids
Additional findings_Paediatric v0.2 CRELD1 Zornitza Stark gene: CRELD1 was added
gene: CRELD1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CRELD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CRELD1 were set to Cardiac atrioventricular septal defect
Additional findings_Paediatric v0.2 CR2 Zornitza Stark gene: CR2 was added
gene: CR2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CR2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CR2 were set to Hypogammaglobulinaemia
Additional findings_Paediatric v0.2 CPZ Zornitza Stark gene: CPZ was added
gene: CPZ was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CPZ was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CPZ were set to Autism
Additional findings_Paediatric v0.2 CPOX Zornitza Stark gene: CPOX was added
gene: CPOX was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CPOX was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CPOX were set to Coproporphyria
Additional findings_Paediatric v0.2 COX4I2 Zornitza Stark gene: COX4I2 was added
gene: COX4I2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: COX4I2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: COX4I2 were set to Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis
Additional findings_Paediatric v0.2 COQ6 Zornitza Stark gene: COQ6 was added
gene: COQ6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: COQ6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: COQ6 were set to Nephrotic syndrome with sensorineural deafness
Additional findings_Paediatric v0.2 COQ2 Zornitza Stark gene: COQ2 was added
gene: COQ2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: COQ2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: COQ2 were set to Coenzyme Q10 deficiency, primary, 1
Additional findings_Paediatric v0.2 COL9A2 Zornitza Stark gene: COL9A2 was added
gene: COL9A2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: COL9A2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: COL9A2 were set to Stickler syndrome
Additional findings_Paediatric v0.2 COL9A1 Zornitza Stark gene: COL9A1 was added
gene: COL9A1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: COL9A1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: COL9A1 were set to Stickler syndrome
Additional findings_Paediatric v0.2 COL1A1 Zornitza Stark Source BabySeq Category C gene was added to COL1A1.
Source Expert Review Red was added to COL1A1.
Added phenotypes Caffey disease for gene: COL1A1
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 COG7 Zornitza Stark gene: COG7 was added
gene: COG7 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: COG7 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: COG7 were set to Congenital disorder of glycosylation, type IIe
Additional findings_Paediatric v0.2 COG5 Zornitza Stark gene: COG5 was added
gene: COG5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: COG5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: COG5 were set to Congenital disorder of glycosylation, type IIi
Additional findings_Paediatric v0.2 COG4 Zornitza Stark gene: COG4 was added
gene: COG4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: COG4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: COG4 were set to Congenital disorder of glycosylation, type IIj
Additional findings_Paediatric v0.2 CNTNAP2 Zornitza Stark gene: CNTNAP2 was added
gene: CNTNAP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CNTNAP2 was set to Unknown
Phenotypes for gene: CNTNAP2 were set to Autism spectrum disorder
Additional findings_Paediatric v0.2 CLPP Zornitza Stark gene: CLPP was added
gene: CLPP was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CLPP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CLPP were set to Perrault syndrome
Additional findings_Paediatric v0.2 CLMP Zornitza Stark gene: CLMP was added
gene: CLMP was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CLMP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CLMP were set to Congenital short-bowel syndrome
Additional findings_Paediatric v0.2 CLDN1 Zornitza Stark gene: CLDN1 was added
gene: CLDN1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CLDN1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CLDN1 were set to Ichthyosis, leukocyte vacuoles, alopecia, and sclerosing cholangitis
Additional findings_Paediatric v0.2 CLCN7 Zornitza Stark gene: CLCN7 was added
gene: CLCN7 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CLCN7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CLCN7 were set to Osteopetrosis
Additional findings_Paediatric v0.2 CLCN1 Zornitza Stark gene: CLCN1 was added
gene: CLCN1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CLCN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CLCN1 were set to Myotonia congenita
Additional findings_Paediatric v0.2 CITED2 Zornitza Stark gene: CITED2 was added
gene: CITED2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CITED2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CITED2 were set to Congenital heart defects
Additional findings_Paediatric v0.2 CISD2 Zornitza Stark gene: CISD2 was added
gene: CISD2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CISD2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CISD2 were set to Wolfram syndrome
Additional findings_Paediatric v0.2 UTP4 Zornitza Stark gene: UTP4 was added
gene: UTP4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: UTP4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: UTP4 were set to North American Indian childhood cirrhosis
Additional findings_Paediatric v0.2 CHSY1 Zornitza Stark gene: CHSY1 was added
gene: CHSY1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CHSY1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CHSY1 were set to Temtamy preaxial brachydactyly syndrome
Additional findings_Paediatric v0.2 CHST3 Zornitza Stark gene: CHST3 was added
gene: CHST3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CHST3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CHST3 were set to Larsen syndrome
Additional findings_Paediatric v0.2 CHRNB1 Zornitza Stark gene: CHRNB1 was added
gene: CHRNB1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CHRNB1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CHRNB1 were set to Congenital myasthenic syndrome
Additional findings_Paediatric v0.2 CHRNA2 Zornitza Stark gene: CHRNA2 was added
gene: CHRNA2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CHRNA2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CHRNA2 were set to Epilepsy
Additional findings_Paediatric v0.2 CHRM2 Zornitza Stark gene: CHRM2 was added
gene: CHRM2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CHRM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CHRM2 were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 CHEK2 Zornitza Stark gene: CHEK2 was added
gene: CHEK2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CHEK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CHEK2 were set to Breast cancer, susceptibility to
Additional findings_Paediatric v0.2 CFI Zornitza Stark gene: CFI was added
gene: CFI was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CFI was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CFI were set to Haemolytic uraemic syndrome
Additional findings_Paediatric v0.2 CFHR5 Zornitza Stark gene: CFHR5 was added
gene: CFHR5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CFHR5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CFHR5 were set to Haemolytic uraemic syndrome
Additional findings_Paediatric v0.2 CFHR4 Zornitza Stark gene: CFHR4 was added
gene: CFHR4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CFHR4 was set to Unknown
Phenotypes for gene: CFHR4 were set to Hemolytic-uremic syndrome, atypical, susceptibility to
Additional findings_Paediatric v0.2 CFHR3 Zornitza Stark gene: CFHR3 was added
gene: CFHR3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CFHR3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CFHR3 were set to Haemolytic uraemic syndrome
Additional findings_Paediatric v0.2 CFHR1 Zornitza Stark gene: CFHR1 was added
gene: CFHR1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CFHR1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CFHR1 were set to Haemolytic uraemic syndrome
Additional findings_Paediatric v0.2 CFH Zornitza Stark gene: CFH was added
gene: CFH was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CFH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CFH were set to Haemolytic uraemic syndrome
Additional findings_Paediatric v0.2 CFD Zornitza Stark gene: CFD was added
gene: CFD was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CFD was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CFD were set to Complement factor D deficiency
Additional findings_Paediatric v0.2 CFB Zornitza Stark gene: CFB was added
gene: CFB was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CFB was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CFB were set to Haemolytic uraemic syndrome
Additional findings_Paediatric v0.2 CEP41 Zornitza Stark gene: CEP41 was added
gene: CEP41 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CEP41 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CEP41 were set to Joubert syndrome
Additional findings_Paediatric v0.2 CENPJ Zornitza Stark gene: CENPJ was added
gene: CENPJ was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CENPJ was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CENPJ were set to Primary microcephaly
Additional findings_Paediatric v0.2 CEACAM16 Zornitza Stark gene: CEACAM16 was added
gene: CEACAM16 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CEACAM16 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CEACAM16 were set to Hearing loss, autosomal dominant
Additional findings_Paediatric v0.2 CDT1 Zornitza Stark gene: CDT1 was added
gene: CDT1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CDT1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CDT1 were set to Meier-Gorlin syndrome
Additional findings_Paediatric v0.2 CDON Zornitza Stark gene: CDON was added
gene: CDON was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CDON was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CDON were set to Holoprosencephaly
Additional findings_Paediatric v0.2 CDK5RAP2 Zornitza Stark gene: CDK5RAP2 was added
gene: CDK5RAP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CDK5RAP2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CDK5RAP2 were set to Microcephaly 3, primary, autosomal recessive
Additional findings_Paediatric v0.2 CDH1 Zornitza Stark Source BabySeq Category C gene was added to CDH1.
Source Expert Review Red was added to CDH1.
Added phenotypes Orofacial clefts for gene: CDH1
Rating Changed from Amber List (moderate evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 CD96 Zornitza Stark gene: CD96 was added
gene: CD96 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CD96 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CD96 were set to C syndrome
Additional findings_Paediatric v0.2 CD46 Zornitza Stark gene: CD46 was added
gene: CD46 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CD46 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CD46 were set to Haemolytic uraemic syndrome
Additional findings_Paediatric v0.2 CD36 Zornitza Stark gene: CD36 was added
gene: CD36 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CD36 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CD36 were set to Platelet glycoprotein IV deficiency
Additional findings_Paediatric v0.2 CD2AP Zornitza Stark gene: CD2AP was added
gene: CD2AP was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CD2AP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CD2AP were set to Glomerulosclerosis, focal segmental, 3
Additional findings_Paediatric v0.2 CCDC88C Zornitza Stark gene: CCDC88C was added
gene: CCDC88C was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CCDC88C was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CCDC88C were set to Hydrocephalus
Additional findings_Paediatric v0.2 CCDC78 Zornitza Stark gene: CCDC78 was added
gene: CCDC78 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CCDC78 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CCDC78 were set to Congenital myopathy with prominent internal nuclei and atypical cores
Additional findings_Paediatric v0.2 CCDC50 Zornitza Stark gene: CCDC50 was added
gene: CCDC50 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CCDC50 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CCDC50 were set to Hearing loss
Additional findings_Paediatric v0.2 CCDC103 Zornitza Stark gene: CCDC103 was added
gene: CCDC103 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CCDC103 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CCDC103 were set to Primary ciliary dyskinesia
Additional findings_Paediatric v0.2 CAV3 Zornitza Stark Mode of inheritance for gene CAV3 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BIALLELIC, autosomal or pseudoautosomal
Added phenotypes Rippling muscle disease for gene: CAV3
Additional findings_Paediatric v0.2 CAV3 Zornitza Stark Added phenotypes Long QT syndrome-9 for gene: CAV3
Additional findings_Paediatric v0.2 CAV3 Zornitza Stark Source BabySeq Category C gene was added to CAV3.
Source Expert Review Red was added to CAV3.
Added phenotypes Cardiomyopathy, familial hypertrophic for gene: CAV3
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 CASP10 Zornitza Stark gene: CASP10 was added
gene: CASP10 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CASP10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CASP10 were set to Autoimmune lymphoproliferative syndrome II
Additional findings_Paediatric v0.2 CARS2 Zornitza Stark gene: CARS2 was added
gene: CARS2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CARS2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CARS2 were set to Epileptic encephalopathy
Additional findings_Paediatric v0.2 CACNB2 Zornitza Stark gene: CACNB2 was added
gene: CACNB2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CACNB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CACNB2 were set to Brugada syndrome
Additional findings_Paediatric v0.2 CACNA2D1 Zornitza Stark gene: CACNA2D1 was added
gene: CACNA2D1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CACNA2D1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CACNA2D1 were set to Brugada syndrome
Additional findings_Paediatric v0.2 CACNA1S Zornitza Stark gene: CACNA1S was added
gene: CACNA1S was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CACNA1S was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CACNA1S were set to Malignant hyperthermia
Additional findings_Paediatric v0.2 CACNA1D Zornitza Stark gene: CACNA1D was added
gene: CACNA1D was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: CACNA1D was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CACNA1D were set to Sinoatrial node dysfunction and deafness
Additional findings_Paediatric v0.2 C3 Zornitza Stark gene: C3 was added
gene: C3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: C3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: C3 were set to Haemolytic uraemic syndrome
Additional findings_Paediatric v0.2 BVES Zornitza Stark gene: BVES was added
gene: BVES was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: BVES was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: BVES were set to Congenital heart disease
Additional findings_Paediatric v0.2 BSCL2 Zornitza Stark Source BabySeq Category C gene was added to BSCL2.
Source Expert Review Red was added to BSCL2.
Mode of inheritance for gene BSCL2 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Silver spastic paraplegia syndrome for gene: BSCL2
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 BRCA2 Zornitza Stark Source BabySeq Category C gene was added to BRCA2.
Source Expert Review Red was added to BRCA2.
Mode of inheritance for gene BRCA2 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Breast-ovarian cancer, familial, 2 for gene: BRCA2
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 BRCA1 Zornitza Stark gene: BRCA1 was added
gene: BRCA1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: BRCA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: BRCA1 were set to Breast-ovarian cancer, familial, 1
Additional findings_Paediatric v0.2 BRAF Zornitza Stark Source BabySeq Category C gene was added to BRAF.
Source Expert Review Red was added to BRAF.
Added phenotypes LEOPARD syndrome for gene: BRAF
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 BPGM Zornitza Stark gene: BPGM was added
gene: BPGM was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: BPGM was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BPGM were set to Erythrocytosis due to bisphosphoglycerate mutase deficiency
Additional findings_Paediatric v0.2 BNC2 Zornitza Stark gene: BNC2 was added
gene: BNC2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: BNC2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: BNC2 were set to Total anomalous pulmonary venous return
Additional findings_Paediatric v0.2 BMPR1A Zornitza Stark Source BabySeq Category C gene was added to BMPR1A.
Source Expert Review Red was added to BMPR1A.
Added phenotypes Tetralogy of Fallot for gene: BMPR1A
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 BLOC1S6 Zornitza Stark gene: BLOC1S6 was added
gene: BLOC1S6 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: BLOC1S6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BLOC1S6 were set to Hermansky-pudlak syndrome 9
Additional findings_Paediatric v0.2 BLOC1S3 Zornitza Stark gene: BLOC1S3 was added
gene: BLOC1S3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: BLOC1S3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BLOC1S3 were set to Hermansky-Pudlak syndrome 8
Additional findings_Paediatric v0.2 BDNF Zornitza Stark gene: BDNF was added
gene: BDNF was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: BDNF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: BDNF were set to Central hypoventilation syndrome
Additional findings_Paediatric v0.2 BCL9 Zornitza Stark gene: BCL9 was added
gene: BCL9 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: BCL9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: BCL9 were set to Congenital heart disease
Additional findings_Paediatric v0.2 BARD1 Zornitza Stark gene: BARD1 was added
gene: BARD1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: BARD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: BARD1 were set to Tetralogy of Fallot
Additional findings_Paediatric v0.2 BANF1 Zornitza Stark gene: BANF1 was added
gene: BANF1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: BANF1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BANF1 were set to Progeroid syndrome
Additional findings_Paediatric v0.2 BAG3 Zornitza Stark Source BabySeq Category C gene was added to BAG3.
Source Expert Review Red was added to BAG3.
Added phenotypes Myopathy, myofibrillar for gene: BAG3
Rating Changed from Amber List (moderate evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 B9D2 Zornitza Stark gene: B9D2 was added
gene: B9D2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: B9D2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: B9D2 were set to Meckel syndrome
Additional findings_Paediatric v0.2 B4GALT1 Zornitza Stark gene: B4GALT1 was added
gene: B4GALT1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: B4GALT1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: B4GALT1 were set to CDG syndrome type IId
Additional findings_Paediatric v0.2 B3GAT3 Zornitza Stark gene: B3GAT3 was added
gene: B3GAT3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: B3GAT3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: B3GAT3 were set to Multiple joint dislocations, short stature, craniofacial dysmorphism, and congenital heart defects
Additional findings_Paediatric v0.2 AXL Zornitza Stark gene: AXL was added
gene: AXL was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: AXL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: AXL were set to Hypogonadotropic hypogonadism
Additional findings_Paediatric v0.2 ATR Zornitza Stark gene: ATR was added
gene: ATR was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ATR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ATR were set to Seckel syndrome
Additional findings_Paediatric v0.2 ATP7A Zornitza Stark Source BabySeq Category C gene was added to ATP7A.
Source Expert Review Red was added to ATP7A.
Added phenotypes Spinal muscular atrophy, distal, X-linked 3 for gene: ATP7A
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 ATP6AP2 Zornitza Stark gene: ATP6AP2 was added
gene: ATP6AP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ATP6AP2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: ATP6AP2 were set to X-linked recessive intellectual deficit - epilepsy
Additional findings_Paediatric v0.2 ATP1A3 Zornitza Stark gene: ATP1A3 was added
gene: ATP1A3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ATP1A3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ATP1A3 were set to Rapid-onset dystonia-parkinsonism
Additional findings_Paediatric v0.2 ATN1 Zornitza Stark gene: ATN1 was added
gene: ATN1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ATN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ATN1 were set to Dentatorubral-pallidoluysian atrophy 1
Additional findings_Paediatric v0.2 ATIC Zornitza Stark gene: ATIC was added
gene: ATIC was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ATIC was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ATIC were set to AICA-Ribosiduria
Additional findings_Paediatric v0.2 ASNS Zornitza Stark gene: ASNS was added
gene: ASNS was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ASNS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ASNS were set to Microcephaly, intellectual disability, cerebral atrophy & intractable seizures
Additional findings_Paediatric v0.2 ASCL1 Zornitza Stark gene: ASCL1 was added
gene: ASCL1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ASCL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ASCL1 were set to Congenital central hypoventilation
Additional findings_Paediatric v0.2 ARSE Zornitza Stark gene: ARSE was added
gene: ARSE was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ARSE was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: ARSE were set to Chondrodysplasia punctata, X-linked recessive
Additional findings_Paediatric v0.2 ARL13B Zornitza Stark gene: ARL13B was added
gene: ARL13B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ARL13B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ARL13B were set to Joubert syndrome
Additional findings_Paediatric v0.2 ARID1A Zornitza Stark gene: ARID1A was added
gene: ARID1A was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ARID1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ARID1A were set to Coffin-Siris syndrome
Additional findings_Paediatric v0.2 ARHGEF9 Zornitza Stark gene: ARHGEF9 was added
gene: ARHGEF9 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ARHGEF9 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: ARHGEF9 were set to Hyperekplexia and epilepsy
Additional findings_Paediatric v0.2 ARHGAP31 Zornitza Stark gene: ARHGAP31 was added
gene: ARHGAP31 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ARHGAP31 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ARHGAP31 were set to Syndromic cutis aplasia & limb anomalies
Additional findings_Paediatric v0.2 AR Zornitza Stark Source BabySeq Category C gene was added to AR.
Source Expert Review Red was added to AR.
Added phenotypes Spinal and bulbar muscular atrophy of Kennedy for gene: AR
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 APRT Zornitza Stark gene: APRT was added
gene: APRT was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: APRT was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: APRT were set to Adenine phosphoribosyltransferase deficiency
Additional findings_Paediatric v0.2 APP Zornitza Stark gene: APP was added
gene: APP was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: APP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: APP were set to Alzheimer disease 1, familial
Additional findings_Paediatric v0.2 APOE Zornitza Stark gene: APOE was added
gene: APOE was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: APOE was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: APOE were set to Sea-blue histiocyte disease
Additional findings_Paediatric v0.2 AP4M1 Zornitza Stark gene: AP4M1 was added
gene: AP4M1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: AP4M1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AP4M1 were set to Spastic paraplegia 50, autosomal recessive
Additional findings_Paediatric v0.2 AP1S3 Zornitza Stark gene: AP1S3 was added
gene: AP1S3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: AP1S3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: AP1S3 were set to Pustular psoriasis
Additional findings_Paediatric v0.2 ANO5 Zornitza Stark Source BabySeq Category C gene was added to ANO5.
Source Expert Review Red was added to ANO5.
Mode of inheritance for gene ANO5 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Gnathodiaphyseal dysplasia for gene: ANO5
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 ANKRD1 Zornitza Stark Source BabySeq Category C gene was added to ANKRD1.
Source Expert Review Red was added to ANKRD1.
Added phenotypes Cardiomyopathy, hypertrophic for gene: ANKRD1
Rating Changed from Amber List (moderate evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 AMPD1 Zornitza Stark gene: AMPD1 was added
gene: AMPD1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: AMPD1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AMPD1 were set to Adenosine monophosphate deaminase deficiency
Additional findings_Paediatric v0.2 AMACR Zornitza Stark Added phenotypes Alpha-methylacyl-CoA racemase deficiency for gene: AMACR
Additional findings_Paediatric v0.2 AMACR Zornitza Stark gene: AMACR was added
gene: AMACR was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: AMACR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AMACR were set to Bile acid synthesis defect, congenital, 4
Additional findings_Paediatric v0.2 ALG9 Zornitza Stark gene: ALG9 was added
gene: ALG9 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ALG9 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ALG9 were set to Congenital disorder of glycosylation, type Il
Additional findings_Paediatric v0.2 ALG2 Zornitza Stark gene: ALG2 was added
gene: ALG2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ALG2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ALG2 were set to Congenital disorder of glycosylation, type Ii
Additional findings_Paediatric v0.2 ALG11 Zornitza Stark gene: ALG11 was added
gene: ALG11 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ALG11 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ALG11 were set to Congenital disorder of glycosylation type 1P
Additional findings_Paediatric v0.2 ALDOA Zornitza Stark gene: ALDOA was added
gene: ALDOA was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ALDOA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ALDOA were set to Aldolase A deficiency
Additional findings_Paediatric v0.2 ALDH4A1 Zornitza Stark gene: ALDH4A1 was added
gene: ALDH4A1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ALDH4A1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ALDH4A1 were set to Hyperprolinemia, type II
Additional findings_Paediatric v0.2 ALDH1A2 Zornitza Stark gene: ALDH1A2 was added
gene: ALDH1A2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ALDH1A2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ALDH1A2 were set to Tetralogy of Fallot
Additional findings_Paediatric v0.2 AKT3 Zornitza Stark gene: AKT3 was added
gene: AKT3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: AKT3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: AKT3 were set to Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome
Additional findings_Paediatric v0.2 AKT2 Zornitza Stark gene: AKT2 was added
gene: AKT2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: AKT2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: AKT2 were set to Severe insulin resistance and diabetes mellitus
Additional findings_Paediatric v0.2 AKAP9 Zornitza Stark gene: AKAP9 was added
gene: AKAP9 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: AKAP9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: AKAP9 were set to Long QT syndrome
Additional findings_Paediatric v0.2 AK1 Zornitza Stark gene: AK1 was added
gene: AK1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: AK1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AK1 were set to Hemolytic anemia due to adenylate kinase deficiency
Additional findings_Paediatric v0.2 AHSP Zornitza Stark gene: AHSP was added
gene: AHSP was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: AHSP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AHSP were set to Thalassaemia
Additional findings_Paediatric v0.2 AGTR1 Zornitza Stark gene: AGTR1 was added
gene: AGTR1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: AGTR1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AGTR1 were set to Renal tubular dysgenesis
Additional findings_Paediatric v0.2 AGT Zornitza Stark gene: AGT was added
gene: AGT was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: AGT was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AGT were set to Renal tubular dysgenesis
Additional findings_Paediatric v0.2 AGPS Zornitza Stark gene: AGPS was added
gene: AGPS was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: AGPS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AGPS were set to Rhizomelic chondrodysplasia punctata, type 3
Additional findings_Paediatric v0.2 ADAMTS2 Zornitza Stark gene: ADAMTS2 was added
gene: ADAMTS2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ADAMTS2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ADAMTS2 were set to Ehlers-Danlos syndrome VIIc
Additional findings_Paediatric v0.2 ADAM17 Zornitza Stark gene: ADAM17 was added
gene: ADAM17 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ADAM17 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ADAM17 were set to Neonatal inflammatory skin and bowel disease
Additional findings_Paediatric v0.2 ACVR2B Zornitza Stark gene: ACVR2B was added
gene: ACVR2B was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ACVR2B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ACVR2B were set to Left-right axis malformation
Additional findings_Paediatric v0.2 ACTN2 Zornitza Stark Source BabySeq Category C gene was added to ACTN2.
Source Expert Review Red was added to ACTN2.
Added phenotypes Cardiomyopathy, dilated for gene: ACTN2
Rating Changed from Amber List (moderate evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 ACTC1 Zornitza Stark Added phenotypes Left ventricular noncompaction for gene: ACTC1
Additional findings_Paediatric v0.2 ACTC1 Zornitza Stark Source BabySeq Category C gene was added to ACTC1.
Source Expert Review Red was added to ACTC1.
Added phenotypes Atrial septal defect for gene: ACTC1
Rating Changed from Amber List (moderate evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 ACTB Zornitza Stark Source BabySeq Category C gene was added to ACTB.
Source Expert Review Red was added to ACTB.
Added phenotypes Neutrophil dysfunction and recurrent infection for gene: ACTB
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 ACTA1 Zornitza Stark Source BabySeq Category C gene was added to ACTA1.
Source Expert Review Red was added to ACTA1.
Added phenotypes Congenital myopathy with fiber type disproportion for gene: ACTA1
Rating Changed from Green List (high evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 ACO2 Zornitza Stark gene: ACO2 was added
gene: ACO2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ACO2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ACO2 were set to Cerebellar-retinal degeneration, infantile
Additional findings_Paediatric v0.2 ACBD5 Zornitza Stark gene: ACBD5 was added
gene: ACBD5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ACBD5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ACBD5 were set to Thrombocytopaenia
Additional findings_Paediatric v0.2 ACADSB Zornitza Stark gene: ACADSB was added
gene: ACADSB was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ACADSB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ACADSB were set to 2-Methylbutyryl-CoA dehydrogenase deficiency
Additional findings_Paediatric v0.2 ACADS Zornitza Stark gene: ACADS was added
gene: ACADS was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ACADS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ACADS were set to Acyl-CoA dehydrogenase, short-chain, deficiency of
Additional findings_Paediatric v0.2 ACADL Zornitza Stark gene: ACADL was added
gene: ACADL was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ACADL was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ACADL were set to Sudden infant death
Additional findings_Paediatric v0.2 ABCD4 Zornitza Stark gene: ABCD4 was added
gene: ABCD4 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ABCD4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ABCD4 were set to Methylmalonic aciduria and homocystinuria, cblJ type
Additional findings_Paediatric v0.2 ABCC9 Zornitza Stark Source BabySeq Category C gene was added to ABCC9.
Source Expert Review Red was added to ABCC9.
Added phenotypes Atrial fibrillation, familial for gene: ABCC9
Rating Changed from Amber List (moderate evidence) to Red List (low evidence)
Additional findings_Paediatric v0.2 ABCC2 Zornitza Stark gene: ABCC2 was added
gene: ABCC2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ABCC2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ABCC2 were set to Dubin-Johnson syndrome
Additional findings_Paediatric v0.2 ABCB7 Zornitza Stark gene: ABCB7 was added
gene: ABCB7 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ABCB7 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: ABCB7 were set to Sideroblastic anaemia and ataxia
Additional findings_Paediatric v0.2 ABAT Zornitza Stark gene: ABAT was added
gene: ABAT was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: ABAT was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ABAT were set to GABA-transaminase deficiency
Additional findings_Paediatric v0.2 AARS2 Zornitza Stark gene: AARS2 was added
gene: AARS2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category C gene,Expert Review Red
Mode of inheritance for gene: AARS2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AARS2 were set to Leukoencephalopathy, and ovarian failure in females
Additional findings_Paediatric v0.2 WT1 Zornitza Stark Source BabySeq Category B gene was added to WT1.
Source Expert Review Amber was added to WT1.
Added phenotypes Wilms tumor, type 1 for gene: WT1
Rating Changed from Green List (high evidence) to Amber List (moderate evidence)
Additional findings_Paediatric v0.2 VWF Zornitza Stark gene: VWF was added
gene: VWF was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: VWF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: VWF were set to von Willebrand disease
Additional findings_Paediatric v0.2 VCL Zornitza Stark gene: VCL was added
gene: VCL was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: VCL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: VCL were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 TTN Zornitza Stark Source BabySeq Category B gene was added to TTN.
Source Expert Review Amber was added to TTN.
Mode of inheritance for gene TTN was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Cardiomyopathy, dilated for gene: TTN
Rating Changed from Green List (high evidence) to Amber List (moderate evidence)
Additional findings_Paediatric v0.2 TPM1 Zornitza Stark gene: TPM1 was added
gene: TPM1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: TPM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TPM1 were set to Cardiomyopathy, hypertrophic
Additional findings_Paediatric v0.2 TNNT2 Zornitza Stark Added phenotypes Familial hypertrophic cardiomyopathy for gene: TNNT2
Additional findings_Paediatric v0.2 TNNT2 Zornitza Stark gene: TNNT2 was added
gene: TNNT2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: TNNT2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TNNT2 were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 TNNI3 Zornitza Stark Added phenotypes Familial hypertrophic cardiomyopathy for gene: TNNI3
Additional findings_Paediatric v0.2 TNNI3 Zornitza Stark gene: TNNI3 was added
gene: TNNI3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: TNNI3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TNNI3 were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 TNNC1 Zornitza Stark gene: TNNC1 was added
gene: TNNC1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: TNNC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TNNC1 were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 TINF2 Zornitza Stark gene: TINF2 was added
gene: TINF2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: TINF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TINF2 were set to Dyskeratosis congenita
Additional findings_Paediatric v0.2 TERT Zornitza Stark gene: TERT was added
gene: TERT was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: TERT was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TERT were set to Dyskeratosis congenita
Additional findings_Paediatric v0.2 TERC Zornitza Stark gene: TERC was added
gene: TERC was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: TERC was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TERC were set to Dyskeratosis congenita
Additional findings_Paediatric v0.2 SNTA1 Zornitza Stark gene: SNTA1 was added
gene: SNTA1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: SNTA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SNTA1 were set to Long QT syndrome
Additional findings_Paediatric v0.2 SDHC Zornitza Stark gene: SDHC was added
gene: SDHC was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: SDHC was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SDHC were set to Hereditary Paraganglioma-Pheochromocytoma Syndromes
Additional findings_Paediatric v0.2 SDHB Zornitza Stark gene: SDHB was added
gene: SDHB was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: SDHB was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SDHB were set to Hereditary Paraganglioma-Pheochromocytoma Syndromes
Additional findings_Paediatric v0.2 SDHAF2 Zornitza Stark gene: SDHAF2 was added
gene: SDHAF2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: SDHAF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SDHAF2 were set to Hereditary Paraganglioma-Pheochromocytoma Syndromes
Additional findings_Paediatric v0.2 SCN5A Zornitza Stark Added phenotypes Brugada syndrome for gene: SCN5A
Additional findings_Paediatric v0.2 SCN5A Zornitza Stark gene: SCN5A was added
gene: SCN5A was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: SCN5A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SCN5A were set to Long QT syndrome
Additional findings_Paediatric v0.2 RYR1 Zornitza Stark Source BabySeq Category B gene was added to RYR1.
Source Expert Review Amber was added to RYR1.
Mode of inheritance for gene RYR1 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Malignant hyperthermia for gene: RYR1
Rating Changed from Green List (high evidence) to Amber List (moderate evidence)
Additional findings_Paediatric v0.2 RBM20 Zornitza Stark gene: RBM20 was added
gene: RBM20 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: RBM20 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RBM20 were set to Cardiomyopathy, dilated, 1DD
Additional findings_Paediatric v0.2 PRKAG2 Zornitza Stark Source BabySeq Category B gene was added to PRKAG2.
Source Expert Review Amber was added to PRKAG2.
Added phenotypes Cardiomyopathy, hypertrophic for gene: PRKAG2
Rating Changed from Green List (high evidence) to Amber List (moderate evidence)
Additional findings_Paediatric v0.2 PLN Zornitza Stark gene: PLN was added
gene: PLN was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: PLN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PLN were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 PKP2 Zornitza Stark gene: PKP2 was added
gene: PKP2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: PKP2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PKP2 were set to Arrhythmogenic right ventricular dysplasia 9
Additional findings_Paediatric v0.2 PHOX2B Zornitza Stark gene: PHOX2B was added
gene: PHOX2B was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: PHOX2B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PHOX2B were set to Central hypoventilation syndrome
Additional findings_Paediatric v0.2 PCSK9 Zornitza Stark gene: PCSK9 was added
gene: PCSK9 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: PCSK9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PCSK9 were set to Hypercholesterolemia
Additional findings_Paediatric v0.2 NKX2-5 Zornitza Stark gene: NKX2-5 was added
gene: NKX2-5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: NKX2-5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NKX2-5 were set to Congenital heart disease
Additional findings_Paediatric v0.2 MYLK Zornitza Stark gene: MYLK was added
gene: MYLK was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: MYLK was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYLK were set to Aortic aneurysm, familial thoracic 7
Additional findings_Paediatric v0.2 MYL3 Zornitza Stark gene: MYL3 was added
gene: MYL3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: MYL3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYL3 were set to Cardiomyopathy, familial hypertrophic, 8
Additional findings_Paediatric v0.2 MYL2 Zornitza Stark gene: MYL2 was added
gene: MYL2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: MYL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYL2 were set to Cardiomyopathy, familial hypertrophic, 10
Additional findings_Paediatric v0.2 MYH7 Zornitza Stark Added phenotypes Left ventricular noncompaction for gene: MYH7
Additional findings_Paediatric v0.2 MYH7 Zornitza Stark Added phenotypes Cardiomyopathy, dilated for gene: MYH7
Additional findings_Paediatric v0.2 MYH7 Zornitza Stark Source BabySeq Category B gene was added to MYH7.
Source Expert Review Amber was added to MYH7.
Added phenotypes Cardiomyopathy, familial hypertrophic for gene: MYH7
Rating Changed from Green List (high evidence) to Amber List (moderate evidence)
Additional findings_Paediatric v0.2 MYH11 Zornitza Stark gene: MYH11 was added
gene: MYH11 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: MYH11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYH11 were set to Aortic aneurysm, familial thoracic 4
Additional findings_Paediatric v0.2 MYBPC3 Zornitza Stark gene: MYBPC3 was added
gene: MYBPC3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: MYBPC3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYBPC3 were set to Cardiomyopathy, familial hypertrophic
Additional findings_Paediatric v0.2 MTHFR Zornitza Stark gene: MTHFR was added
gene: MTHFR was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: MTHFR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MTHFR were set to Homocystinuria due to MTHFR deficiency
Additional findings_Paediatric v0.2 MCCC2 Zornitza Stark gene: MCCC2 was added
gene: MCCC2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: MCCC2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MCCC2 were set to 3-Methylcrotonyl-CoA carboxylase 2 deficiency
Additional findings_Paediatric v0.2 MCCC1 Zornitza Stark gene: MCCC1 was added
gene: MCCC1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: MCCC1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MCCC1 were set to 3-Methylcrotonyl-CoA carboxylase 1 deficiency
Additional findings_Paediatric v0.2 LMNA Zornitza Stark Source BabySeq Category B gene was added to LMNA.
Source Expert Review Amber was added to LMNA.
Mode of inheritance for gene LMNA was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Dilated cardiomyopathy for gene: LMNA
Rating Changed from Green List (high evidence) to Amber List (moderate evidence)
Additional findings_Paediatric v0.2 KCNQ1 Zornitza Stark Source BabySeq Category B gene was added to KCNQ1.
Source Expert Review Amber was added to KCNQ1.
Mode of inheritance for gene KCNQ1 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Long QT syndrome-1 for gene: KCNQ1
Rating Changed from Green List (high evidence) to Amber List (moderate evidence)
Additional findings_Paediatric v0.2 KCNH2 Zornitza Stark gene: KCNH2 was added
gene: KCNH2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: KCNH2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KCNH2 were set to Long QT syndrome-2
Additional findings_Paediatric v0.2 KCNE2 Zornitza Stark gene: KCNE2 was added
gene: KCNE2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: KCNE2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KCNE2 were set to Long QT syndrome-6
Additional findings_Paediatric v0.2 KCNE1 Zornitza Stark Source BabySeq Category B gene was added to KCNE1.
Source Expert Review Amber was added to KCNE1.
Mode of inheritance for gene KCNE1 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Long QT syndrome-5 for gene: KCNE1
Rating Changed from Green List (high evidence) to Amber List (moderate evidence)
Additional findings_Paediatric v0.2 KCNA5 Zornitza Stark gene: KCNA5 was added
gene: KCNA5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: KCNA5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KCNA5 were set to Atrial fibrillation
Additional findings_Paediatric v0.2 JUP Zornitza Stark Source BabySeq Category B gene was added to JUP.
Source Expert Review Amber was added to JUP.
Mode of inheritance for gene JUP was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Arrhythmogenic right ventricular dysplasia 12 for gene: JUP
Rating Changed from Green List (high evidence) to Amber List (moderate evidence)
Additional findings_Paediatric v0.2 GPD1L Zornitza Stark gene: GPD1L was added
gene: GPD1L was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: GPD1L was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GPD1L were set to Brugada syndrome
Additional findings_Paediatric v0.2 GJA5 Zornitza Stark gene: GJA5 was added
gene: GJA5 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: GJA5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GJA5 were set to Atrial fibrillation
Additional findings_Paediatric v0.2 GCH1 Zornitza Stark gene: GCH1 was added
gene: GCH1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: GCH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GCH1 were set to Dystonia, dopa-responsive
Additional findings_Paediatric v0.2 DSP Zornitza Stark Source BabySeq Category B gene was added to DSP.
Source Expert Review Amber was added to DSP.
Added phenotypes Arrhythmogenic right ventricular dysplasia/cardiomyopathy for gene: DSP
Rating Changed from Green List (high evidence) to Amber List (moderate evidence)
Additional findings_Paediatric v0.2 DSG2 Zornitza Stark gene: DSG2 was added
gene: DSG2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: DSG2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DSG2 were set to Arrhythmogenic right ventricular cardiomyopathy
Additional findings_Paediatric v0.2 DSC2 Zornitza Stark gene: DSC2 was added
gene: DSC2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: DSC2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DSC2 were set to Arrhythmogenic right ventricular cardiomyopathy
Additional findings_Paediatric v0.2 DMD Zornitza Stark Source BabySeq Category B gene was added to DMD.
Source Expert Review Amber was added to DMD.
Added phenotypes Cardiomyopathy, dilated for gene: DMD
Rating Changed from Green List (high evidence) to Amber List (moderate evidence)
Additional findings_Paediatric v0.2 DKC1 Zornitza Stark gene: DKC1 was added
gene: DKC1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: DKC1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: DKC1 were set to Dyskeratosis congenita
Additional findings_Paediatric v0.2 DES Zornitza Stark Source BabySeq Category B gene was added to DES.
Source Expert Review Amber was added to DES.
Added phenotypes Cardiomyopathy, dilated for gene: DES
Rating Changed from Green List (high evidence) to Amber List (moderate evidence)
Additional findings_Paediatric v0.2 CSRP3 Zornitza Stark gene: CSRP3 was added
gene: CSRP3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: CSRP3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CSRP3 were set to Cardiomyopathy, familial hypertrophic, 12
Additional findings_Paediatric v0.2 CRYAB Zornitza Stark Source BabySeq Category B gene was added to CRYAB.
Source Expert Review Amber was added to CRYAB.
Added phenotypes Cardiomyopathy, dilated for gene: CRYAB
Rating Changed from Green List (high evidence) to Amber List (moderate evidence)
Additional findings_Paediatric v0.2 CP Zornitza Stark gene: CP was added
gene: CP was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: CP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CP were set to Aceruloplasminaemia
Additional findings_Paediatric v0.2 CDKN2A Zornitza Stark gene: CDKN2A was added
gene: CDKN2A was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: CDKN2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CDKN2A were set to Melanoma
Additional findings_Paediatric v0.2 CDH1 Zornitza Stark gene: CDH1 was added
gene: CDH1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: CDH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CDH1 were set to Gastric cancer
Additional findings_Paediatric v0.2 CACNA1C Zornitza Stark gene: CACNA1C was added
gene: CACNA1C was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: CACNA1C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CACNA1C were set to Brugada syndrome
Additional findings_Paediatric v0.2 BMPR2 Zornitza Stark gene: BMPR2 was added
gene: BMPR2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: BMPR2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: BMPR2 were set to Pulmonary hypertension, familial primary
Additional findings_Paediatric v0.2 BAG3 Zornitza Stark gene: BAG3 was added
gene: BAG3 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: BAG3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: BAG3 were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 ANKRD1 Zornitza Stark gene: ANKRD1 was added
gene: ANKRD1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: ANKRD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ANKRD1 were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 ANK2 Zornitza Stark gene: ANK2 was added
gene: ANK2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: ANK2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ANK2 were set to Long QT syndrome
Additional findings_Paediatric v0.2 AIP Zornitza Stark gene: AIP was added
gene: AIP was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: AIP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: AIP were set to Pituitary adenoma
Additional findings_Paediatric v0.2 ACTN2 Zornitza Stark gene: ACTN2 was added
gene: ACTN2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: ACTN2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ACTN2 were set to Cardiomyopathy, familial hypertrophic
Additional findings_Paediatric v0.2 ACTC1 Zornitza Stark Added phenotypes Cardiomyopathy, familial hypertrophic for gene: ACTC1
Additional findings_Paediatric v0.2 ACTC1 Zornitza Stark gene: ACTC1 was added
gene: ACTC1 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: ACTC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ACTC1 were set to Cardiomyopathy, dilated
Additional findings_Paediatric v0.2 ACTA2 Zornitza Stark gene: ACTA2 was added
gene: ACTA2 was added to Newborn Screening_BabySeq. Sources: BabySeq Category B gene,Expert Review Amber
Mode of inheritance for gene: ACTA2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ACTA2 were set to Aortic aneurysm, familial thoracic
Additional findings_Paediatric v0.2 ABCC9 Zornitza Stark Source BabySeq Category B gene was added to ABCC9.
Source Expert Review Amber was added to ABCC9.
Added phenotypes Cardiomyopathy, dilated for gene: ABCC9
Rating Changed from Green List (high evidence) to Amber List (moderate evidence)
Additional findings_Paediatric v0.2 ZNF469 Zornitza Stark gene: ZNF469 was added
gene: ZNF469 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ZNF469 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ZNF469 were set to Brittle cornea syndrome
Additional findings_Paediatric v0.2 ZMPSTE24 Zornitza Stark gene: ZMPSTE24 was added
gene: ZMPSTE24 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ZMPSTE24 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ZMPSTE24 were set to Restrictive dermopathy
Additional findings_Paediatric v0.2 ZIC3 Zornitza Stark gene: ZIC3 was added
gene: ZIC3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ZIC3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: ZIC3 were set to Heterotaxy
Additional findings_Paediatric v0.2 ZIC2 Zornitza Stark gene: ZIC2 was added
gene: ZIC2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ZIC2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ZIC2 were set to Holoprosencephaly-5
Additional findings_Paediatric v0.2 ZEB2 Zornitza Stark gene: ZEB2 was added
gene: ZEB2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ZEB2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ZEB2 were set to Mowat-Wilson syndrome
Additional findings_Paediatric v0.2 ZAP70 Zornitza Stark gene: ZAP70 was added
gene: ZAP70 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ZAP70 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ZAP70 were set to ZAP70-related severe combined immunodeficiency
Additional findings_Paediatric v0.2 XPC Zornitza Stark gene: XPC was added
gene: XPC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: XPC was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: XPC were set to Xeroderma pigmentosum
Additional findings_Paediatric v0.2 XPA Zornitza Stark gene: XPA was added
gene: XPA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: XPA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: XPA were set to Xeroderma pigmentosum
Additional findings_Paediatric v0.2 WT1 Zornitza Stark Added phenotypes Frasier syndrome for gene: WT1
Additional findings_Paediatric v0.2 WT1 Zornitza Stark gene: WT1 was added
gene: WT1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: WT1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: WT1 were set to Denys-Drash syndrome
Additional findings_Paediatric v0.2 WRN Zornitza Stark gene: WRN was added
gene: WRN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: WRN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WRN were set to Werner syndrome
Additional findings_Paediatric v0.2 WNT10A Zornitza Stark gene: WNT10A was added
gene: WNT10A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: WNT10A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WNT10A were set to Ectodermal dysplasia
Additional findings_Paediatric v0.2 WFS1 Zornitza Stark gene: WFS1 was added
gene: WFS1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: WFS1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WFS1 were set to Wolfram syndrome
Additional findings_Paediatric v0.2 WDR62 Zornitza Stark gene: WDR62 was added
gene: WDR62 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: WDR62 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: WDR62 were set to Microcephaly 2, primary, autosomal recessive, with or without cortical malformations
Additional findings_Paediatric v0.2 WAS Zornitza Stark gene: WAS was added
gene: WAS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: WAS was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: WAS were set to Wiskott-Aldrich syndrome
Additional findings_Paediatric v0.2 VPS33B Zornitza Stark gene: VPS33B was added
gene: VPS33B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: VPS33B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: VPS33B were set to Arthrogryposis renal dysfunction cholestasis syndrome
Additional findings_Paediatric v0.2 VPS13B Zornitza Stark gene: VPS13B was added
gene: VPS13B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: VPS13B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: VPS13B were set to Cohen syndrome
Additional findings_Paediatric v0.2 VPS13A Zornitza Stark gene: VPS13A was added
gene: VPS13A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: VPS13A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: VPS13A were set to Choreoacanthocytosis
Additional findings_Paediatric v0.2 VLDLR Zornitza Stark gene: VLDLR was added
gene: VLDLR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: VLDLR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: VLDLR were set to Cerebellar hypoplasia and mental retardation with or without quadrupedal locomotion 1
Additional findings_Paediatric v0.2 VIPAS39 Zornitza Stark gene: VIPAS39 was added
gene: VIPAS39 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: VIPAS39 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: VIPAS39 were set to Arthrogryposis, renal dysfunction and cholestasis
Additional findings_Paediatric v0.2 VHL Zornitza Stark gene: VHL was added
gene: VHL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: VHL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: VHL were set to von Hippel-Lindau syndrome
Additional findings_Paediatric v0.2 VDR Zornitza Stark gene: VDR was added
gene: VDR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: VDR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: VDR were set to Vitamin D-dependent rickets
Additional findings_Paediatric v0.2 VCP Zornitza Stark gene: VCP was added
gene: VCP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: VCP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: VCP were set to Inclusion body myopathy with early-onset paget disease and frontotemporal dementia
Additional findings_Paediatric v0.2 VCAN Zornitza Stark gene: VCAN was added
gene: VCAN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: VCAN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: VCAN were set to Wagner syndrome
Additional findings_Paediatric v0.2 USH2A Zornitza Stark gene: USH2A was added
gene: USH2A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: USH2A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: USH2A were set to Usher syndrome 2
Additional findings_Paediatric v0.2 USH1G Zornitza Stark gene: USH1G was added
gene: USH1G was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: USH1G was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: USH1G were set to Usher syndrome 1
Additional findings_Paediatric v0.2 USH1C Zornitza Stark gene: USH1C was added
gene: USH1C was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: USH1C was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: USH1C were set to Usher syndrome 1
Additional findings_Paediatric v0.2 UROS Zornitza Stark gene: UROS was added
gene: UROS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: UROS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: UROS were set to Porphyria, congenital erythropoietic
Additional findings_Paediatric v0.2 UROD Zornitza Stark gene: UROD was added
gene: UROD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: UROD was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: UROD were set to Porphyria, hepatoerythropoietic
Additional findings_Paediatric v0.2 UNC13D Zornitza Stark gene: UNC13D was added
gene: UNC13D was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: UNC13D was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: UNC13D were set to Hemophagocytic lymphohistiocytosis, familial, 3
Additional findings_Paediatric v0.2 UMOD Zornitza Stark gene: UMOD was added
gene: UMOD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: UMOD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: UMOD were set to Nephropathy
Additional findings_Paediatric v0.2 UGT1A1 Zornitza Stark gene: UGT1A1 was added
gene: UGT1A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: UGT1A1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: UGT1A1 were set to Crigler-Najjar syndrome
Additional findings_Paediatric v0.2 UBR1 Zornitza Stark gene: UBR1 was added
gene: UBR1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: UBR1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: UBR1 were set to Johanson-Blizzard syndrome
Additional findings_Paediatric v0.2 TYR Zornitza Stark gene: TYR was added
gene: TYR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TYR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TYR were set to Albinism, oculocutaneous 1
Additional findings_Paediatric v0.2 TYMP Zornitza Stark gene: TYMP was added
gene: TYMP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TYMP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TYMP were set to Mitochondrial DNA depletion syndrome
Additional findings_Paediatric v0.2 TWIST1 Zornitza Stark gene: TWIST1 was added
gene: TWIST1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TWIST1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TWIST1 were set to Saethre-Chotzen syndrome
Additional findings_Paediatric v0.2 TTR Zornitza Stark gene: TTR was added
gene: TTR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TTR was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TTR were set to Amyloidosis, hereditary, transthyretin-related
Additional findings_Paediatric v0.2 TTPA Zornitza Stark gene: TTPA was added
gene: TTPA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TTPA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TTPA were set to Ataxia with isolated vitamin E deficiency
Additional findings_Paediatric v0.2 TTN Zornitza Stark gene: TTN was added
gene: TTN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TTN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TTN were set to Centronuclear myopathy
Additional findings_Paediatric v0.2 TTC7A Zornitza Stark gene: TTC7A was added
gene: TTC7A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TTC7A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TTC7A were set to Immunodeficiency, combined, with intestinal atresias
Additional findings_Paediatric v0.2 TTC37 Zornitza Stark gene: TTC37 was added
gene: TTC37 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TTC37 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TTC37 were set to Trichohepatoenteric syndrome
Additional findings_Paediatric v0.2 TSHR Zornitza Stark gene: TSHR was added
gene: TSHR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TSHR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TSHR were set to Hypothyroidism
Additional findings_Paediatric v0.2 TSHB Zornitza Stark gene: TSHB was added
gene: TSHB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TSHB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TSHB were set to Hypothryoidism, congenital, nongoitrous 4
Additional findings_Paediatric v0.2 TSEN54 Zornitza Stark gene: TSEN54 was added
gene: TSEN54 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TSEN54 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TSEN54 were set to Pontocerebellar hypoplasia type 4
Additional findings_Paediatric v0.2 TSC2 Zornitza Stark gene: TSC2 was added
gene: TSC2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TSC2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TSC2 were set to Tuberous sclerosis 2
Additional findings_Paediatric v0.2 TSC1 Zornitza Stark gene: TSC1 was added
gene: TSC1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TSC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TSC1 were set to Tuberous sclerosis 1
Additional findings_Paediatric v0.2 TRPM4 Zornitza Stark gene: TRPM4 was added
gene: TRPM4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TRPM4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TRPM4 were set to Cardiac conduction disease
Additional findings_Paediatric v0.2 TRMU Zornitza Stark gene: TRMU was added
gene: TRMU was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TRMU was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TRMU were set to Liver failure, transient infantile
Additional findings_Paediatric v0.2 TRIOBP Zornitza Stark gene: TRIOBP was added
gene: TRIOBP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TRIOBP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TRIOBP were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 TRIM37 Zornitza Stark gene: TRIM37 was added
gene: TRIM37 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TRIM37 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TRIM37 were set to Mulibrey nanism syndrome
Additional findings_Paediatric v0.2 TRIM32 Zornitza Stark gene: TRIM32 was added
gene: TRIM32 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TRIM32 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TRIM32 were set to Muscular dystrophy, limb-girdle, type 2H
Additional findings_Paediatric v0.2 TREX1 Zornitza Stark gene: TREX1 was added
gene: TREX1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TREX1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TREX1 were set to Aicardi-Goutieres syndrome 1
Additional findings_Paediatric v0.2 TRAPPC2 Zornitza Stark gene: TRAPPC2 was added
gene: TRAPPC2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TRAPPC2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: TRAPPC2 were set to Spondyloepiphyseal dysplasia tarda
Additional findings_Paediatric v0.2 TPP1 Zornitza Stark gene: TPP1 was added
gene: TPP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TPP1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TPP1 were set to Neuronal ceroid lipofuscinosis
Additional findings_Paediatric v0.2 TPO Zornitza Stark gene: TPO was added
gene: TPO was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TPO was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TPO were set to Thyroid dyshormonogenesis 2A
Additional findings_Paediatric v0.2 TPM3 Zornitza Stark Added phenotypes Congenital fiber-type disproportion myopathy for gene: TPM3
Additional findings_Paediatric v0.2 TPM3 Zornitza Stark gene: TPM3 was added
gene: TPM3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TPM3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TPM3 were set to Nemaline myopathy
Additional findings_Paediatric v0.2 TPM2 Zornitza Stark Added phenotypes Arthrogryposis multiplex congenita, distal for gene: TPM2
Additional findings_Paediatric v0.2 TPM2 Zornitza Stark gene: TPM2 was added
gene: TPM2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TPM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TPM2 were set to Nemaline myopathy
Additional findings_Paediatric v0.2 TP53 Zornitza Stark gene: TP53 was added
gene: TP53 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TP53 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TP53 were set to Li-Fraumeni syndrome
Additional findings_Paediatric v0.2 TNNT3 Zornitza Stark gene: TNNT3 was added
gene: TNNT3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TNNT3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TNNT3 were set to Arthyrgryposis, distal
Additional findings_Paediatric v0.2 TNNT1 Zornitza Stark gene: TNNT1 was added
gene: TNNT1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TNNT1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TNNT1 were set to Nemaline myopathy, Amish type
Additional findings_Paediatric v0.2 TNNI2 Zornitza Stark gene: TNNI2 was added
gene: TNNI2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TNNI2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TNNI2 were set to Distal arthrogryposis syndrome 2b
Additional findings_Paediatric v0.2 TNFSF11 Zornitza Stark gene: TNFSF11 was added
gene: TNFSF11 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TNFSF11 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TNFSF11 were set to Osteopetrosis, autosomal recessive 2
Additional findings_Paediatric v0.2 TNFRSF11B Zornitza Stark gene: TNFRSF11B was added
gene: TNFRSF11B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TNFRSF11B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TNFRSF11B were set to Paget disease
Additional findings_Paediatric v0.2 TMPRSS3 Zornitza Stark gene: TMPRSS3 was added
gene: TMPRSS3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TMPRSS3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TMPRSS3 were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 TMIE Zornitza Stark gene: TMIE was added
gene: TMIE was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TMIE was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TMIE were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 TMEM67 Zornitza Stark Added phenotypes Meckel syndrome for gene: TMEM67
Additional findings_Paediatric v0.2 TMEM67 Zornitza Stark gene: TMEM67 was added
gene: TMEM67 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TMEM67 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TMEM67 were set to Joubert syndrome
Additional findings_Paediatric v0.2 TMEM43 Zornitza Stark gene: TMEM43 was added
gene: TMEM43 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TMEM43 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TMEM43 were set to Arrhythmogenic right ventricular dysplasia 5
Additional findings_Paediatric v0.2 TMC1 Zornitza Stark gene: TMC1 was added
gene: TMC1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TMC1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TMC1 were set to Deafness
Additional findings_Paediatric v0.2 TK2 Zornitza Stark gene: TK2 was added
gene: TK2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TK2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TK2 were set to Mitochondrial DNA depletion syndrome
Additional findings_Paediatric v0.2 TIMM8A Zornitza Stark gene: TIMM8A was added
gene: TIMM8A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TIMM8A was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: TIMM8A were set to Mohr-Tranebjaerg syndrome
Additional findings_Paediatric v0.2 THRB Zornitza Stark gene: THRB was added
gene: THRB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: THRB was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: THRB were set to Thyroid hormone resistance
Additional findings_Paediatric v0.2 THRA Zornitza Stark gene: THRA was added
gene: THRA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: THRA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: THRA were set to Hypothyroidism, congenital, nongoitrous, 6
Additional findings_Paediatric v0.2 TH Zornitza Stark gene: TH was added
gene: TH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TH were set to Tyrosine hydroxylase deficiency
Additional findings_Paediatric v0.2 TGM5 Zornitza Stark gene: TGM5 was added
gene: TGM5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TGM5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TGM5 were set to Peeling skin syndrome, acral type
Additional findings_Paediatric v0.2 TGM1 Zornitza Stark gene: TGM1 was added
gene: TGM1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TGM1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TGM1 were set to Ichthyosis, congenital, autosomal recessive
Additional findings_Paediatric v0.2 TGFBR2 Zornitza Stark gene: TGFBR2 was added
gene: TGFBR2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TGFBR2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TGFBR2 were set to Loeys-Dietz syndrome
Additional findings_Paediatric v0.2 TGFBR1 Zornitza Stark gene: TGFBR1 was added
gene: TGFBR1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TGFBR1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TGFBR1 were set to Loeys-Dietz syndrome
Additional findings_Paediatric v0.2 TG Zornitza Stark gene: TG was added
gene: TG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TG was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TG were set to Thyroid dyshormonogenesis 3
Additional findings_Paediatric v0.2 TFG Zornitza Stark gene: TFG was added
gene: TFG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TFG was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TFG were set to Hereditary motor and sensory neuropathy
Additional findings_Paediatric v0.2 TFAP2B Zornitza Stark gene: TFAP2B was added
gene: TFAP2B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TFAP2B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TFAP2B were set to Char syndrome
Additional findings_Paediatric v0.2 TFAP2A Zornitza Stark gene: TFAP2A was added
gene: TFAP2A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TFAP2A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TFAP2A were set to Branchiooculofacial syndrome
Additional findings_Paediatric v0.2 TECTA Zornitza Stark gene: TECTA was added
gene: TECTA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TECTA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TECTA were set to Deafness
Additional findings_Paediatric v0.2 TCOF1 Zornitza Stark gene: TCOF1 was added
gene: TCOF1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TCOF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TCOF1 were set to Treacher Collins syndrome 1
Additional findings_Paediatric v0.2 TCIRG1 Zornitza Stark gene: TCIRG1 was added
gene: TCIRG1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TCIRG1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TCIRG1 were set to Osteopetrosis, infantile malignant
Additional findings_Paediatric v0.2 TCAP Zornitza Stark gene: TCAP was added
gene: TCAP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TCAP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TCAP were set to Muscular dystrophy, limb-girdle, type 2G
Additional findings_Paediatric v0.2 TBX5 Zornitza Stark gene: TBX5 was added
gene: TBX5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TBX5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TBX5 were set to Holt-Oram syndrome
Additional findings_Paediatric v0.2 TBX1 Zornitza Stark gene: TBX1 was added
gene: TBX1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TBX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: TBX1 were set to DiGeorge syndrome
Additional findings_Paediatric v0.2 TBC1D24 Zornitza Stark gene: TBC1D24 was added
gene: TBC1D24 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TBC1D24 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TBC1D24 were set to Deafness, onychodystrophy, osteodystrophy, mental retardation, and seizures syndrome
Additional findings_Paediatric v0.2 TAZ Zornitza Stark gene: TAZ was added
gene: TAZ was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TAZ was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: TAZ were set to Barth syndrome
Additional findings_Paediatric v0.2 TAT Zornitza Stark gene: TAT was added
gene: TAT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TAT was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TAT were set to Tyrosinemia, type II
Additional findings_Paediatric v0.2 SURF1 Zornitza Stark gene: SURF1 was added
gene: SURF1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SURF1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SURF1 were set to Leigh syndrome, due to COX deficiency
Additional findings_Paediatric v0.2 SUOX Zornitza Stark gene: SUOX was added
gene: SUOX was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SUOX was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SUOX were set to Sulphite oxidase deficiency
Additional findings_Paediatric v0.2 SUCLG1 Zornitza Stark gene: SUCLG1 was added
gene: SUCLG1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SUCLG1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SUCLG1 were set to Mitochondrial DNA depletion syndrome 9 (encephalomyopathic type with methylmalonic aciduria)
Additional findings_Paediatric v0.2 SUCLA2 Zornitza Stark gene: SUCLA2 was added
gene: SUCLA2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SUCLA2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SUCLA2 were set to Mitochondrial DNA depletion syndrome 5 (encephalomyopathic with methylmalonic aciduria)
Additional findings_Paediatric v0.2 STXBP2 Zornitza Stark gene: STXBP2 was added
gene: STXBP2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: STXBP2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: STXBP2 were set to Hemophagocytic lymphohistiocytosis
Additional findings_Paediatric v0.2 STXBP1 Zornitza Stark gene: STXBP1 was added
gene: STXBP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: STXBP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: STXBP1 were set to Epileptic encephalopathy, early infantile
Additional findings_Paediatric v0.2 STX11 Zornitza Stark gene: STX11 was added
gene: STX11 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: STX11 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: STX11 were set to Hemophagocytic lymphohistiocytosis, familial, 4
Additional findings_Paediatric v0.2 STS Zornitza Stark gene: STS was added
gene: STS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: STS was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: STS were set to Ichthyosis, X-linked
Additional findings_Paediatric v0.2 STRC Zornitza Stark gene: STRC was added
gene: STRC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: STRC was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: STRC were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 STRA6 Zornitza Stark gene: STRA6 was added
gene: STRA6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: STRA6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: STRA6 were set to Microphthalmia, syndromic
Additional findings_Paediatric v0.2 STK11 Zornitza Stark gene: STK11 was added
gene: STK11 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: STK11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: STK11 were set to Peutz-Jeghers syndrome
Additional findings_Paediatric v0.2 STAT3 Zornitza Stark gene: STAT3 was added
gene: STAT3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: STAT3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: STAT3 were set to Hyper-IgE recurrent infection syndrome
Additional findings_Paediatric v0.2 STAR Zornitza Stark gene: STAR was added
gene: STAR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: STAR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: STAR were set to Congenital lipoid adrenal hyperplasia,
Additional findings_Paediatric v0.2 SRCAP Zornitza Stark gene: SRCAP was added
gene: SRCAP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SRCAP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SRCAP were set to Floating-Harbor syndrome
Additional findings_Paediatric v0.2 SPTLC1 Zornitza Stark gene: SPTLC1 was added
gene: SPTLC1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SPTLC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SPTLC1 were set to Neuropathy, hereditary sensory and autonomic, type IA
Additional findings_Paediatric v0.2 SPTB Zornitza Stark gene: SPTB was added
gene: SPTB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SPTB was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SPTB were set to Spherocytosis
Additional findings_Paediatric v0.2 SPTA1 Zornitza Stark gene: SPTA1 was added
gene: SPTA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SPTA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SPTA1 were set to Elliptocytosis
Additional findings_Paediatric v0.2 SPRED1 Zornitza Stark gene: SPRED1 was added
gene: SPRED1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SPRED1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SPRED1 were set to Legius syndrome
Additional findings_Paediatric v0.2 SPR Zornitza Stark gene: SPR was added
gene: SPR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SPR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SPR were set to Sepiapterin reductase deficiency
Additional findings_Paediatric v0.2 SPINK5 Zornitza Stark gene: SPINK5 was added
gene: SPINK5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SPINK5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SPINK5 were set to Netherton syndrome 1; Netherton syndrome
Additional findings_Paediatric v0.2 SP110 Zornitza Stark gene: SP110 was added
gene: SP110 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SP110 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SP110 were set to Hepatic venoocclusive disease with immunodeficiency
Additional findings_Paediatric v0.2 SOX9 Zornitza Stark gene: SOX9 was added
gene: SOX9 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SOX9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SOX9 were set to Campomelic dysplasia
Additional findings_Paediatric v0.2 SOX10 Zornitza Stark gene: SOX10 was added
gene: SOX10 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SOX10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SOX10 were set to Shah-Waardenburg syndrome
Additional findings_Paediatric v0.2 SMPX Zornitza Stark gene: SMPX was added
gene: SMPX was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SMPX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: SMPX were set to Deafness, X-linked
Additional findings_Paediatric v0.2 SMPD1 Zornitza Stark Added phenotypes Niemann-Pick disease, type B for gene: SMPD1
Additional findings_Paediatric v0.2 SMPD1 Zornitza Stark gene: SMPD1 was added
gene: SMPD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SMPD1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SMPD1 were set to Niemann-Pick disease, type A
Additional findings_Paediatric v0.2 SMN1 Zornitza Stark gene: SMN1 was added
gene: SMN1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SMN1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SMN1 were set to Spinal muscular atrophy
Additional findings_Paediatric v0.2 SMC1A Zornitza Stark gene: SMC1A was added
gene: SMC1A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SMC1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SMC1A were set to Cornelia de Lange syndrome
Additional findings_Paediatric v0.2 SMARCAL1 Zornitza Stark gene: SMARCAL1 was added
gene: SMARCAL1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SMARCAL1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SMARCAL1 were set to Schimke immunoosseous dysplasia
Additional findings_Paediatric v0.2 SMAD4 Zornitza Stark gene: SMAD4 was added
gene: SMAD4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SMAD4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SMAD4 were set to Juvenile polyposis syndrome
Additional findings_Paediatric v0.2 SMAD3 Zornitza Stark gene: SMAD3 was added
gene: SMAD3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SMAD3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SMAD3 were set to Loeys-Dietz syndrome
Additional findings_Paediatric v0.2 SLCO2A1 Zornitza Stark gene: SLCO2A1 was added
gene: SLCO2A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLCO2A1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLCO2A1 were set to Hypertrophic osteoarthropathy, primary, autosomal recessive 2
Additional findings_Paediatric v0.2 SLC9A6 Zornitza Stark gene: SLC9A6 was added
gene: SLC9A6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC9A6 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: SLC9A6 were set to Christianson syndrome
Additional findings_Paediatric v0.2 SLC7A9 Zornitza Stark gene: SLC7A9 was added
gene: SLC7A9 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC7A9 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC7A9 were set to Cystinuria
Additional findings_Paediatric v0.2 SLC7A7 Zornitza Stark gene: SLC7A7 was added
gene: SLC7A7 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC7A7 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC7A7 were set to Lysinuric protein intolerance
Additional findings_Paediatric v0.2 SLC6A8 Zornitza Stark gene: SLC6A8 was added
gene: SLC6A8 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC6A8 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: SLC6A8 were set to Creatine deficiency syndrome, X-linked
Additional findings_Paediatric v0.2 SLC6A5 Zornitza Stark gene: SLC6A5 was added
gene: SLC6A5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC6A5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC6A5 were set to Hyperekplexia 3
Additional findings_Paediatric v0.2 SLC5A5 Zornitza Stark gene: SLC5A5 was added
gene: SLC5A5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC5A5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC5A5 were set to Thyroid dyshormonogenesis 1
Additional findings_Paediatric v0.2 SLC5A2 Zornitza Stark gene: SLC5A2 was added
gene: SLC5A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC5A2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC5A2 were set to Renal glucosuria
Additional findings_Paediatric v0.2 SLC4A11 Zornitza Stark gene: SLC4A11 was added
gene: SLC4A11 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC4A11 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC4A11 were set to Corneal endothelial dystrophy
Additional findings_Paediatric v0.2 SLC4A1 Zornitza Stark gene: SLC4A1 was added
gene: SLC4A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC4A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SLC4A1 were set to Spherocytosis
Additional findings_Paediatric v0.2 SLC46A1 Zornitza Stark gene: SLC46A1 was added
gene: SLC46A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC46A1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC46A1 were set to Folate malabsorption, hereditary
Additional findings_Paediatric v0.2 SLC45A2 Zornitza Stark gene: SLC45A2 was added
gene: SLC45A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC45A2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC45A2 were set to Oculocutaneous albinism, type IV
Additional findings_Paediatric v0.2 SLC3A1 Zornitza Stark gene: SLC3A1 was added
gene: SLC3A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC3A1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC3A1 were set to Cystinuria
Additional findings_Paediatric v0.2 SLC39A4 Zornitza Stark gene: SLC39A4 was added
gene: SLC39A4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC39A4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC39A4 were set to Acrodermatitis enteropathica
Additional findings_Paediatric v0.2 SLC37A4 Zornitza Stark gene: SLC37A4 was added
gene: SLC37A4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC37A4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC37A4 were set to Glycogen storage disease Ib
Additional findings_Paediatric v0.2 SLC35D1 Zornitza Stark gene: SLC35D1 was added
gene: SLC35D1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC35D1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC35D1 were set to Schneckenbecken dysplasia
Additional findings_Paediatric v0.2 SLC34A3 Zornitza Stark gene: SLC34A3 was added
gene: SLC34A3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC34A3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC34A3 were set to Hypophosphatemic rickets with hypercalciuria
Additional findings_Paediatric v0.2 SLC34A2 Zornitza Stark gene: SLC34A2 was added
gene: SLC34A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC34A2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC34A2 were set to Pulmonary alveolar microlithiasis
Additional findings_Paediatric v0.2 SLC2A10 Zornitza Stark gene: SLC2A10 was added
gene: SLC2A10 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC2A10 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC2A10 were set to Arterial tortuosity syndrome
Additional findings_Paediatric v0.2 SLC2A1 Zornitza Stark gene: SLC2A1 was added
gene: SLC2A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC2A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SLC2A1 were set to GLUT1 deficiency syndrome 1
Additional findings_Paediatric v0.2 SLC27A4 Zornitza Stark gene: SLC27A4 was added
gene: SLC27A4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC27A4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC27A4 were set to Ichthyosis prematurity syndrome
Additional findings_Paediatric v0.2 SLC26A4 Zornitza Stark gene: SLC26A4 was added
gene: SLC26A4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC26A4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC26A4 were set to Pendred syndrome
Additional findings_Paediatric v0.2 SLC26A3 Zornitza Stark gene: SLC26A3 was added
gene: SLC26A3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC26A3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC26A3 were set to Chloride diarrhea, congenital, Finnish type
Additional findings_Paediatric v0.2 SLC26A2 Zornitza Stark gene: SLC26A2 was added
gene: SLC26A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC26A2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC26A2 were set to Achondrogenesis 1B
Additional findings_Paediatric v0.2 SLC25A4 Zornitza Stark gene: SLC25A4 was added
gene: SLC25A4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC25A4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SLC25A4 were set to Progressive external ophthalmoplegia
Additional findings_Paediatric v0.2 SLC25A38 Zornitza Stark gene: SLC25A38 was added
gene: SLC25A38 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC25A38 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC25A38 were set to Anemia, sideroblastic, pyridoxine-refractory, autosomal recessive
Additional findings_Paediatric v0.2 SLC25A20 Zornitza Stark gene: SLC25A20 was added
gene: SLC25A20 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC25A20 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC25A20 were set to Carnitine-acylcarnitine translocase deficiency
Additional findings_Paediatric v0.2 SLC25A15 Zornitza Stark gene: SLC25A15 was added
gene: SLC25A15 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC25A15 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC25A15 were set to Hyperornithinemia-hyperammonemia-homocitrullinemia syndrome
Additional findings_Paediatric v0.2 SLC25A13 Zornitza Stark gene: SLC25A13 was added
gene: SLC25A13 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC25A13 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC25A13 were set to Citrullinemia
Additional findings_Paediatric v0.2 SLC22A5 Zornitza Stark gene: SLC22A5 was added
gene: SLC22A5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC22A5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC22A5 were set to Carnitine deficiency, systemic primary
Additional findings_Paediatric v0.2 SLC19A3 Zornitza Stark gene: SLC19A3 was added
gene: SLC19A3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC19A3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC19A3 were set to Basal ganglia disease, biotin-responsive
Additional findings_Paediatric v0.2 SLC19A2 Zornitza Stark gene: SLC19A2 was added
gene: SLC19A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC19A2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC19A2 were set to Thiamine-responsive megaloblastic anemia syndrome
Additional findings_Paediatric v0.2 SLC17A5 Zornitza Stark gene: SLC17A5 was added
gene: SLC17A5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC17A5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC17A5 were set to Sialic acid storage disorder, infantile
Additional findings_Paediatric v0.2 SLC16A2 Zornitza Stark gene: SLC16A2 was added
gene: SLC16A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC16A2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: SLC16A2 were set to Allan-Herndon-Dudley syndrome
Additional findings_Paediatric v0.2 SLC12A6 Zornitza Stark gene: SLC12A6 was added
gene: SLC12A6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC12A6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC12A6 were set to Agenesis of the corpus callosum with peripheral neuropathy
Additional findings_Paediatric v0.2 SLC12A3 Zornitza Stark gene: SLC12A3 was added
gene: SLC12A3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC12A3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC12A3 were set to Gitelman syndrome
Additional findings_Paediatric v0.2 SLC12A1 Zornitza Stark gene: SLC12A1 was added
gene: SLC12A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SLC12A1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SLC12A1 were set to Bartter syndrome
Additional findings_Paediatric v0.2 SKI Zornitza Stark gene: SKI was added
gene: SKI was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SKI was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SKI were set to Shprintzen-Goldberg syndrome
Additional findings_Paediatric v0.2 SIX3 Zornitza Stark gene: SIX3 was added
gene: SIX3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SIX3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SIX3 were set to Holoprosencephaly-2
Additional findings_Paediatric v0.2 SIX1 Zornitza Stark gene: SIX1 was added
gene: SIX1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SIX1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SIX1 were set to Branchiootorenal syndrome
Additional findings_Paediatric v0.2 SIL1 Zornitza Stark gene: SIL1 was added
gene: SIL1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SIL1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SIL1 were set to Marinesco-Sjogren syndrome
Additional findings_Paediatric v0.2 SHH Zornitza Stark gene: SHH was added
gene: SHH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SHH was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SHH were set to Holoprosencephaly-3
Additional findings_Paediatric v0.2 SHANK3 Zornitza Stark gene: SHANK3 was added
gene: SHANK3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SHANK3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SHANK3 were set to Phelan-McDermid syndrome
Additional findings_Paediatric v0.2 SH3TC2 Zornitza Stark gene: SH3TC2 was added
gene: SH3TC2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SH3TC2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SH3TC2 were set to Charcot-Marie-Tooth disease
Additional findings_Paediatric v0.2 SH2D1A Zornitza Stark gene: SH2D1A was added
gene: SH2D1A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SH2D1A was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: SH2D1A were set to Lymphoproliferative syndrome
Additional findings_Paediatric v0.2 SGSH Zornitza Stark gene: SGSH was added
gene: SGSH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SGSH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SGSH were set to Mucopolysaccharidisis type IIIA (Sanfilippo A)
Additional findings_Paediatric v0.2 SGCG Zornitza Stark gene: SGCG was added
gene: SGCG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SGCG was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SGCG were set to Muscular dystrophy, limb-girdle, type 2C
Additional findings_Paediatric v0.2 SGCD Zornitza Stark gene: SGCD was added
gene: SGCD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SGCD was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SGCD were set to Muscular dystrophy, limb-girdle, type 2F
Additional findings_Paediatric v0.2 SGCB Zornitza Stark gene: SGCB was added
gene: SGCB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SGCB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SGCB were set to Muscular dystrophy, limb-girdle, type 2E
Additional findings_Paediatric v0.2 SGCA Zornitza Stark gene: SGCA was added
gene: SGCA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SGCA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SGCA were set to Muscular dystrophy, limb-girdle, type 2D
Additional findings_Paediatric v0.2 SFTPB Zornitza Stark gene: SFTPB was added
gene: SFTPB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SFTPB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SFTPB were set to Surfactant metabolism dysfunction, pulmonary
Additional findings_Paediatric v0.2 SETX Zornitza Stark gene: SETX was added
gene: SETX was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SETX was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SETX were set to Ataxia-ocular apraxia 2
Additional findings_Paediatric v0.2 SETBP1 Zornitza Stark gene: SETBP1 was added
gene: SETBP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SETBP1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SETBP1 were set to Schinzel-Giedion syndrome
Additional findings_Paediatric v0.2 SEPT9 Zornitza Stark gene: SEPT9 was added
gene: SEPT9 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SEPT9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SEPT9 were set to Amyotrophy, hereditary neuralgic
Additional findings_Paediatric v0.2 SELENON Zornitza Stark gene: SELENON was added
gene: SELENON was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SELENON was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SELENON were set to Myopathy, congenital, with fiber-type disproportion; Muscular dystrophy, rigid spine
Additional findings_Paediatric v0.2 SDHD Zornitza Stark gene: SDHD was added
gene: SDHD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SDHD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SDHD were set to Hereditary Paraganglioma-Pheochromocytoma Syndromes
Additional findings_Paediatric v0.2 SCO2 Zornitza Stark gene: SCO2 was added
gene: SCO2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SCO2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SCO2 were set to Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency
Additional findings_Paediatric v0.2 SCNN1B Zornitza Stark gene: SCNN1B was added
gene: SCNN1B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SCNN1B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SCNN1B were set to Pseudohypoaldosteronism
Additional findings_Paediatric v0.2 SCNN1A Zornitza Stark gene: SCNN1A was added
gene: SCNN1A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SCNN1A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SCNN1A were set to Pseudohypoaldosteronism
Additional findings_Paediatric v0.2 SCN4A Zornitza Stark gene: SCN4A was added
gene: SCN4A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SCN4A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SCN4A were set to Hyperkalemic periodic paralysis, type 2
Additional findings_Paediatric v0.2 SCN1A Zornitza Stark gene: SCN1A was added
gene: SCN1A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SCN1A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SCN1A were set to Dravet syndrome
Additional findings_Paediatric v0.2 SCN11A Zornitza Stark gene: SCN11A was added
gene: SCN11A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SCN11A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SCN11A were set to Episodic pain syndrome
Additional findings_Paediatric v0.2 SBDS Zornitza Stark gene: SBDS was added
gene: SBDS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SBDS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SBDS were set to Shwachman-Bodian-Diamond syndrome
Additional findings_Paediatric v0.2 SAMHD1 Zornitza Stark gene: SAMHD1 was added
gene: SAMHD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SAMHD1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SAMHD1 were set to Aicardi-Goutieres syndrome
Additional findings_Paediatric v0.2 SALL1 Zornitza Stark gene: SALL1 was added
gene: SALL1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SALL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: SALL1 were set to Townes-Brocks syndrome
Additional findings_Paediatric v0.2 SACS Zornitza Stark gene: SACS was added
gene: SACS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: SACS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: SACS were set to Spastic ataxia Charlevoix-Saguenay type
Additional findings_Paediatric v0.2 RYR2 Zornitza Stark Added phenotypes Ventricular tachycardia, catecholaminergic polymorphic for gene: RYR2
Additional findings_Paediatric v0.2 RYR2 Zornitza Stark gene: RYR2 was added
gene: RYR2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RYR2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RYR2 were set to Arrhythmogenic right ventricular dysplasia 2
Additional findings_Paediatric v0.2 RYR1 Zornitza Stark Added phenotypes Multiminicore disease for gene: RYR1
Additional findings_Paediatric v0.2 RYR1 Zornitza Stark Mode of inheritance for gene RYR1 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BIALLELIC, autosomal or pseudoautosomal
Added phenotypes Centronuclear myopathy for gene: RYR1
Additional findings_Paediatric v0.2 RYR1 Zornitza Stark gene: RYR1 was added
gene: RYR1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RYR1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RYR1 were set to Central core disease
Additional findings_Paediatric v0.2 RUNX2 Zornitza Stark gene: RUNX2 was added
gene: RUNX2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RUNX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RUNX2 were set to Cleidocranial dysostosis
Additional findings_Paediatric v0.2 RSPH9 Zornitza Stark gene: RSPH9 was added
gene: RSPH9 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RSPH9 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RSPH9 were set to Ciliary dyskinesia, primary
Additional findings_Paediatric v0.2 RSPH4A Zornitza Stark gene: RSPH4A was added
gene: RSPH4A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RSPH4A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RSPH4A were set to Ciliary dyskinesia, primary
Additional findings_Paediatric v0.2 RS1 Zornitza Stark gene: RS1 was added
gene: RS1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RS1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: RS1 were set to Retinoschisis, X linked
Additional findings_Paediatric v0.2 RRM2B Zornitza Stark gene: RRM2B was added
gene: RRM2B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RRM2B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RRM2B were set to Mitochondrial DNA depletion syndrome
Additional findings_Paediatric v0.2 RPS6KA3 Zornitza Stark gene: RPS6KA3 was added
gene: RPS6KA3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RPS6KA3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: RPS6KA3 were set to Coffin-Lowry syndrome
Additional findings_Paediatric v0.2 RPS26 Zornitza Stark gene: RPS26 was added
gene: RPS26 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RPS26 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RPS26 were set to Diamond-Blackfan anemia
Additional findings_Paediatric v0.2 RPS24 Zornitza Stark gene: RPS24 was added
gene: RPS24 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RPS24 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RPS24 were set to Diamond-Blackfan anemia
Additional findings_Paediatric v0.2 RPS19 Zornitza Stark gene: RPS19 was added
gene: RPS19 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RPS19 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RPS19 were set to Diamond-Blackfan anemia
Additional findings_Paediatric v0.2 RPS17 Zornitza Stark gene: RPS17 was added
gene: RPS17 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RPS17 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RPS17 were set to Diamond-Blackfan anemia
Additional findings_Paediatric v0.2 RPS15 Zornitza Stark gene: RPS15 was added
gene: RPS15 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RPS15 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RPS15 were set to Diamond-Blackfan anemia
Additional findings_Paediatric v0.2 RPL5 Zornitza Stark gene: RPL5 was added
gene: RPL5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RPL5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RPL5 were set to Diamond-Blackfan anemia
Additional findings_Paediatric v0.2 RPL11 Zornitza Stark gene: RPL11 was added
gene: RPL11 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RPL11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RPL11 were set to Diamond-Blackfan anemia
Additional findings_Paediatric v0.2 RPGRIP1L Zornitza Stark Added phenotypes Joubert syndrome for gene: RPGRIP1L
Additional findings_Paediatric v0.2 RPGRIP1L Zornitza Stark gene: RPGRIP1L was added
gene: RPGRIP1L was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RPGRIP1L was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RPGRIP1L were set to Meckel syndrome
Additional findings_Paediatric v0.2 RPGR Zornitza Stark gene: RPGR was added
gene: RPGR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RPGR was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: RPGR were set to Retinitis pigmentosa
Additional findings_Paediatric v0.2 ROR2 Zornitza Stark Mode of inheritance for gene ROR2 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Brachydactyly, type B1 for gene: ROR2
Additional findings_Paediatric v0.2 ROR2 Zornitza Stark gene: ROR2 was added
gene: ROR2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ROR2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ROR2 were set to Robinow syndrome
Additional findings_Paediatric v0.2 RNASEH2C Zornitza Stark gene: RNASEH2C was added
gene: RNASEH2C was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RNASEH2C was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RNASEH2C were set to Aicardi-Goutieres syndrome
Additional findings_Paediatric v0.2 RNASEH2B Zornitza Stark gene: RNASEH2B was added
gene: RNASEH2B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RNASEH2B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RNASEH2B were set to Aicardi-Goutieres syndrome
Additional findings_Paediatric v0.2 RNASEH2A Zornitza Stark gene: RNASEH2A was added
gene: RNASEH2A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RNASEH2A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RNASEH2A were set to Aicardi-Goutieres syndrome
Additional findings_Paediatric v0.2 RMRP Zornitza Stark gene: RMRP was added
gene: RMRP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RMRP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RMRP were set to Cartilage-hair hypoplasia
Additional findings_Paediatric v0.2 RET Zornitza Stark Added phenotypes Multiple endocrine neoplasia IIB for gene: RET
Additional findings_Paediatric v0.2 RET Zornitza Stark gene: RET was added
gene: RET was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RET was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RET were set to Multiple endocrine neoplasia IIA
Additional findings_Paediatric v0.2 REN Zornitza Stark gene: REN was added
gene: REN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: REN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: REN were set to Renal tubular dysgenesis
Additional findings_Paediatric v0.2 RECQL4 Zornitza Stark Added phenotypes Rothmund-Thomson syndrome for gene: RECQL4
Additional findings_Paediatric v0.2 RECQL4 Zornitza Stark Added phenotypes Rapadilino syndrome for gene: RECQL4
Additional findings_Paediatric v0.2 RECQL4 Zornitza Stark gene: RECQL4 was added
gene: RECQL4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RECQL4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RECQL4 were set to Baller-Gerold syndrome
Additional findings_Paediatric v0.2 RBM8A Zornitza Stark gene: RBM8A was added
gene: RBM8A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RBM8A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RBM8A were set to Thrombocytopaenia-absent radius syndrome
Additional findings_Paediatric v0.2 RB1 Zornitza Stark gene: RB1 was added
gene: RB1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RB1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RB1 were set to Retinoblastoma
Additional findings_Paediatric v0.2 RASA1 Zornitza Stark gene: RASA1 was added
gene: RASA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RASA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RASA1 were set to Capillary malformation-arteriovenous malformation
Additional findings_Paediatric v0.2 RAPSN Zornitza Stark gene: RAPSN was added
gene: RAPSN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RAPSN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RAPSN were set to Congenital myasthenic syndrome
Additional findings_Paediatric v0.2 RAI1 Zornitza Stark Added phenotypes Potocki-Lupski syndrome for gene: RAI1
Additional findings_Paediatric v0.2 RAI1 Zornitza Stark gene: RAI1 was added
gene: RAI1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RAI1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RAI1 were set to Smith-Magenis syndrome
Additional findings_Paediatric v0.2 RAG2 Zornitza Stark gene: RAG2 was added
gene: RAG2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RAG2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RAG2 were set to Omenn syndrome
Additional findings_Paediatric v0.2 RAG1 Zornitza Stark gene: RAG1 was added
gene: RAG1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RAG1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RAG1 were set to Omenn syndrome
Additional findings_Paediatric v0.2 RAF1 Zornitza Stark gene: RAF1 was added
gene: RAF1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RAF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RAF1 were set to Noonan syndrome
Additional findings_Paediatric v0.2 RAB7A Zornitza Stark gene: RAB7A was added
gene: RAB7A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RAB7A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: RAB7A were set to Charcot-Marie-Tooth disease
Additional findings_Paediatric v0.2 RAB3GAP1 Zornitza Stark gene: RAB3GAP1 was added
gene: RAB3GAP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RAB3GAP1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RAB3GAP1 were set to Warburg micro syndrome
Additional findings_Paediatric v0.2 RAB27A Zornitza Stark gene: RAB27A was added
gene: RAB27A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RAB27A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RAB27A were set to Griscelli syndrome
Additional findings_Paediatric v0.2 RAB23 Zornitza Stark gene: RAB23 was added
gene: RAB23 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: RAB23 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: RAB23 were set to Carpenter syndrome
Additional findings_Paediatric v0.2 QDPR Zornitza Stark gene: QDPR was added
gene: QDPR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: QDPR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: QDPR were set to Dihydropteridine reductase deficiency
Additional findings_Paediatric v0.2 PYGL Zornitza Stark gene: PYGL was added
gene: PYGL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PYGL was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PYGL were set to Glycogen storage disease VI
Additional findings_Paediatric v0.2 PTS Zornitza Stark gene: PTS was added
gene: PTS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PTS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PTS were set to Hyperphenylalaninemia, BH4-deficient, A
Additional findings_Paediatric v0.2 CAVIN1 Zornitza Stark gene: CAVIN1 was added
gene: CAVIN1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CAVIN1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CAVIN1 were set to Lipodystrophy, congenital generalized, type 4
Additional findings_Paediatric v0.2 PTPN11 Zornitza Stark gene: PTPN11 was added
gene: PTPN11 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PTPN11 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PTPN11 were set to Noonan syndrome
Additional findings_Paediatric v0.2 PTH1R Zornitza Stark gene: PTH1R was added
gene: PTH1R was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PTH1R was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PTH1R were set to Metaphyseal chondrodysplasia
Additional findings_Paediatric v0.2 PTEN Zornitza Stark Added phenotypes Bannayan-Riley-Ruvalcaba syndrome for gene: PTEN
Additional findings_Paediatric v0.2 PTEN Zornitza Stark gene: PTEN was added
gene: PTEN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PTEN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PTEN were set to Cowden disease
Additional findings_Paediatric v0.2 PTCH1 Zornitza Stark gene: PTCH1 was added
gene: PTCH1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PTCH1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PTCH1 were set to Nevoid basal cell carcinoma syndrome
Additional findings_Paediatric v0.2 PSAP Zornitza Stark gene: PSAP was added
gene: PSAP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PSAP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PSAP were set to Metachromatic leukodystrophy
Additional findings_Paediatric v0.2 PRX Zornitza Stark gene: PRX was added
gene: PRX was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PRX was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PRX were set to Charcot-Marie-Tooth disease
Additional findings_Paediatric v0.2 PROS1 Zornitza Stark gene: PROS1 was added
gene: PROS1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PROS1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PROS1 were set to Protein S deficiency
Additional findings_Paediatric v0.2 PROP1 Zornitza Stark gene: PROP1 was added
gene: PROP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PROP1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PROP1 were set to Pituitary hormone deficiency, combined, 2
Additional findings_Paediatric v0.2 PROKR2 Zornitza Stark gene: PROKR2 was added
gene: PROKR2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PROKR2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PROKR2 were set to Hypogonadotropic hypogonadism
Additional findings_Paediatric v0.2 PROC Zornitza Stark gene: PROC was added
gene: PROC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PROC was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PROC were set to Thrombophilia due to protein C deficiency
Additional findings_Paediatric v0.2 PRKAR1A Zornitza Stark gene: PRKAR1A was added
gene: PRKAR1A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PRKAR1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PRKAR1A were set to Carney complex
Additional findings_Paediatric v0.2 PRKAG2 Zornitza Stark gene: PRKAG2 was added
gene: PRKAG2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PRKAG2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PRKAG2 were set to Wolff-Parkinson-White syndrome
Additional findings_Paediatric v0.2 PRF1 Zornitza Stark gene: PRF1 was added
gene: PRF1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PRF1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PRF1 were set to Hemophagocytic lymphohistiocytosis, familial, 2
Additional findings_Paediatric v0.2 PQBP1 Zornitza Stark gene: PQBP1 was added
gene: PQBP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PQBP1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: PQBP1 were set to Mental retardation
Additional findings_Paediatric v0.2 PPT1 Zornitza Stark gene: PPT1 was added
gene: PPT1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PPT1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PPT1 were set to Neuronal ceroid lipofuscinosis
Additional findings_Paediatric v0.2 POU4F3 Zornitza Stark gene: POU4F3 was added
gene: POU4F3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: POU4F3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: POU4F3 were set to Deafness, autosomal dominant
Additional findings_Paediatric v0.2 POU3F4 Zornitza Stark gene: POU3F4 was added
gene: POU3F4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: POU3F4 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: POU3F4 were set to Deafness, X-linked
Additional findings_Paediatric v0.2 POU1F1 Zornitza Stark gene: POU1F1 was added
gene: POU1F1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: POU1F1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: POU1F1 were set to Pituitary hormone deficiency
Additional findings_Paediatric v0.2 PORCN Zornitza Stark gene: PORCN was added
gene: PORCN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PORCN was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: PORCN were set to Focal dermal hypoplasia
Additional findings_Paediatric v0.2 POR Zornitza Stark gene: POR was added
gene: POR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: POR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: POR were set to Disordered steroidogenesis with and without Antley-Bixler syndrome
Additional findings_Paediatric v0.2 POMT2 Zornitza Stark gene: POMT2 was added
gene: POMT2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: POMT2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: POMT2 were set to Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 2
Additional findings_Paediatric v0.2 POMT1 Zornitza Stark Added phenotypes Walker-Warburg syndrome for gene: POMT1
Additional findings_Paediatric v0.2 POMT1 Zornitza Stark gene: POMT1 was added
gene: POMT1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: POMT1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: POMT1 were set to Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 1
Additional findings_Paediatric v0.2 POMGNT1 Zornitza Stark Added phenotypes Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 3 for gene: POMGNT1
Additional findings_Paediatric v0.2 POMGNT1 Zornitza Stark gene: POMGNT1 was added
gene: POMGNT1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: POMGNT1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: POMGNT1 were set to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies)
Additional findings_Paediatric v0.2 POLH Zornitza Stark gene: POLH was added
gene: POLH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: POLH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: POLH were set to Xeroderma pigmentosum
Additional findings_Paediatric v0.2 POLG Zornitza Stark gene: POLG was added
gene: POLG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: POLG was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: POLG were set to POLG-Related Ataxia Neuropathy Spectrum Disorders
Additional findings_Paediatric v0.2 PNPO Zornitza Stark gene: PNPO was added
gene: PNPO was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PNPO was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PNPO were set to Epileptic encephalopathy, neonatal
Additional findings_Paediatric v0.2 PNKP Zornitza Stark gene: PNKP was added
gene: PNKP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PNKP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PNKP were set to Microcephaly - seizures - developmental delay
Additional findings_Paediatric v0.2 PNKD Zornitza Stark gene: PNKD was added
gene: PNKD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PNKD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PNKD were set to Paroxysmal nonkinesiogenic dyskinesia
Additional findings_Paediatric v0.2 PMP22 Zornitza Stark gene: PMP22 was added
gene: PMP22 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PMP22 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PMP22 were set to Charcot-Marie-Tooth disease
Additional findings_Paediatric v0.2 PMM2 Zornitza Stark gene: PMM2 was added
gene: PMM2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PMM2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PMM2 were set to Congenital disorder of glycosylation, type Ia
Additional findings_Paediatric v0.2 PLP1 Zornitza Stark Added phenotypes Spastic paraplegia 2, X-linked for gene: PLP1
Additional findings_Paediatric v0.2 PLP1 Zornitza Stark gene: PLP1 was added
gene: PLP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PLP1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: PLP1 were set to Pelizaeus-Merzbacher disease
Additional findings_Paediatric v0.2 PLOD1 Zornitza Stark gene: PLOD1 was added
gene: PLOD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PLOD1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PLOD1 were set to Ehlers-Danlos syndrome, kyphoscoliotic type
Additional findings_Paediatric v0.2 PLG Zornitza Stark gene: PLG was added
gene: PLG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PLG was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PLG were set to Plasminogen deficiency
Additional findings_Paediatric v0.2 PLEC Zornitza Stark Added phenotypes Muscular dystrophy for gene: PLEC
Additional findings_Paediatric v0.2 PLEC Zornitza Stark gene: PLEC was added
gene: PLEC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PLEC was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PLEC were set to Epidermolysis bullosa simplex
Additional findings_Paediatric v0.2 PLCE1 Zornitza Stark gene: PLCE1 was added
gene: PLCE1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PLCE1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PLCE1 were set to Nephrotic syndrome
Additional findings_Paediatric v0.2 PLA2G6 Zornitza Stark gene: PLA2G6 was added
gene: PLA2G6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PLA2G6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PLA2G6 were set to Infantile neuroaxonal dystrophy 1
Additional findings_Paediatric v0.2 PKLR Zornitza Stark gene: PKLR was added
gene: PKLR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PKLR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PKLR were set to Pyruvate kinase deficiency
Additional findings_Paediatric v0.2 PKHD1 Zornitza Stark gene: PKHD1 was added
gene: PKHD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PKHD1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PKHD1 were set to Polycystic kidney and hepatic disease
Additional findings_Paediatric v0.2 PKD2 Zornitza Stark gene: PKD2 was added
gene: PKD2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PKD2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PKD2 were set to Polycystic kidney disease
Additional findings_Paediatric v0.2 PKD1 Zornitza Stark gene: PKD1 was added
gene: PKD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PKD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PKD1 were set to Polycystic kidney disease
Additional findings_Paediatric v0.2 PINK1 Zornitza Stark gene: PINK1 was added
gene: PINK1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PINK1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PINK1 were set to Parkinson disease 6, early onset
Additional findings_Paediatric v0.2 PIEZO2 Zornitza Stark gene: PIEZO2 was added
gene: PIEZO2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PIEZO2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PIEZO2 were set to Arthrogryposis, distal, type 5
Additional findings_Paediatric v0.2 PHYH Zornitza Stark gene: PHYH was added
gene: PHYH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PHYH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PHYH were set to Refsum disease
Additional findings_Paediatric v0.2 PHKG2 Zornitza Stark gene: PHKG2 was added
gene: PHKG2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PHKG2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PHKG2 were set to Phosphorylase kinase deficiency
Additional findings_Paediatric v0.2 PHKB Zornitza Stark gene: PHKB was added
gene: PHKB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PHKB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PHKB were set to Phosphorylase kinase deficiency
Additional findings_Paediatric v0.2 PHKA2 Zornitza Stark gene: PHKA2 was added
gene: PHKA2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PHKA2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: PHKA2 were set to Phosphorylase kinase deficiency
Additional findings_Paediatric v0.2 PHF6 Zornitza Stark gene: PHF6 was added
gene: PHF6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PHF6 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: PHF6 were set to Borjeson-Forssman-Lehmann syndrome
Additional findings_Paediatric v0.2 PFKM Zornitza Stark gene: PFKM was added
gene: PFKM was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PFKM was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PFKM were set to Glycogen storage disease 7
Additional findings_Paediatric v0.2 PEX7 Zornitza Stark Added phenotypes Rhizomelic chondrodysplasia punctata for gene: PEX7
Additional findings_Paediatric v0.2 PEX7 Zornitza Stark gene: PEX7 was added
gene: PEX7 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PEX7 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PEX7 were set to Refsum disease
Additional findings_Paediatric v0.2 PEX6 Zornitza Stark gene: PEX6 was added
gene: PEX6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PEX6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PEX6 were set to Zellweger syndrome
Additional findings_Paediatric v0.2 PEX5 Zornitza Stark gene: PEX5 was added
gene: PEX5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PEX5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PEX5 were set to Zellweger syndrome
Additional findings_Paediatric v0.2 PEX3 Zornitza Stark gene: PEX3 was added
gene: PEX3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PEX3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PEX3 were set to Zellweger syndrome
Additional findings_Paediatric v0.2 PEX26 Zornitza Stark gene: PEX26 was added
gene: PEX26 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PEX26 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PEX26 were set to Zellweger syndrome
Additional findings_Paediatric v0.2 PEX2 Zornitza Stark gene: PEX2 was added
gene: PEX2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PEX2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PEX2 were set to Zellweger syndrome
Additional findings_Paediatric v0.2 PEX13 Zornitza Stark gene: PEX13 was added
gene: PEX13 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PEX13 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PEX13 were set to Zellweger syndrome
Additional findings_Paediatric v0.2 PEX12 Zornitza Stark gene: PEX12 was added
gene: PEX12 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PEX12 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PEX12 were set to Zellweger syndrome
Additional findings_Paediatric v0.2 PEX10 Zornitza Stark gene: PEX10 was added
gene: PEX10 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PEX10 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PEX10 were set to Zellweger syndrome
Additional findings_Paediatric v0.2 PEX1 Zornitza Stark gene: PEX1 was added
gene: PEX1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PEX1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PEX1 were set to Zellweger syndrome
Additional findings_Paediatric v0.2 PDHX Zornitza Stark gene: PDHX was added
gene: PDHX was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PDHX was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PDHX were set to Pyruvate dehydrogenase complex deficiency
Additional findings_Paediatric v0.2 PDHA1 Zornitza Stark gene: PDHA1 was added
gene: PDHA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PDHA1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: PDHA1 were set to Pyruvate dehydrogenase deficiency
Additional findings_Paediatric v0.2 PDE4D Zornitza Stark gene: PDE4D was added
gene: PDE4D was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PDE4D was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PDE4D were set to Acrodysostosis 2, with or without hormone resistance
Additional findings_Paediatric v0.2 PCNT Zornitza Stark gene: PCNT was added
gene: PCNT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PCNT was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PCNT were set to Microcephalic osteodysplastic primordial dwarfism type 2
Additional findings_Paediatric v0.2 PCDH15 Zornitza Stark gene: PCDH15 was added
gene: PCDH15 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PCDH15 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PCDH15 were set to Usher syndrome
Additional findings_Paediatric v0.2 PCCB Zornitza Stark gene: PCCB was added
gene: PCCB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PCCB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PCCB were set to Propionicacidemia
Additional findings_Paediatric v0.2 PCCA Zornitza Stark gene: PCCA was added
gene: PCCA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PCCA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PCCA were set to Propionicacidemia
Additional findings_Paediatric v0.2 PC Zornitza Stark gene: PC was added
gene: PC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PC was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PC were set to Pyruvate carboxylase deficiency
Additional findings_Paediatric v0.2 PAX8 Zornitza Stark gene: PAX8 was added
gene: PAX8 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PAX8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PAX8 were set to Hypothyroidism, congenital, due to thyroid dysgenesis or hypoplasia
Additional findings_Paediatric v0.2 PAX6 Zornitza Stark gene: PAX6 was added
gene: PAX6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PAX6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PAX6 were set to Aniridia
Additional findings_Paediatric v0.2 PAX3 Zornitza Stark gene: PAX3 was added
gene: PAX3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PAX3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: PAX3 were set to Waardenburg syndrome
Additional findings_Paediatric v0.2 PANK2 Zornitza Stark gene: PANK2 was added
gene: PANK2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PANK2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PANK2 were set to Neurodegeneration with brain iron accumulation 1
Additional findings_Paediatric v0.2 PAK3 Zornitza Stark gene: PAK3 was added
gene: PAK3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PAK3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: PAK3 were set to Mental retardation syndrome, X-linked
Additional findings_Paediatric v0.2 PAH Zornitza Stark gene: PAH was added
gene: PAH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PAH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PAH were set to Phenylketonuria
Additional findings_Paediatric v0.2 OTOGL Zornitza Stark gene: OTOGL was added
gene: OTOGL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: OTOGL was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: OTOGL were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 OTOF Zornitza Stark gene: OTOF was added
gene: OTOF was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: OTOF was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: OTOF were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 OTOA Zornitza Stark gene: OTOA was added
gene: OTOA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: OTOA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: OTOA were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 OTC Zornitza Stark gene: OTC was added
gene: OTC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: OTC was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: OTC were set to Ornithine transcarbamylase deficiency
Additional findings_Paediatric v0.2 OSTM1 Zornitza Stark gene: OSTM1 was added
gene: OSTM1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: OSTM1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: OSTM1 were set to Osteopetrosis
Additional findings_Paediatric v0.2 OSMR Zornitza Stark gene: OSMR was added
gene: OSMR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: OSMR was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: OSMR were set to Amyloidosis, primary cutaneous
Additional findings_Paediatric v0.2 ORC1 Zornitza Stark gene: ORC1 was added
gene: ORC1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ORC1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ORC1 were set to Meier-Gorlin syndrome
Additional findings_Paediatric v0.2 OPA3 Zornitza Stark gene: OPA3 was added
gene: OPA3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: OPA3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: OPA3 were set to 3-methylglutaconic aciduria, type III
Additional findings_Paediatric v0.2 OPA1 Zornitza Stark gene: OPA1 was added
gene: OPA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: OPA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: OPA1 were set to Optic atrophy 1
Additional findings_Paediatric v0.2 OFD1 Zornitza Stark gene: OFD1 was added
gene: OFD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: OFD1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: OFD1 were set to Oral-facial-digital syndrome
Additional findings_Paediatric v0.2 OCRL Zornitza Stark gene: OCRL was added
gene: OCRL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: OCRL was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: OCRL were set to Lowe oculocerebrorenal syndrome
Additional findings_Paediatric v0.2 OCA2 Zornitza Stark gene: OCA2 was added
gene: OCA2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: OCA2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: OCA2 were set to Albinism, oculocutaneous
Additional findings_Paediatric v0.2 OBSL1 Zornitza Stark gene: OBSL1 was added
gene: OBSL1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: OBSL1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: OBSL1 were set to 3-M syndrome
Additional findings_Paediatric v0.2 NTRK1 Zornitza Stark gene: NTRK1 was added
gene: NTRK1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NTRK1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NTRK1 were set to Congenital insensitivity to pain with anhidrosis
Additional findings_Paediatric v0.2 NSDHL Zornitza Stark gene: NSDHL was added
gene: NSDHL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NSDHL was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: NSDHL were set to CHILD syndrome
Additional findings_Paediatric v0.2 NSD1 Zornitza Stark gene: NSD1 was added
gene: NSD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NSD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NSD1 were set to Sotos syndrome
Additional findings_Paediatric v0.2 NR0B1 Zornitza Stark gene: NR0B1 was added
gene: NR0B1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NR0B1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: NR0B1 were set to Congenital adrenal hypoplasia
Additional findings_Paediatric v0.2 NPHS1 Zornitza Stark gene: NPHS1 was added
gene: NPHS1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NPHS1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NPHS1 were set to Congenital nephrotic syndrome, Finnish type
Additional findings_Paediatric v0.2 NPHP4 Zornitza Stark gene: NPHP4 was added
gene: NPHP4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NPHP4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NPHP4 were set to Nephronophthisis
Additional findings_Paediatric v0.2 NPHP3 Zornitza Stark gene: NPHP3 was added
gene: NPHP3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NPHP3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NPHP3 were set to Nephronophthisis
Additional findings_Paediatric v0.2 NPHP1 Zornitza Stark gene: NPHP1 was added
gene: NPHP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NPHP1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NPHP1 were set to Nephronophthisis
Additional findings_Paediatric v0.2 NPC2 Zornitza Stark gene: NPC2 was added
gene: NPC2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NPC2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NPC2 were set to Niemann-Pick disease type C2
Additional findings_Paediatric v0.2 NPC1 Zornitza Stark gene: NPC1 was added
gene: NPC1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NPC1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NPC1 were set to Niemann-Pick disease type C1
Additional findings_Paediatric v0.2 NOTCH3 Zornitza Stark gene: NOTCH3 was added
gene: NOTCH3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NOTCH3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NOTCH3 were set to Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy
Additional findings_Paediatric v0.2 NOTCH2 Zornitza Stark gene: NOTCH2 was added
gene: NOTCH2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NOTCH2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NOTCH2 were set to Hajdu-Cheney syndrome
Additional findings_Paediatric v0.2 NOG Zornitza Stark gene: NOG was added
gene: NOG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NOG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NOG were set to Symphalangism, proximal, 1A
Additional findings_Paediatric v0.2 NKX2-1 Zornitza Stark gene: NKX2-1 was added
gene: NKX2-1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NKX2-1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NKX2-1 were set to Choreoathetosis, hypothyroidism, and neonatal respiratory distress
Additional findings_Paediatric v0.2 NIPBL Zornitza Stark gene: NIPBL was added
gene: NIPBL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NIPBL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NIPBL were set to Cornelia de Lange syndrome
Additional findings_Paediatric v0.2 NIPAL4 Zornitza Stark gene: NIPAL4 was added
gene: NIPAL4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NIPAL4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NIPAL4 were set to Ichthyosis, autosomal recessive
Additional findings_Paediatric v0.2 NHLRC1 Zornitza Stark gene: NHLRC1 was added
gene: NHLRC1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NHLRC1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NHLRC1 were set to Myoclonic epilepsy of Lafora
Additional findings_Paediatric v0.2 NHEJ1 Zornitza Stark gene: NHEJ1 was added
gene: NHEJ1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NHEJ1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NHEJ1 were set to Severe combined immunodeficiency with microcephaly, growth retardation, and sensitivity to ionizing radiation
Additional findings_Paediatric v0.2 NGLY1 Zornitza Stark gene: NGLY1 was added
gene: NGLY1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NGLY1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NGLY1 were set to Developmental delay, multifocal epilepsy & abnormal liver function
Additional findings_Paediatric v0.2 NF2 Zornitza Stark gene: NF2 was added
gene: NF2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NF2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NF2 were set to Neurofibromatosis 2
Additional findings_Paediatric v0.2 NF1 Zornitza Stark gene: NF1 was added
gene: NF1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NF1 were set to Neurofibromatosis, type 1
Additional findings_Paediatric v0.2 NEU1 Zornitza Stark gene: NEU1 was added
gene: NEU1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NEU1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NEU1 were set to Sialidosis
Additional findings_Paediatric v0.2 NEFL Zornitza Stark gene: NEFL was added
gene: NEFL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NEFL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: NEFL were set to Charcot-Marie-Tooth disease
Additional findings_Paediatric v0.2 NEB Zornitza Stark gene: NEB was added
gene: NEB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NEB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NEB were set to Nemaline myopathy
Additional findings_Paediatric v0.2 NDP Zornitza Stark gene: NDP was added
gene: NDP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NDP was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: NDP were set to Norrie disease
Additional findings_Paediatric v0.2 NCF2 Zornitza Stark gene: NCF2 was added
gene: NCF2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NCF2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NCF2 were set to Chronic granulomatous disease
Additional findings_Paediatric v0.2 NCF1 Zornitza Stark gene: NCF1 was added
gene: NCF1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NCF1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NCF1 were set to Chronic granulomatous disease
Additional findings_Paediatric v0.2 NBN Zornitza Stark gene: NBN was added
gene: NBN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NBN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NBN were set to Nijmegen breakage syndrome
Additional findings_Paediatric v0.2 NAGS Zornitza Stark gene: NAGS was added
gene: NAGS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NAGS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NAGS were set to N-acetylglutamate synthetase deficiency
Additional findings_Paediatric v0.2 NAGLU Zornitza Stark gene: NAGLU was added
gene: NAGLU was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NAGLU was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NAGLU were set to Sanfilippo syndrome type B
Additional findings_Paediatric v0.2 NAGA Zornitza Stark gene: NAGA was added
gene: NAGA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: NAGA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: NAGA were set to N-acetylgalactosaminidase alpha deficiency
Additional findings_Paediatric v0.2 MYO7A Zornitza Stark gene: MYO7A was added
gene: MYO7A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MYO7A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MYO7A were set to Usher syndrome
Additional findings_Paediatric v0.2 MYO6 Zornitza Stark gene: MYO6 was added
gene: MYO6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MYO6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MYO6 were set to Deafness
Additional findings_Paediatric v0.2 MYO3A Zornitza Stark gene: MYO3A was added
gene: MYO3A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MYO3A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MYO3A were set to Sensorineural hearing loss
Additional findings_Paediatric v0.2 MYO15A Zornitza Stark gene: MYO15A was added
gene: MYO15A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MYO15A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MYO15A were set to Sensorineural hearing loss
Additional findings_Paediatric v0.2 MYH9 Zornitza Stark gene: MYH9 was added
gene: MYH9 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MYH9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYH9 were set to Macrothrombocytopenia and progressive sensorineural deafness
Additional findings_Paediatric v0.2 MYH7 Zornitza Stark Added phenotypes Myopathy, myosin storage for gene: MYH7
Additional findings_Paediatric v0.2 MYH7 Zornitza Stark gene: MYH7 was added
gene: MYH7 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MYH7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYH7 were set to Laing distal myopathy
Additional findings_Paediatric v0.2 MYH3 Zornitza Stark gene: MYH3 was added
gene: MYH3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MYH3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYH3 were set to Arthrogryposis, distal
Additional findings_Paediatric v0.2 MYH2 Zornitza Stark gene: MYH2 was added
gene: MYH2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MYH2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MYH2 were set to Proximal myopathy and ophthalmoplegia
Additional findings_Paediatric v0.2 MYH14 Zornitza Stark gene: MYH14 was added
gene: MYH14 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MYH14 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYH14 were set to Deafness, autosomal dominant
Additional findings_Paediatric v0.2 MYCN Zornitza Stark gene: MYCN was added
gene: MYCN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MYCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MYCN were set to Feingold syndrome
Additional findings_Paediatric v0.2 MVK Zornitza Stark gene: MVK was added
gene: MVK was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MVK was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MVK were set to Hyperimmunoglobulin D and periodic fever syndrome
Additional findings_Paediatric v0.2 MUTYH Zornitza Stark gene: MUTYH was added
gene: MUTYH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MUTYH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MUTYH were set to MUTYH-associated polyposis
Additional findings_Paediatric v0.2 MUT Zornitza Stark gene: MUT was added
gene: MUT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MUT was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MUT were set to Methylmalonic aciduria, mut(0) type
Additional findings_Paediatric v0.2 MUSK Zornitza Stark gene: MUSK was added
gene: MUSK was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MUSK was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MUSK were set to Congenital myasthenic syndrome
Additional findings_Paediatric v0.2 MTTP Zornitza Stark gene: MTTP was added
gene: MTTP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MTTP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MTTP were set to Abetalipoproteinaemia
Additional findings_Paediatric v0.2 MTRR Zornitza Stark gene: MTRR was added
gene: MTRR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MTRR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MTRR were set to Methylmalonic aciduria and homocystinuria
Additional findings_Paediatric v0.2 MTR Zornitza Stark gene: MTR was added
gene: MTR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MTR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MTR were set to Methylmalonic aciduria and homocystinuria
Additional findings_Paediatric v0.2 MTM1 Zornitza Stark gene: MTM1 was added
gene: MTM1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MTM1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: MTM1 were set to Myotubular myopathy, X-linked
Additional findings_Paediatric v0.2 MSX2 Zornitza Stark gene: MSX2 was added
gene: MSX2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MSX2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MSX2 were set to Parietal foramina 1
Additional findings_Paediatric v0.2 MPZ Zornitza Stark gene: MPZ was added
gene: MPZ was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MPZ was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MPZ were set to Charcot-Marie-Tooth disease
Additional findings_Paediatric v0.2 MPV17 Zornitza Stark gene: MPV17 was added
gene: MPV17 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MPV17 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MPV17 were set to Mitochondrial DNA depletion syndrome, hepatic
Additional findings_Paediatric v0.2 MPL Zornitza Stark gene: MPL was added
gene: MPL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MPL was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MPL were set to Amegakaryocytic thrombocytopaenia, congenital
Additional findings_Paediatric v0.2 MPI Zornitza Stark gene: MPI was added
gene: MPI was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MPI was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MPI were set to Congenital disorder of glycosylation 1b
Additional findings_Paediatric v0.2 MOCS2 Zornitza Stark gene: MOCS2 was added
gene: MOCS2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MOCS2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MOCS2 were set to Molybdenum cofactor deficiency
Additional findings_Paediatric v0.2 MOCS1 Zornitza Stark gene: MOCS1 was added
gene: MOCS1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MOCS1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MOCS1 were set to Molybdenum cofactor deficiency
Additional findings_Paediatric v0.2 MMADHC Zornitza Stark gene: MMADHC was added
gene: MMADHC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MMADHC was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MMADHC were set to Methylmalonic aciduria and homocystinuria, cblD type
Additional findings_Paediatric v0.2 MMACHC Zornitza Stark gene: MMACHC was added
gene: MMACHC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MMACHC was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MMACHC were set to Methylmalonic aciduria and homocystinuria, cblC type
Additional findings_Paediatric v0.2 MMAB Zornitza Stark gene: MMAB was added
gene: MMAB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MMAB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MMAB were set to Methylmalonic aciduria, vitamin B12-responsive, due to defect in synthesis of adenosylcobalamin, cblB complementation type
Additional findings_Paediatric v0.2 MMAA Zornitza Stark gene: MMAA was added
gene: MMAA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MMAA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MMAA were set to Methylmalonic aciduria, vitamin B12-responsive
Additional findings_Paediatric v0.2 MLYCD Zornitza Stark gene: MLYCD was added
gene: MLYCD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MLYCD was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MLYCD were set to Malonyl-CoA decarboxylase deficiency
Additional findings_Paediatric v0.2 MLC1 Zornitza Stark gene: MLC1 was added
gene: MLC1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MLC1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MLC1 were set to Megalencephalic leukoencephalopathy
Additional findings_Paediatric v0.2 MKS1 Zornitza Stark gene: MKS1 was added
gene: MKS1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MKS1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MKS1 were set to Meckel syndrome
Additional findings_Paediatric v0.2 MKKS Zornitza Stark gene: MKKS was added
gene: MKKS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MKKS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MKKS were set to Bardet-Biedl syndrome
Additional findings_Paediatric v0.2 MITF Zornitza Stark gene: MITF was added
gene: MITF was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MITF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MITF were set to Waardenburg syndrome
Additional findings_Paediatric v0.2 MGP Zornitza Stark gene: MGP was added
gene: MGP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MGP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MGP were set to Keutel syndrome
Additional findings_Paediatric v0.2 MFSD8 Zornitza Stark gene: MFSD8 was added
gene: MFSD8 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MFSD8 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MFSD8 were set to Ceroid lipofuscinosis, neuronal
Additional findings_Paediatric v0.2 MFN2 Zornitza Stark gene: MFN2 was added
gene: MFN2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MFN2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MFN2 were set to Charcot-Marie-Tooth disease
Additional findings_Paediatric v0.2 MEN1 Zornitza Stark gene: MEN1 was added
gene: MEN1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MEN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MEN1 were set to Multiple endocrine neoplasia I
Additional findings_Paediatric v0.2 MEGF10 Zornitza Stark gene: MEGF10 was added
gene: MEGF10 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MEGF10 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MEGF10 were set to Myopathy, areflexia, respiratory distress, and dysphagia, early-onset
Additional findings_Paediatric v0.2 MEFV Zornitza Stark gene: MEFV was added
gene: MEFV was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MEFV was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MEFV were set to Mediterranean fever, familial
Additional findings_Paediatric v0.2 MED12 Zornitza Stark gene: MED12 was added
gene: MED12 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MED12 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: MED12 were set to Intellectual disability
Additional findings_Paediatric v0.2 MECP2 Zornitza Stark gene: MECP2 was added
gene: MECP2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MECP2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: MECP2 were set to Rett syndrome
Additional findings_Paediatric v0.2 MCPH1 Zornitza Stark gene: MCPH1 was added
gene: MCPH1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MCPH1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MCPH1 were set to Microcephaly 1, primary, autosomal recessive
Additional findings_Paediatric v0.2 MCOLN1 Zornitza Stark gene: MCOLN1 was added
gene: MCOLN1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MCOLN1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MCOLN1 were set to Mucolipidosis IV
Additional findings_Paediatric v0.2 MCFD2 Zornitza Stark gene: MCFD2 was added
gene: MCFD2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MCFD2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MCFD2 were set to Factor V and Factor VIII deficiency, combined
Additional findings_Paediatric v0.2 MBTPS2 Zornitza Stark gene: MBTPS2 was added
gene: MBTPS2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MBTPS2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: MBTPS2 were set to Ichthyosis follicularis, alopecia & photophobia
Additional findings_Paediatric v0.2 MARVELD2 Zornitza Stark gene: MARVELD2 was added
gene: MARVELD2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MARVELD2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MARVELD2 were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 MAP2K2 Zornitza Stark gene: MAP2K2 was added
gene: MAP2K2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MAP2K2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MAP2K2 were set to Cardiofaciocutaneous syndrome
Additional findings_Paediatric v0.2 MAP2K1 Zornitza Stark gene: MAP2K1 was added
gene: MAP2K1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MAP2K1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MAP2K1 were set to Cardiofaciocutaneous syndrome
Additional findings_Paediatric v0.2 MAN2B1 Zornitza Stark gene: MAN2B1 was added
gene: MAN2B1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MAN2B1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: MAN2B1 were set to Mannosidosis, alpha
Additional findings_Paediatric v0.2 MAGI2 Zornitza Stark gene: MAGI2 was added
gene: MAGI2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MAGI2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MAGI2 were set to Infantile spasms
Additional findings_Paediatric v0.2 MAFB Zornitza Stark gene: MAFB was added
gene: MAFB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: MAFB was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: MAFB were set to Multicentric carpotarsal osteolysis syndrome
Additional findings_Paediatric v0.2 LYST Zornitza Stark gene: LYST was added
gene: LYST was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LYST was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LYST were set to Chediak-Higashi syndrome
Additional findings_Paediatric v0.2 LTBP4 Zornitza Stark gene: LTBP4 was added
gene: LTBP4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LTBP4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LTBP4 were set to Cutis laxa, autosomal recessive, type IC
Additional findings_Paediatric v0.2 LRTOMT Zornitza Stark gene: LRTOMT was added
gene: LRTOMT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LRTOMT was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LRTOMT were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 LRSAM1 Zornitza Stark gene: LRSAM1 was added
gene: LRSAM1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LRSAM1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: LRSAM1 were set to Charcot-Marie-Tooth disease
Additional findings_Paediatric v0.2 LRRC6 Zornitza Stark gene: LRRC6 was added
gene: LRRC6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LRRC6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LRRC6 were set to Primary ciliary dyskinesia
Additional findings_Paediatric v0.2 LRPPRC Zornitza Stark gene: LRPPRC was added
gene: LRPPRC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LRPPRC was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LRPPRC were set to Leigh syndrome
Additional findings_Paediatric v0.2 LRP5 Zornitza Stark Mode of inheritance for gene LRP5 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Osteopetrosis, autosomal dominant for gene: LRP5
Additional findings_Paediatric v0.2 LRP5 Zornitza Stark gene: LRP5 was added
gene: LRP5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LRP5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LRP5 were set to Osteoporosis-pseudoglioma syndrome
Additional findings_Paediatric v0.2 LRP4 Zornitza Stark gene: LRP4 was added
gene: LRP4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LRP4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LRP4 were set to Cenani-Lenz syndactyly syndrome
Additional findings_Paediatric v0.2 LRP2 Zornitza Stark gene: LRP2 was added
gene: LRP2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LRP2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LRP2 were set to Donnai-Barrow syndrome
Additional findings_Paediatric v0.2 LOXHD1 Zornitza Stark gene: LOXHD1 was added
gene: LOXHD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LOXHD1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LOXHD1 were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 LMX1B Zornitza Stark gene: LMX1B was added
gene: LMX1B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LMX1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: LMX1B were set to Nail patella syndrome
Additional findings_Paediatric v0.2 LMOD3 Zornitza Stark gene: LMOD3 was added
gene: LMOD3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LMOD3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LMOD3 were set to Nemaline myopathy
Additional findings_Paediatric v0.2 LMNA Zornitza Stark Mode of inheritance for gene LMNA was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BIALLELIC, autosomal or pseudoautosomal
Added phenotypes Charcot-Marie-Tooth disease for gene: LMNA
Additional findings_Paediatric v0.2 LMNA Zornitza Stark gene: LMNA was added
gene: LMNA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LMNA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: LMNA were set to Emery-Dreifuss muscular dystrophy 2
Additional findings_Paediatric v0.2 LMBRD1 Zornitza Stark gene: LMBRD1 was added
gene: LMBRD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LMBRD1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LMBRD1 were set to Methylmalonic aciduria and homocystinuria
Additional findings_Paediatric v0.2 LITAF Zornitza Stark gene: LITAF was added
gene: LITAF was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LITAF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: LITAF were set to Charcot-Marie-Tooth disease
Additional findings_Paediatric v0.2 LIPA Zornitza Stark gene: LIPA was added
gene: LIPA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LIPA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LIPA were set to Wolman syndrome
Additional findings_Paediatric v0.2 LIG4 Zornitza Stark gene: LIG4 was added
gene: LIG4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LIG4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LIG4 were set to Severe combined immunodeficiency with sensitivity to ionizing radiation
Additional findings_Paediatric v0.2 LIFR Zornitza Stark gene: LIFR was added
gene: LIFR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LIFR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LIFR were set to Stuve-Wiedemann syndrome
Additional findings_Paediatric v0.2 LHX3 Zornitza Stark gene: LHX3 was added
gene: LHX3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LHX3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LHX3 were set to Pituitary hormone deficiency, combined
Additional findings_Paediatric v0.2 LHFPL5 Zornitza Stark gene: LHFPL5 was added
gene: LHFPL5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LHFPL5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LHFPL5 were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 LEPR Zornitza Stark gene: LEPR was added
gene: LEPR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LEPR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LEPR were set to Obesity, morbid, due to leptin receptor deficiency
Additional findings_Paediatric v0.2 LDLR Zornitza Stark gene: LDLR was added
gene: LDLR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LDLR was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: LDLR were set to Hypercholesterolemia
Additional findings_Paediatric v0.2 LBR Zornitza Stark gene: LBR was added
gene: LBR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LBR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LBR were set to Pelger-Huet anomaly
Additional findings_Paediatric v0.2 LARGE1 Zornitza Stark gene: LARGE1 was added
gene: LARGE1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LARGE1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LARGE1 were set to Walker-Warburg syndrome
Additional findings_Paediatric v0.2 LAMP2 Zornitza Stark gene: LAMP2 was added
gene: LAMP2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LAMP2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: LAMP2 were set to Danon disease
Additional findings_Paediatric v0.2 LAMC2 Zornitza Stark gene: LAMC2 was added
gene: LAMC2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LAMC2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LAMC2 were set to Epidermolysis bullosa, junctional
Additional findings_Paediatric v0.2 LAMB3 Zornitza Stark gene: LAMB3 was added
gene: LAMB3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LAMB3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LAMB3 were set to Epidermolysis bullosa, junctional
Additional findings_Paediatric v0.2 LAMB2 Zornitza Stark gene: LAMB2 was added
gene: LAMB2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LAMB2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LAMB2 were set to Pierson syndrome
Additional findings_Paediatric v0.2 LAMA3 Zornitza Stark gene: LAMA3 was added
gene: LAMA3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LAMA3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LAMA3 were set to Epidermolysis bullosa, junctional
Additional findings_Paediatric v0.2 LAMA2 Zornitza Stark gene: LAMA2 was added
gene: LAMA2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: LAMA2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: LAMA2 were set to Muscular dystrophy, congenital merosin-deficient
Additional findings_Paediatric v0.2 L1CAM Zornitza Stark gene: L1CAM was added
gene: L1CAM was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: L1CAM was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: L1CAM were set to X-linked hydrocephalus syndrome
Additional findings_Paediatric v0.2 KRT6A Zornitza Stark gene: KRT6A was added
gene: KRT6A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KRT6A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KRT6A were set to Pachyonychia congenita
Additional findings_Paediatric v0.2 KRT5 Zornitza Stark gene: KRT5 was added
gene: KRT5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KRT5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KRT5 were set to Epidermolysis bullosa simplex
Additional findings_Paediatric v0.2 KRT17 Zornitza Stark gene: KRT17 was added
gene: KRT17 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KRT17 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KRT17 were set to Pachyonychia congenita
Additional findings_Paediatric v0.2 KRT16 Zornitza Stark gene: KRT16 was added
gene: KRT16 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KRT16 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KRT16 were set to Pachyonychia congenita
Additional findings_Paediatric v0.2 KRT14 Zornitza Stark gene: KRT14 was added
gene: KRT14 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KRT14 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KRT14 were set to Epidermolysis bullosa simplex
Additional findings_Paediatric v0.2 KRAS Zornitza Stark gene: KRAS was added
gene: KRAS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KRAS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KRAS were set to Noonan syndrome
Additional findings_Paediatric v0.2 KMT2D Zornitza Stark gene: KMT2D was added
gene: KMT2D was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KMT2D was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KMT2D were set to Kabuki syndrome 1
Additional findings_Paediatric v0.2 KLHL41 Zornitza Stark gene: KLHL41 was added
gene: KLHL41 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KLHL41 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: KLHL41 were set to Nemaline myopathy
Additional findings_Paediatric v0.2 KLHL40 Zornitza Stark gene: KLHL40 was added
gene: KLHL40 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KLHL40 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: KLHL40 were set to Nemaline myopathy
Additional findings_Paediatric v0.2 KIT Zornitza Stark gene: KIT was added
gene: KIT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KIT was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KIT were set to Piebaldism
Additional findings_Paediatric v0.2 KIF21A Zornitza Stark gene: KIF21A was added
gene: KIF21A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KIF21A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KIF21A were set to Fibrosis of extraocular muscles, congenital
Additional findings_Paediatric v0.2 KDM6A Zornitza Stark gene: KDM6A was added
gene: KDM6A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KDM6A was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: KDM6A were set to Kabuki syndrome 2
Additional findings_Paediatric v0.2 KCTD7 Zornitza Stark gene: KCTD7 was added
gene: KCTD7 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KCTD7 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: KCTD7 were set to Epilepsy, progressive myoclonic
Additional findings_Paediatric v0.2 KCNQ4 Zornitza Stark gene: KCNQ4 was added
gene: KCNQ4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KCNQ4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KCNQ4 were set to Deafness, autosomal dominant
Additional findings_Paediatric v0.2 KCNQ1 Zornitza Stark gene: KCNQ1 was added
gene: KCNQ1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KCNQ1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: KCNQ1 were set to Jervell and Lange-Nielsen syndrome
Additional findings_Paediatric v0.2 KCNJ2 Zornitza Stark gene: KCNJ2 was added
gene: KCNJ2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KCNJ2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KCNJ2 were set to Andersen cardiodysrhythmic periodic paralysis
Additional findings_Paediatric v0.2 KCNJ11 Zornitza Stark gene: KCNJ11 was added
gene: KCNJ11 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KCNJ11 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: KCNJ11 were set to Hyperinsulinemic hypoglycemia, familial
Additional findings_Paediatric v0.2 KCNJ1 Zornitza Stark gene: KCNJ1 was added
gene: KCNJ1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KCNJ1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: KCNJ1 were set to Bartter syndrome
Additional findings_Paediatric v0.2 KCNE1 Zornitza Stark gene: KCNE1 was added
gene: KCNE1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KCNE1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: KCNE1 were set to Jervell and Lange-Nielsen syndrome
Additional findings_Paediatric v0.2 KCNA1 Zornitza Stark gene: KCNA1 was added
gene: KCNA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KCNA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KCNA1 were set to Episodic ataxia type 1
Additional findings_Paediatric v0.2 KBTBD13 Zornitza Stark gene: KBTBD13 was added
gene: KBTBD13 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KBTBD13 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KBTBD13 were set to Nemaline myopathy
Additional findings_Paediatric v0.2 KAT6B Zornitza Stark gene: KAT6B was added
gene: KAT6B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KAT6B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: KAT6B were set to Genitopatellar syndrome
Additional findings_Paediatric v0.2 KANSL1 Zornitza Stark gene: KANSL1 was added
gene: KANSL1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: KANSL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: KANSL1 were set to Koolen-De Vries syndrome
Additional findings_Paediatric v0.2 JUP Zornitza Stark gene: JUP was added
gene: JUP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: JUP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: JUP were set to Naxos disease
Additional findings_Paediatric v0.2 JAK3 Zornitza Stark gene: JAK3 was added
gene: JAK3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: JAK3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: JAK3 were set to SCID, autosomal recessive, T-negative/B-positive type
Additional findings_Paediatric v0.2 JAG1 Zornitza Stark gene: JAG1 was added
gene: JAG1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: JAG1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: JAG1 were set to Alagille syndrome
Additional findings_Paediatric v0.2 IVD Zornitza Stark gene: IVD was added
gene: IVD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: IVD was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: IVD were set to Isovaleric acidemia
Additional findings_Paediatric v0.2 ITGB4 Zornitza Stark gene: ITGB4 was added
gene: ITGB4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ITGB4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ITGB4 were set to Epidermolysis bullosa, junctional, with pyloric atresia
Additional findings_Paediatric v0.2 ISPD Zornitza Stark gene: ISPD was added
gene: ISPD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ISPD was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ISPD were set to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7
Additional findings_Paediatric v0.2 IRF6 Zornitza Stark gene: IRF6 was added
gene: IRF6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: IRF6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: IRF6 were set to van der Woude syndrome
Additional findings_Paediatric v0.2 IQCB1 Zornitza Stark gene: IQCB1 was added
gene: IQCB1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: IQCB1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: IQCB1 were set to Senior-Loken syndrome 5
Additional findings_Paediatric v0.2 INVS Zornitza Stark gene: INVS was added
gene: INVS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: INVS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: INVS were set to Nephronophthisis 2
Additional findings_Paediatric v0.2 INSR Zornitza Stark gene: INSR was added
gene: INSR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: INSR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: INSR were set to Leprechaunism
Additional findings_Paediatric v0.2 ILDR1 Zornitza Stark gene: ILDR1 was added
gene: ILDR1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ILDR1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ILDR1 were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.2 IL2RG Zornitza Stark gene: IL2RG was added
gene: IL2RG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: IL2RG was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: IL2RG were set to Severe combined immunodeficiency, X-linked
Additional findings_Paediatric v0.2 IL10RA Zornitza Stark gene: IL10RA was added
gene: IL10RA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: IL10RA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: IL10RA were set to Inflammatory bowel disease
Additional findings_Paediatric v0.2 IKBKG Zornitza Stark gene: IKBKG was added
gene: IKBKG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: IKBKG was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: IKBKG were set to Incontinentia pigmenti 1
Additional findings_Paediatric v0.2 ELP1 Zornitza Stark gene: ELP1 was added
gene: ELP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ELP1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ELP1 were set to Dysautonomia, familial
Additional findings_Paediatric v0.2 IGSF1 Zornitza Stark gene: IGSF1 was added
gene: IGSF1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: IGSF1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: IGSF1 were set to Central hypothyroidism and testicular enlargement
Additional findings_Paediatric v0.2 IGHMBP2 Zornitza Stark gene: IGHMBP2 was added
gene: IGHMBP2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: IGHMBP2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: IGHMBP2 were set to Spinal muscular atrophy with respiratory distress
Additional findings_Paediatric v0.2 IDUA Zornitza Stark gene: IDUA was added
gene: IDUA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: IDUA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: IDUA were set to Mucopolysaccharidosis Ih
Additional findings_Paediatric v0.2 IDS Zornitza Stark gene: IDS was added
gene: IDS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: IDS was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: IDS were set to Mucopolysaccharidosis II
Additional findings_Paediatric v0.2 HTRA1 Zornitza Stark gene: HTRA1 was added
gene: HTRA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HTRA1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HTRA1 were set to CARASIL syndrome
Additional findings_Paediatric v0.2 HSPG2 Zornitza Stark gene: HSPG2 was added
gene: HSPG2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HSPG2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HSPG2 were set to Schwartz-Jampel syndrome
Additional findings_Paediatric v0.2 HSPB8 Zornitza Stark gene: HSPB8 was added
gene: HSPB8 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HSPB8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: HSPB8 were set to Charcot-Marie-Tooth disease, axonal, type 2L
Additional findings_Paediatric v0.2 HSD3B7 Zornitza Stark gene: HSD3B7 was added
gene: HSD3B7 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HSD3B7 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HSD3B7 were set to 3 beta-hydroxysteroid dehydrogenase deficiency
Additional findings_Paediatric v0.2 HSD17B4 Zornitza Stark gene: HSD17B4 was added
gene: HSD17B4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HSD17B4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HSD17B4 were set to D-bifunctional protein deficiency
Additional findings_Paediatric v0.2 HSD17B3 Zornitza Stark gene: HSD17B3 was added
gene: HSD17B3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HSD17B3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HSD17B3 were set to Pseudohermaphroditism, male, with gynecomastia
Additional findings_Paediatric v0.2 HSD17B10 Zornitza Stark gene: HSD17B10 was added
gene: HSD17B10 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HSD17B10 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: HSD17B10 were set to 17-beta-hydroxysteroid dehydrogenase X deficiency
Additional findings_Paediatric v0.2 HRAS Zornitza Stark gene: HRAS was added
gene: HRAS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HRAS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: HRAS were set to Costello syndrome
Additional findings_Paediatric v0.2 HPS5 Zornitza Stark gene: HPS5 was added
gene: HPS5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HPS5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HPS5 were set to Hermansky-Pudlak syndrome 5
Additional findings_Paediatric v0.2 HPS4 Zornitza Stark gene: HPS4 was added
gene: HPS4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HPS4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HPS4 were set to Hermansky-Pudlak syndrome 4
Additional findings_Paediatric v0.2 HPS3 Zornitza Stark gene: HPS3 was added
gene: HPS3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HPS3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HPS3 were set to Hermansky-Pudlak syndrome 3
Additional findings_Paediatric v0.2 HPS1 Zornitza Stark gene: HPS1 was added
gene: HPS1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HPS1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HPS1 were set to Hermansky-Pudlak syndrome 1
Additional findings_Paediatric v0.2 HPRT1 Zornitza Stark gene: HPRT1 was added
gene: HPRT1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HPRT1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: HPRT1 were set to Lesch-Nyhan syndrome 1
Additional findings_Paediatric v0.2 HMGCL Zornitza Stark gene: HMGCL was added
gene: HMGCL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HMGCL was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HMGCL were set to 3-hydroxy-3-methylglutaric aciduria
Additional findings_Paediatric v0.2 HLCS Zornitza Stark gene: HLCS was added
gene: HLCS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HLCS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HLCS were set to Holocarboxylase synthetase deficiency
Additional findings_Paediatric v0.2 HINT1 Zornitza Stark gene: HINT1 was added
gene: HINT1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HINT1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HINT1 were set to Axonal neuropathy with neuromyotonia
Additional findings_Paediatric v0.2 HGSNAT Zornitza Stark gene: HGSNAT was added
gene: HGSNAT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HGSNAT was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HGSNAT were set to Mucopolysaccharidosis IIIC
Additional findings_Paediatric v0.2 HGD Zornitza Stark gene: HGD was added
gene: HGD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HGD was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HGD were set to Alkaptonuria
Additional findings_Paediatric v0.2 HEXB Zornitza Stark gene: HEXB was added
gene: HEXB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HEXB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HEXB were set to Sandhoff disease, infantile, juvenile, and adult forms
Additional findings_Paediatric v0.2 HEXA Zornitza Stark gene: HEXA was added
gene: HEXA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HEXA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HEXA were set to Tay-Sachs disease
Additional findings_Paediatric v0.2 HDAC8 Zornitza Stark gene: HDAC8 was added
gene: HDAC8 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HDAC8 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: HDAC8 were set to Cornelia de Lange syndrome-like features, ocular hypertelorism & large fontanelle
Additional findings_Paediatric v0.2 HBB Zornitza Stark gene: HBB was added
gene: HBB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HBB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HBB were set to Beta-thalassemia
Additional findings_Paediatric v0.2 HBA2 Zornitza Stark gene: HBA2 was added
gene: HBA2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HBA2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HBA2 were set to Thalassemia, alpha
Additional findings_Paediatric v0.2 HBA1 Zornitza Stark gene: HBA1 was added
gene: HBA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HBA1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HBA1 were set to Thalassaemia alpha
Additional findings_Paediatric v0.2 HADHB Zornitza Stark gene: HADHB was added
gene: HADHB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HADHB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HADHB were set to Mitochondrial trifunctional protein deficiency
Additional findings_Paediatric v0.2 HADHA Zornitza Stark gene: HADHA was added
gene: HADHA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HADHA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HADHA were set to Mitochondrial trifunctional protein deficiency
Additional findings_Paediatric v0.2 HADH Zornitza Stark gene: HADH was added
gene: HADH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: HADH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: HADH were set to Hyperinsulinemic hypoglycemia, familial, 4
Additional findings_Paediatric v0.2 H19 Zornitza Stark gene: H19 was added
gene: H19 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: H19 was set to Unknown
Phenotypes for gene: H19 were set to Beckwith-Wiedemann Syndrome
Additional findings_Paediatric v0.2 GYS2 Zornitza Stark gene: GYS2 was added
gene: GYS2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GYS2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GYS2 were set to Glycogen storage disease 0
Additional findings_Paediatric v0.2 GUSB Zornitza Stark gene: GUSB was added
gene: GUSB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GUSB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GUSB were set to Mucopolysaccharidosis VII
Additional findings_Paediatric v0.2 GSS Zornitza Stark gene: GSS was added
gene: GSS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GSS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GSS were set to Glutathione synthetase deficiency
Additional findings_Paediatric v0.2 GRHPR Zornitza Stark gene: GRHPR was added
gene: GRHPR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GRHPR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GRHPR were set to Hyperoxaluria, primary, type II
Additional findings_Paediatric v0.2 GPSM2 Zornitza Stark gene: GPSM2 was added
gene: GPSM2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GPSM2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GPSM2 were set to Chudley-McCullough syndrome
Additional findings_Paediatric v0.2 PDZD7 Zornitza Stark Added phenotypes Usher syndrome for gene: PDZD7
Additional findings_Paediatric v0.2 ADGRG1 Zornitza Stark Added phenotypes Polymicrogyria, bilateral frontoparietal for gene: ADGRG1
Additional findings_Paediatric v0.2 GPR143 Zornitza Stark Added phenotypes Ocular albinism, type I for gene: GPR143
Additional findings_Paediatric v0.2 GPC3 Zornitza Stark Added phenotypes Simpson-Golabi-Behmel syndrome for gene: GPC3
Additional findings_Paediatric v0.2 GNS Zornitza Stark Added phenotypes Mucopolysaccharidosis IIId for gene: GNS
Additional findings_Paediatric v0.2 GNPTG Zornitza Stark Added phenotypes Mucolipidosis III gamma for gene: GNPTG
Additional findings_Paediatric v0.2 GNPTAB Zornitza Stark Added phenotypes Mucolipidosis II for gene: GNPTAB
Additional findings_Paediatric v0.2 GNE Zornitza Stark Added phenotypes Inclusion body myopathy for gene: GNE
Additional findings_Paediatric v0.2 GNAS Zornitza Stark Added phenotypes Pseudopseudohypoparathyroidism for gene: GNAS
Additional findings_Paediatric v0.2 GNAS Zornitza Stark Added phenotypes Pseudohypoparathyroidism for gene: GNAS
Additional findings_Paediatric v0.2 GLUD1 Zornitza Stark Added phenotypes Hyperinsulinism for gene: GLUD1
Additional findings_Paediatric v0.2 GLRA1 Zornitza Stark Added phenotypes Hyperekplexia, hereditary 1, autosomal dominant or recessive for gene: GLRA1
Additional findings_Paediatric v0.2 GLI3 Zornitza Stark Added phenotypes Greig cephalopolysyndactyly syndrome for gene: GLI3
Additional findings_Paediatric v0.2 GLDC Zornitza Stark Added phenotypes Glycine encephalopathy for gene: GLDC
Additional findings_Paediatric v0.2 GLB1 Zornitza Stark Added phenotypes Gangliosidosis GM1 for gene: GLB1
Additional findings_Paediatric v0.2 GLA Zornitza Stark Added phenotypes Fabry disease for gene: GLA
Additional findings_Paediatric v0.2 GJC2 Zornitza Stark Added phenotypes Pelizaeus-Merzbacher-like disease for gene: GJC2
Additional findings_Paediatric v0.2 GJB2 Zornitza Stark Mode of inheritance for gene GJB2 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Deafness and palmoplantar keratoderma for gene: GJB2
Additional findings_Paediatric v0.2 GJB2 Zornitza Stark Mode of inheritance for gene GJB2 was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BIALLELIC, autosomal or pseudoautosomal
Added phenotypes Deafness for gene: GJB2
Additional findings_Paediatric v0.2 GJB1 Zornitza Stark Added phenotypes Charcot-Marie-Tooth neuropathy for gene: GJB1
Additional findings_Paediatric v0.2 GJA1 Zornitza Stark Added phenotypes Oculodentodigital dysplasia for gene: GJA1
Additional findings_Paediatric v0.2 GIPC3 Zornitza Stark Added phenotypes Hearing loss for gene: GIPC3
Additional findings_Paediatric v0.2 GFPT1 Zornitza Stark Added phenotypes Congenital myasthenic syndrome, limb-girdle for gene: GFPT1
Additional findings_Paediatric v0.2 GFM1 Zornitza Stark Added phenotypes Combined oxidative phosphorylation deficiency 1 for gene: GFM1
Additional findings_Paediatric v0.2 GFAP Zornitza Stark Added phenotypes Alexander disease for gene: GFAP
Additional findings_Paediatric v0.2 GDAP1 Zornitza Stark Added phenotypes Charcot-Marie-Tooth disease for gene: GDAP1
Additional findings_Paediatric v0.2 GCK Zornitza Stark Added phenotypes Hyperinsulinemic hypoglycemia, familial for gene: GCK
Additional findings_Paediatric v0.2 GCDH Zornitza Stark Added phenotypes Glutaricaciduria, type I for gene: GCDH
Additional findings_Paediatric v0.2 GBE1 Zornitza Stark Added phenotypes Glycogen storage disease IV for gene: GBE1
Additional findings_Paediatric v0.2 GBA Zornitza Stark Added phenotypes Gaucher disease 1 for gene: GBA
Additional findings_Paediatric v0.2 GATA4 Zornitza Stark Added phenotypes Congenital heart defects for gene: GATA4
Additional findings_Paediatric v0.2 GATA1 Zornitza Stark Added phenotypes Dyserythropoietic anemia with thrombocytopenia for gene: GATA1
Additional findings_Paediatric v0.2 GAN Zornitza Stark Added phenotypes Giant axonal neuropathy for gene: GAN
Additional findings_Paediatric v0.2 GALT Zornitza Stark Added phenotypes Galactosaemia for gene: GALT
Additional findings_Paediatric v0.2 GALNS Zornitza Stark Added phenotypes Mucopolysaccharidosis IVA for gene: GALNS
Additional findings_Paediatric v0.2 GALK1 Zornitza Stark Added phenotypes Galactokinase deficiency with cataracts for gene: GALK1
Additional findings_Paediatric v0.2 GALC Zornitza Stark Added phenotypes Krabbe disease for gene: GALC
Additional findings_Paediatric v0.2 GAA Zornitza Stark Added phenotypes Glycogen storage disease II for gene: GAA
Additional findings_Paediatric v0.2 G6PD Zornitza Stark Added phenotypes Glucose-6-phosphate dehydrogenase deficiency for gene: G6PD
Additional findings_Paediatric v0.2 G6PC3 Zornitza Stark Added phenotypes Neutropaenia, congenital for gene: G6PC3
Additional findings_Paediatric v0.2 G6PC Zornitza Stark Added phenotypes Glycogen storage disease Ia for gene: G6PC
Additional findings_Paediatric v0.2 FXN Zornitza Stark Added phenotypes Friedreich ataxia for gene: FXN
Additional findings_Paediatric v0.2 FUCA1 Zornitza Stark Added phenotypes Fucosidosis for gene: FUCA1
Additional findings_Paediatric v0.2 FTL Zornitza Stark Added phenotypes Neuroferritinopathy for gene: FTL
Additional findings_Paediatric v0.2 FRAS1 Zornitza Stark Added phenotypes Fraser syndrome for gene: FRAS1
Additional findings_Paediatric v0.2 FOXP3 Zornitza Stark Added phenotypes IPEX syndrome for gene: FOXP3
Additional findings_Paediatric v0.2 FOXF1 Zornitza Stark Added phenotypes Alveolar capillary dysplasia with misalignment of pulmonary veins for gene: FOXF1
Additional findings_Paediatric v0.2 FOXC2 Zornitza Stark Added phenotypes Lymphoedema, primary for gene: FOXC2
Additional findings_Paediatric v0.2 FOXC1 Zornitza Stark Added phenotypes Axenfeld-Rieger syndrome for gene: FOXC1
Additional findings_Paediatric v0.2 FLNA Zornitza Stark Added phenotypes Otopalatodigital spectrum disorder for gene: FLNA
Additional findings_Paediatric v0.2 FLCN Zornitza Stark Added phenotypes Birt-Hogg-Dube syndrome for gene: FLCN
Additional findings_Paediatric v0.2 FKTN Zornitza Stark Added phenotypes Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies for gene: FKTN
Additional findings_Paediatric v0.2 FKTN Zornitza Stark Added phenotypes Muscular dystrophy, Fukuyama for gene: FKTN
Additional findings_Paediatric v0.2 FKRP Zornitza Stark Added phenotypes Muscle-eye-brain disease for gene: FKRP
Additional findings_Paediatric v0.2 FKRP Zornitza Stark Added phenotypes Muscular dystrophy, limb girdle 2I for gene: FKRP
Additional findings_Paediatric v0.2 FHL1 Zornitza Stark Added phenotypes Emery-Dreifuss muscular dystrophy for gene: FHL1
Additional findings_Paediatric v0.2 FH Zornitza Stark Added phenotypes Fumarase deficiency for gene: FH
Additional findings_Paediatric v0.2 FGG Zornitza Stark Added phenotypes Afibrinogenaemia for gene: FGG
Additional findings_Paediatric v0.2 FGFR3 Zornitza Stark Added phenotypes Muenke syndrome for gene: FGFR3
Additional findings_Paediatric v0.2 FGFR3 Zornitza Stark Added phenotypes Thanatophoric dysplasia type 1 for gene: FGFR3
Additional findings_Paediatric v0.2 FGFR3 Zornitza Stark Added phenotypes Crouzon syndrome with acanthosis nigricans for gene: FGFR3
Additional findings_Paediatric v0.2 FGFR3 Zornitza Stark Added phenotypes Hypochondroplasia for gene: FGFR3
Additional findings_Paediatric v0.2 FGFR3 Zornitza Stark Added phenotypes Achondroplasia for gene: FGFR3
Additional findings_Paediatric v0.2 FGFR2 Zornitza Stark Added phenotypes Jackson-Weiss syndrome for gene: FGFR2
Additional findings_Paediatric v0.2 FGFR2 Zornitza Stark Added phenotypes Beare-Stevenson cutis gyrata syndrome for gene: FGFR2
Additional findings_Paediatric v0.2 FGFR2 Zornitza Stark Added phenotypes Crouzon syndrome for gene: FGFR2
Additional findings_Paediatric v0.2 FGFR2 Zornitza Stark Added phenotypes Apert syndrome for gene: FGFR2
Additional findings_Paediatric v0.2 FGFR2 Zornitza Stark Added phenotypes Pfeiffer syndrome for gene: FGFR2
Additional findings_Paediatric v0.2 FGFR1 Zornitza Stark Added phenotypes Kallmann syndrome for gene: FGFR1
Additional findings_Paediatric v0.2 FGF3 Zornitza Stark Added phenotypes Deafness, congenital with inner ear agenesis, microtia, and microdontia for gene: FGF3
Additional findings_Paediatric v0.2 FGD4 Zornitza Stark Added phenotypes Charcot-Marie-Tooth disease for gene: FGD4
Additional findings_Paediatric v0.2 FGD1 Zornitza Stark Added phenotypes Aarskog-Scott syndrome for gene: FGD1
Additional findings_Paediatric v0.2 FGB Zornitza Stark Added phenotypes Afibrinogenaemia for gene: FGB
Additional findings_Paediatric v0.2 FGA Zornitza Stark Added phenotypes Afibrinogenaemia for gene: FGA
Additional findings_Paediatric v0.2 FBN2 Zornitza Stark Added phenotypes Contractural arachnodactyly for gene: FBN2
Additional findings_Paediatric v0.2 FBN1 Zornitza Stark Added phenotypes Marfan's syndrome for gene: FBN1
Additional findings_Paediatric v0.2 FBLN5 Zornitza Stark Added phenotypes Cutis laxa for gene: FBLN5
Additional findings_Paediatric v0.2 FANCI Zornitza Stark Added phenotypes Fanconi anaemia for gene: FANCI
Additional findings_Paediatric v0.2 FANCG Zornitza Stark Added phenotypes Fanconi anaemia for gene: FANCG
Additional findings_Paediatric v0.2 FANCD2 Zornitza Stark Added phenotypes Fanconi anaemia for gene: FANCD2
Additional findings_Paediatric v0.2 FANCC Zornitza Stark Added phenotypes Fanconi anaemia for gene: FANCC
Additional findings_Paediatric v0.2 FANCB Zornitza Stark Added phenotypes Fanconi anaemia for gene: FANCB
Additional findings_Paediatric v0.2 FANCA Zornitza Stark Added phenotypes Fanconi anaemia for gene: FANCA
Additional findings_Paediatric v0.2 FAM58A Zornitza Stark Added phenotypes Syndactyly - telecanthus - anogenital and renal malformations for gene: FAM58A
Additional findings_Paediatric v0.2 FAM20C Zornitza Stark Added phenotypes Osteosclerotic bone dysplasia for gene: FAM20C
Additional findings_Paediatric v0.2 FAM161A Zornitza Stark Added phenotypes Retinal dystrophy for gene: FAM161A
Additional findings_Paediatric v0.2 FAM126A Zornitza Stark Added phenotypes Hypomyelination and congenital cataract for gene: FAM126A
Additional findings_Paediatric v0.2 FAH Zornitza Stark Added phenotypes Tyrosinemia, type I for gene: FAH
Additional findings_Paediatric v0.2 F9 Zornitza Stark Added phenotypes Hemophilia B for gene: F9
Additional findings_Paediatric v0.2 F8 Zornitza Stark Added phenotypes Hemophilia A for gene: F8
Additional findings_Paediatric v0.2 F2 Zornitza Stark Added phenotypes Prothrombin deficiency for gene: F2
Additional findings_Paediatric v0.2 F11 Zornitza Stark Added phenotypes Factor XI deficiency for gene: F11
Additional findings_Paediatric v0.2 EZH2 Zornitza Stark Added phenotypes Weaver syndrome 2 for gene: EZH2
Additional findings_Paediatric v0.2 EYA4 Zornitza Stark Added phenotypes Deafness, autosomal dominant for gene: EYA4
Additional findings_Paediatric v0.2 EYA1 Zornitza Stark Added phenotypes Branchiootorenal syndrome for gene: EYA1
Additional findings_Paediatric v0.2 EXT2 Zornitza Stark Added phenotypes Exostoses, multiple, type 2 for gene: EXT2
Additional findings_Paediatric v0.2 EXT1 Zornitza Stark Added phenotypes Exostoses, multiple, type 1 for gene: EXT1
Additional findings_Paediatric v0.2 EVC2 Zornitza Stark Added phenotypes Ellis-van Creveld syndrome for gene: EVC2
Additional findings_Paediatric v0.2 EVC Zornitza Stark Added phenotypes Ellis-van Creveld syndrome for gene: EVC
Additional findings_Paediatric v0.2 ETHE1 Zornitza Stark Added phenotypes Ethylmalonic encephalopathy for gene: ETHE1
Additional findings_Paediatric v0.2 ETFDH Zornitza Stark Added phenotypes Glutaric acidemia IIC for gene: ETFDH
Additional findings_Paediatric v0.2 ETFB Zornitza Stark Added phenotypes Glutaric acidemia IIB for gene: ETFB
Additional findings_Paediatric v0.2 ETFA Zornitza Stark Added phenotypes Glutaric acidemia IIA for gene: ETFA
Additional findings_Paediatric v0.2 ESRRB Zornitza Stark Added phenotypes Hearing loss for gene: ESRRB
Additional findings_Paediatric v0.2 ESCO2 Zornitza Stark Added phenotypes Roberts syndrome for gene: ESCO2
Additional findings_Paediatric v0.2 ERCC8 Zornitza Stark Added phenotypes Cockayne syndrome for gene: ERCC8
Additional findings_Paediatric v0.2 ERCC6 Zornitza Stark Added phenotypes Cockayne syndrome for gene: ERCC6
Additional findings_Paediatric v0.2 ERCC5 Zornitza Stark Added phenotypes Xeroderma pigmentosum for gene: ERCC5
Additional findings_Paediatric v0.2 ERCC2 Zornitza Stark Added phenotypes Xeroderma pigmentosum for gene: ERCC2
Additional findings_Paediatric v0.2 EPM2A Zornitza Stark Added phenotypes Epilepsy, progressive myoclonic 2A (Lafora) for gene: EPM2A
Additional findings_Paediatric v0.2 ENPP1 Zornitza Stark Added phenotypes Arterial calcification, generalized, of infancy, 1 for gene: ENPP1
Additional findings_Paediatric v0.2 ENG Zornitza Stark Added phenotypes Telangiectasia, hereditary hemorrhagic, type 1 for gene: ENG
Additional findings_Paediatric v0.2 EMD Zornitza Stark Added phenotypes Muscular dystrophy, Emery-Dreifuss for gene: EMD
Additional findings_Paediatric v0.2 ELN Zornitza Stark Added phenotypes Supravalvar aortic stenosis for gene: ELN
Additional findings_Paediatric v0.2 ELANE Zornitza Stark Added phenotypes Neutropenia, congenital for gene: ELANE
Additional findings_Paediatric v0.2 EIF2AK3 Zornitza Stark Added phenotypes Wolcott-Rallison syndrome for gene: EIF2AK3
Additional findings_Paediatric v0.2 EGR2 Zornitza Stark Added phenotypes Charcot-Marie-Tooth disease for gene: EGR2
Additional findings_Paediatric v0.2 EFTUD2 Zornitza Stark Added phenotypes Mandibulofacial dysostosis with microcephaly for gene: EFTUD2
Additional findings_Paediatric v0.2 EFHC1 Zornitza Stark Added phenotypes Myoclonic epilepsy for gene: EFHC1
Additional findings_Paediatric v0.2 EDARADD Zornitza Stark Added phenotypes Ectodermal dysplasia, hypohidrotic for gene: EDARADD
Additional findings_Paediatric v0.2 EDAR Zornitza Stark Added phenotypes Ectodermal dysplasia, hypohidrotic for gene: EDAR
Additional findings_Paediatric v0.2 EDA Zornitza Stark Added phenotypes Ectodermal dysplasia, hypohidrotic for gene: EDA
Additional findings_Paediatric v0.2 DYSF Zornitza Stark Added phenotypes Miyoshi muscular dystrophy 1 for gene: DYSF
Additional findings_Paediatric v0.2 DYSF Zornitza Stark Added phenotypes Muscular dystrophy, limb-girdle, type 2B for gene: DYSF
Additional findings_Paediatric v0.2 DUOX2 Zornitza Stark Added phenotypes Thyroid dyshormonogenesis for gene: DUOX2
Additional findings_Paediatric v0.2 DSP Zornitza Stark Added phenotypes Epidermolysis bullosa, lethal acantholytic for gene: DSP
Additional findings_Paediatric v0.2 DPAGT1 Zornitza Stark Added phenotypes Congenital disorder of glycosylation, type Ij for gene: DPAGT1
Additional findings_Paediatric v0.2 DOK7 Zornitza Stark Added phenotypes Congenital myasthenic syndrome for gene: DOK7
Additional findings_Paediatric v0.2 DOCK8 Zornitza Stark Added phenotypes Hyper-IgE syndrome for gene: DOCK8
Additional findings_Paediatric v0.2 DNMT3B Zornitza Stark Added phenotypes Immunodeficiency-centromeric instability-facial anomalies syndrome 1 for gene: DNMT3B
Additional findings_Paediatric v0.2 DNM2 Zornitza Stark Added phenotypes Charcot-Marie-Tooth disease, axonal, type 2M for gene: DNM2
Additional findings_Paediatric v0.2 DNM2 Zornitza Stark Added phenotypes Myopathy, centronuclear for gene: DNM2
Additional findings_Paediatric v0.2 DNAJB6 Zornitza Stark Added phenotypes Muscular dystrophy, limb girdle for gene: DNAJB6
Additional findings_Paediatric v0.2 DNAI1 Zornitza Stark Added phenotypes Primary ciliary dyskinesia for gene: DNAI1
Additional findings_Paediatric v0.2 DNAH5 Zornitza Stark Added phenotypes Primary ciliary dyskinesia for gene: DNAH5
Additional findings_Paediatric v0.2 DNAH11 Zornitza Stark Added phenotypes Primary ciliary dyskinesia for gene: DNAH11
Additional findings_Paediatric v0.2 DNAAF1 Zornitza Stark Added phenotypes Primary ciliary dyskinesia for gene: DNAAF1
Additional findings_Paediatric v0.2 DMPK Zornitza Stark Added phenotypes Myotonic dystrophy 1 for gene: DMPK
Additional findings_Paediatric v0.2 DMP1 Zornitza Stark Added phenotypes Hypophosphatemic rickets, AR for gene: DMP1
Additional findings_Paediatric v0.2 DMD Zornitza Stark Added phenotypes Becker muscular dystrophy for gene: DMD
Additional findings_Paediatric v0.2 DMD Zornitza Stark Added phenotypes Duchenne muscular dystrophy for gene: DMD
Additional findings_Paediatric v0.2 DLL3 Zornitza Stark Added phenotypes Spondylocostal dysostosis, autosomal recessive, 1 for gene: DLL3
Additional findings_Paediatric v0.2 DLD Zornitza Stark Added phenotypes Maple syrup urine disease, type III for gene: DLD
Additional findings_Paediatric v0.2 DHCR7 Zornitza Stark Added phenotypes Smith-Lemli-Opitz syndrome for gene: DHCR7
Additional findings_Paediatric v0.2 DGUOK Zornitza Stark Added phenotypes Mitochondrial DNA depletion syndrome for gene: DGUOK
Additional findings_Paediatric v0.2 DFNB59 Zornitza Stark Added phenotypes Hearing loss for gene: DFNB59
Additional findings_Paediatric v0.2 DFNA5 Zornitza Stark Added phenotypes Hearing loss for gene: DFNA5
Additional findings_Paediatric v0.2 DES Zornitza Stark Added phenotypes Myopathy, myofibrillar for gene: DES
Additional findings_Paediatric v0.2 DDC Zornitza Stark Added phenotypes Aromatic L-amino acid decarboxylase deficiency for gene: DDC
Additional findings_Paediatric v0.2 DDB2 Zornitza Stark Added phenotypes Xeroderma pigmentosum for gene: DDB2
Additional findings_Paediatric v0.2 DCX Zornitza Stark Added phenotypes Lissencephaly, X-linked for gene: DCX
Additional findings_Paediatric v0.2 DCLRE1C Zornitza Stark Added phenotypes Severe combined immunodeficiency, Athabascan type for gene: DCLRE1C
Additional findings_Paediatric v0.2 DBT Zornitza Stark Added phenotypes Maple syrup urine disease for gene: DBT
Additional findings_Paediatric v0.2 D2HGDH Zornitza Stark Added phenotypes D-2-hydroxyglutaric aciduria for gene: D2HGDH
Additional findings_Paediatric v0.2 CYP4F22 Zornitza Stark Added phenotypes Ichthyosis, congenital, autosomal recessive for gene: CYP4F22
Additional findings_Paediatric v0.2 CYP27B1 Zornitza Stark Added phenotypes Vitamin D-dependent rickets, type I for gene: CYP27B1
Additional findings_Paediatric v0.2 CYP27A1 Zornitza Stark Added phenotypes Cerebrotendinous xanthomatosis for gene: CYP27A1
Additional findings_Paediatric v0.2 CYP21A2 Zornitza Stark Added phenotypes Adrenal hyperplasia, congenital, due to 21-hydroxylase deficiency for gene: CYP21A2
Additional findings_Paediatric v0.2 CYP11B1 Zornitza Stark Added phenotypes Adrenal hyperplasia, congenital, due to 11-beta-hydroxylase deficiency for gene: CYP11B1
Additional findings_Paediatric v0.2 CYP11A1 Zornitza Stark Added phenotypes Adrenal insufficiency, congenital, with 46XY sex reversal, partial or complete for gene: CYP11A1
Additional findings_Paediatric v0.2 CYBB Zornitza Stark Added phenotypes Chronic granulomatous disease for gene: CYBB
Additional findings_Paediatric v0.2 CYBA Zornitza Stark Added phenotypes Chronic granulomatous disease for gene: CYBA
Additional findings_Paediatric v0.2 CUL7 Zornitza Stark Added phenotypes 3-M syndrome for gene: CUL7
Additional findings_Paediatric v0.2 CUBN Zornitza Stark Added phenotypes Megaloblastic anemia-1, Finnish type for gene: CUBN
Additional findings_Paediatric v0.2 CTSK Zornitza Stark Added phenotypes Pycnodysostosis for gene: CTSK
Additional findings_Paediatric v0.2 CTSD Zornitza Stark Added phenotypes Ceroid lipofuscinosis, neuronal, 10 for gene: CTSD
Additional findings_Paediatric v0.2 CTNS Zornitza Stark Added phenotypes Cystinosis for gene: CTNS
Additional findings_Paediatric v0.2 CTC1 Zornitza Stark Added phenotypes Coats plus syndrome for gene: CTC1
Additional findings_Paediatric v0.2 CSTB Zornitza Stark Added phenotypes Epilepsy, progressive myoclonic 1A for gene: CSTB
Additional findings_Paediatric v0.2 CSF2RA Zornitza Stark Added phenotypes Pulmonary alveolar proteinosis for gene: CSF2RA
Additional findings_Paediatric v0.2 CRYAB Zornitza Stark Added phenotypes Myofibrillar myopathy for gene: CRYAB
Additional findings_Paediatric v0.2 CRTAP Zornitza Stark Added phenotypes Osteogenesis imperfecta, type VII for gene: CRTAP
Additional findings_Paediatric v0.2 CRLF1 Zornitza Stark Added phenotypes Crisponi syndrome for gene: CRLF1
Additional findings_Paediatric v0.2 CREBBP Zornitza Stark Added phenotypes Rubinstein-Taybi syndrome for gene: CREBBP
Additional findings_Paediatric v0.2 CPT2 Zornitza Stark Added phenotypes Carnitine palmitoyltransferase 2 deficiency for gene: CPT2
Additional findings_Paediatric v0.2 CPT1A Zornitza Stark Added phenotypes Carnitine palmitoyltransferase I deficiency for gene: CPT1A
Additional findings_Paediatric v0.2 CPS1 Zornitza Stark Added phenotypes Carbamoylphosphate synthetase I deficiency for gene: CPS1
Additional findings_Paediatric v0.2 COLQ Zornitza Stark Added phenotypes Congenital myasthenic syndrome for gene: COLQ
Additional findings_Paediatric v0.2 COL7A1 Zornitza Stark Added phenotypes Epidermolysis bullosa dystrophica for gene: COL7A1
Additional findings_Paediatric v0.2 COL6A3 Zornitza Stark Added phenotypes Ullrich congenital muscular dystrophy for gene: COL6A3
Additional findings_Paediatric v0.2 COL6A2 Zornitza Stark Added phenotypes Ullrich congenital muscular dystrophy for gene: COL6A2
Additional findings_Paediatric v0.2 COL6A1 Zornitza Stark Added phenotypes Ullrich congenital muscular dystrophy for gene: COL6A1
Additional findings_Paediatric v0.2 COL5A2 Zornitza Stark Added phenotypes Ehlers-Danlos syndrome for gene: COL5A2
Additional findings_Paediatric v0.2 COL5A1 Zornitza Stark Added phenotypes Ehlers-Danlos syndrome, type I for gene: COL5A1
Additional findings_Paediatric v0.2 COL4A5 Zornitza Stark Added phenotypes Alport syndrome for gene: COL4A5
Additional findings_Paediatric v0.2 COL4A4 Zornitza Stark Added phenotypes Alport syndrome for gene: COL4A4
Additional findings_Paediatric v0.2 COL4A3 Zornitza Stark Added phenotypes Alport syndrome for gene: COL4A3
Additional findings_Paediatric v0.2 COL3A1 Zornitza Stark Added phenotypes Ehlers-Danlos syndrome, type IV for gene: COL3A1
Additional findings_Paediatric v0.2 COL2A1 Zornitza Stark Added phenotypes Stickler syndrome for gene: COL2A1
Additional findings_Paediatric v0.2 COL1A2 Zornitza Stark Added phenotypes Osteogenesis imperfecta, type II for gene: COL1A2
Additional findings_Paediatric v0.2 COL1A1 Zornitza Stark Added phenotypes Osteogenesis imperfecta, type I for gene: COL1A1
Additional findings_Paediatric v0.2 COL17A1 Zornitza Stark Added phenotypes Epidermolysis bullosa, junctional, non-Herlitz type for gene: COL17A1
Additional findings_Paediatric v0.2 COL11A2 Zornitza Stark Added phenotypes Otospondylomegaepiphyseal dysplasia for gene: COL11A2
Additional findings_Paediatric v0.2 COL11A1 Zornitza Stark Added phenotypes Stickler syndrome for gene: COL11A1
Additional findings_Paediatric v0.2 COCH Zornitza Stark Added phenotypes Deafness, non-syndromic, autosomal dominant for gene: COCH
Additional findings_Paediatric v0.2 CNGB3 Zornitza Stark Added phenotypes Achromatopsia-3 for gene: CNGB3
Additional findings_Paediatric v0.2 CLRN1 Zornitza Stark Added phenotypes Usher syndrome, type 3A for gene: CLRN1
Additional findings_Paediatric v0.2 CLN8 Zornitza Stark Added phenotypes Ceroid lipofuscinosis, neuronal, 8 for gene: CLN8
Additional findings_Paediatric v0.2 CLN6 Zornitza Stark Added phenotypes Ceroid lipofuscinosis, neuronal, 6 for gene: CLN6
Additional findings_Paediatric v0.2 CLN5 Zornitza Stark Added phenotypes Ceroid lipofuscinosis, neuronal, 5 for gene: CLN5
Additional findings_Paediatric v0.2 CLN3 Zornitza Stark Added phenotypes Ceroid lipofuscinosis, neuronal, 3 for gene: CLN3
Additional findings_Paediatric v0.2 CLDN19 Zornitza Stark Added phenotypes Hypomagnesemia 5, renal, with ocular involvement for gene: CLDN19
Additional findings_Paediatric v0.2 CLDN14 Zornitza Stark Added phenotypes Hearing loss, non-syndromic, autosomal recessive for gene: CLDN14
Additional findings_Paediatric v0.2 CLCN5 Zornitza Stark Added phenotypes Dent disease for gene: CLCN5
Additional findings_Paediatric v0.2 CHRNG Zornitza Stark Added phenotypes Pterygium syndrome for gene: CHRNG
Additional findings_Paediatric v0.2 CHRNE Zornitza Stark Added phenotypes Congenital myasthenic syndrome for gene: CHRNE
Additional findings_Paediatric v0.2 CHRND Zornitza Stark Added phenotypes Congenital myasthenic syndrome for gene: CHRND
Additional findings_Paediatric v0.2 CHRNA1 Zornitza Stark Added phenotypes Congenital myasthenic syndrome for gene: CHRNA1
Additional findings_Paediatric v0.2 CHM Zornitza Stark Added phenotypes Choroideremia for gene: CHM
Additional findings_Paediatric v0.2 CHKB Zornitza Stark Added phenotypes Muscular dystrophy, congenital, megaconial type for gene: CHKB
Additional findings_Paediatric v0.2 CHD7 Zornitza Stark Added phenotypes CHARGE syndrome for gene: CHD7
Additional findings_Paediatric v0.2 CHD2 Zornitza Stark Added phenotypes Developmental delay, intellectual disability, epilepsy for gene: CHD2
Additional findings_Paediatric v0.2 CHAT Zornitza Stark Added phenotypes Congenital myasthenic syndrome for gene: CHAT
Additional findings_Paediatric v0.2 CFTR Zornitza Stark Added phenotypes Cystic fibrosis for gene: CFTR
Additional findings_Paediatric v0.2 CFP Zornitza Stark Added phenotypes Properdin deficiency, X-linked for gene: CFP
Additional findings_Paediatric v0.2 CFL2 Zornitza Stark Added phenotypes Nemaline myopathy for gene: CFL2
Additional findings_Paediatric v0.2 CFC1 Zornitza Stark Added phenotypes Congenital heart defects for gene: CFC1
Additional findings_Paediatric v0.2 CEP290 Zornitza Stark Added phenotypes Joubert syndrome for gene: CEP290
Additional findings_Paediatric v0.2 CEP152 Zornitza Stark Added phenotypes Seckel syndrome for gene: CEP152
Additional findings_Paediatric v0.2 CDSN Zornitza Stark Added phenotypes Hypotrichosis for gene: CDSN
Additional findings_Paediatric v0.2 CDKN1C Zornitza Stark Added phenotypes Beckwith-Wiedemann syndrome for gene: CDKN1C
Additional findings_Paediatric v0.2 CDKL5 Zornitza Stark Added phenotypes Epileptic encephalopathy, early infantile, 2 for gene: CDKL5
Additional findings_Paediatric v0.2 CDH23 Zornitza Stark Added phenotypes Usher syndrome, type 1D for gene: CDH23
Additional findings_Paediatric v0.2 CDH23 Zornitza Stark Added phenotypes Deafness, autosomal recessive for gene: CDH23
Additional findings_Paediatric v0.2 CDAN1 Zornitza Stark Added phenotypes Anemia, congenital dyserythropoietic, type I for gene: CDAN1
Additional findings_Paediatric v0.2 CD40LG Zornitza Stark Added phenotypes Immunodeficiency, X-linked, with hyper-IgM for gene: CD40LG
Additional findings_Paediatric v0.2 CCDC40 Zornitza Stark Added phenotypes Primary ciliary dyskinesia for gene: CCDC40
Additional findings_Paediatric v0.2 CCDC39 Zornitza Stark Added phenotypes Primary ciliary dyskinesia for gene: CCDC39
Additional findings_Paediatric v0.2 CC2D2A Zornitza Stark Added phenotypes Joubert syndrome for gene: CC2D2A
Additional findings_Paediatric v0.2 CBS Zornitza Stark Added phenotypes Homocystinuria, B6-responsive and nonresponsive types for gene: CBS
Additional findings_Paediatric v0.2 CBL Zornitza Stark Added phenotypes Noonan syndrome-like disorder with or without juvenile meylomonocytic leukemia for gene: CBL
Additional findings_Paediatric v0.2 CAV3 Zornitza Stark Added phenotypes Caveolinopathy for gene: CAV3
Additional findings_Paediatric v0.2 CAV3 Zornitza Stark Added phenotypes Muscular dystrophy, limb-girdle, type IC, for gene: CAV3
Additional findings_Paediatric v0.2 CASQ2 Zornitza Stark Added phenotypes Ventricular tachycardia, catecholaminergic polymorphic for gene: CASQ2
Additional findings_Paediatric v0.2 CASK Zornitza Stark Added phenotypes Mental retardation and microcephaly with pontine and cerebellar hypoplasia for gene: CASK
Additional findings_Paediatric v0.2 CAPN3 Zornitza Stark Added phenotypes Muscular dystrophy, limb-girdle, type 2A for gene: CAPN3
Additional findings_Paediatric v0.2 CACNA1F Zornitza Stark Added phenotypes Night blindness, congenital stationary (complete), 1A, X-linked for gene: CACNA1F
Additional findings_Paediatric v0.2 CACNA1A Zornitza Stark Added phenotypes Episodic ataxia, type 2 for gene: CACNA1A
Additional findings_Paediatric v0.2 CA2 Zornitza Stark Added phenotypes Osteopetrosis, autosomal recessive 3, with renal tubular acidosis for gene: CA2
Additional findings_Paediatric v0.2 TWNK Zornitza Stark Added phenotypes Spinocerebellar ataxia infantile-onset for gene: TWNK
Additional findings_Paediatric v0.2 BTK Zornitza Stark Added phenotypes Agammaglobulinemia, X-linked 1 for gene: BTK
Additional findings_Paediatric v0.2 BTD Zornitza Stark Added phenotypes Biotinidase deficiency for gene: BTD
Additional findings_Paediatric v0.2 BSND Zornitza Stark Added phenotypes Bartter syndrome with sensorineural deafness for gene: BSND
Additional findings_Paediatric v0.2 BSCL2 Zornitza Stark Added phenotypes Berardinelli-Seip lipodystrophy for gene: BSCL2
Additional findings_Paediatric v0.2 BRCA2 Zornitza Stark Added phenotypes Fanconi anemia, complementation group D1 for gene: BRCA2
Additional findings_Paediatric v0.2 BRAF Zornitza Stark Added phenotypes Cardiofaciocutaneous syndrome for gene: BRAF
Additional findings_Paediatric v0.2 BMPR1A Zornitza Stark Added phenotypes Juvenile polyposis syndrome for gene: BMPR1A
Additional findings_Paediatric v0.2 BLM Zornitza Stark Added phenotypes Bloom syndrome for gene: BLM
Additional findings_Paediatric v0.2 BIN1 Zornitza Stark Added phenotypes Myopathy, centronuclear, autosomal recessive for gene: BIN1
Additional findings_Paediatric v0.2 BICD2 Zornitza Stark Added phenotypes Congenital spinal muscular atrophy for gene: BICD2
Additional findings_Paediatric v0.2 BCS1L Zornitza Stark Added phenotypes Complex 3 deficiency for gene: BCS1L
Additional findings_Paediatric v0.2 BCKDHB Zornitza Stark Added phenotypes Maple syrup urine disease for gene: BCKDHB
Additional findings_Paediatric v0.2 BCKDHA Zornitza Stark Added phenotypes Maple syrup urine disease for gene: BCKDHA
Additional findings_Paediatric v0.2 BBS9 Zornitza Stark Added phenotypes Bardet-Biedl syndrome for gene: BBS9
Additional findings_Paediatric v0.2 BBS7 Zornitza Stark Added phenotypes Bardet-Biedl syndrome for gene: BBS7
Additional findings_Paediatric v0.2 BBS5 Zornitza Stark Added phenotypes Bardet-Biedl syndrome for gene: BBS5
Additional findings_Paediatric v0.2 BBS4 Zornitza Stark Added phenotypes Bardet-Biedl syndrome for gene: BBS4
Additional findings_Paediatric v0.2 BBS2 Zornitza Stark Added phenotypes Bardet-Biedl syndrome for gene: BBS2
Additional findings_Paediatric v0.2 BBS12 Zornitza Stark Added phenotypes Bardet-Biedl syndrome for gene: BBS12
Additional findings_Paediatric v0.2 BBS10 Zornitza Stark Added phenotypes Bardet-Biedl syndrome for gene: BBS10
Additional findings_Paediatric v0.2 BBS1 Zornitza Stark Added phenotypes Bardet-Biedl syndrome for gene: BBS1
Additional findings_Paediatric v0.2 BAAT Zornitza Stark Added phenotypes Bile acid amidation defect for gene: BAAT
Additional findings_Paediatric v0.2 B3GLCT Zornitza Stark Added phenotypes Peters-Plus syndrome for gene: B3GLCT
Additional findings_Paediatric v0.2 AVPR2 Zornitza Stark Added phenotypes Diabetes insipidus, nephrogenic for gene: AVPR2
Additional findings_Paediatric v0.2 AUH Zornitza Stark Added phenotypes 3-methylglutaconic aciduria, type I for gene: AUH
Additional findings_Paediatric v0.2 ATRX Zornitza Stark Added phenotypes Alpha-thalassemia/mental retardation syndrome for gene: ATRX
Additional findings_Paediatric v0.2 ATP8B1 Zornitza Stark Added phenotypes Cholestasis, progressive familial intrahepatic 1 for gene: ATP8B1
Additional findings_Paediatric v0.2 ATP7B Zornitza Stark Added phenotypes Wilson disease for gene: ATP7B
Additional findings_Paediatric v0.2 ATP7A Zornitza Stark Added phenotypes Occipital horn syndrome for gene: ATP7A
Additional findings_Paediatric v0.2 ATP7A Zornitza Stark Added phenotypes Menkes syndrome for gene: ATP7A
Additional findings_Paediatric v0.2 ATP6V1B1 Zornitza Stark Added phenotypes Renal tubular acidosis & hearing loss for gene: ATP6V1B1
Additional findings_Paediatric v0.2 ATP6V0A2 Zornitza Stark Added phenotypes Cutis laxa, autosomal recessive, type IIA for gene: ATP6V0A2
Additional findings_Paediatric v0.2 ATP2A1 Zornitza Stark Added phenotypes Brody myopathy for gene: ATP2A1
Additional findings_Paediatric v0.2 ATP1A2 Zornitza Stark Added phenotypes Hemiplegic migraine for gene: ATP1A2
Additional findings_Paediatric v0.2 ATM Zornitza Stark Added phenotypes Ataxia-telangiectasia for gene: ATM
Additional findings_Paediatric v0.2 ASS1 Zornitza Stark Added phenotypes Citrullinemia for gene: ASS1
Additional findings_Paediatric v0.2 ASPA Zornitza Stark Added phenotypes Canavan disease for gene: ASPA
Additional findings_Paediatric v0.2 ASL Zornitza Stark Added phenotypes Argininosuccinic aciduria for gene: ASL
Additional findings_Paediatric v0.2 ARX Zornitza Stark Added phenotypes Lissencephaly, X-linked 2 for gene: ARX
Additional findings_Paediatric v0.2 ARSB Zornitza Stark Added phenotypes Mucopolysaccharidosis type VI (Maroteaux-Lamy) for gene: ARSB
Additional findings_Paediatric v0.2 ARSA Zornitza Stark Added phenotypes Metachromatic leukodystrophy for gene: ARSA
Additional findings_Paediatric v0.2 ARMC4 Zornitza Stark Added phenotypes Primary ciliary dyskinesia for gene: ARMC4
Additional findings_Paediatric v0.2 ARID1B Zornitza Stark Added phenotypes Coffin-Siris syndrome for gene: ARID1B
Additional findings_Paediatric v0.2 ARG1 Zornitza Stark Added phenotypes Arginase deficiency for gene: ARG1
Additional findings_Paediatric v0.2 ARFGEF2 Zornitza Stark Added phenotypes Periventricular heterotopia with microcephaly for gene: ARFGEF2
Additional findings_Paediatric v0.2 AR Zornitza Stark Added phenotypes Androgen insensitivity for gene: AR
Additional findings_Paediatric v0.2 APTX Zornitza Stark Added phenotypes Ataxia, early-onset, with oculomotor apraxia and hypoalbuminemia for gene: APTX
Additional findings_Paediatric v0.2 APOB Zornitza Stark Added phenotypes Apolipoprotein B deficiency for gene: APOB
Additional findings_Paediatric v0.2 APC Zornitza Stark Added phenotypes Adenomatous polyposis coli, attenuated for gene: APC
Additional findings_Paediatric v0.2 APC Zornitza Stark Added phenotypes Adenomatous polyposis coli for gene: APC
Additional findings_Paediatric v0.2 AP3B1 Zornitza Stark Added phenotypes Hermansky-Pudlak syndrome 2 for gene: AP3B1
Additional findings_Paediatric v0.2 ANTXR2 Zornitza Stark Added phenotypes Hyaline fibromatosis syndrome for gene: ANTXR2
Additional findings_Paediatric v0.2 ANO5 Zornitza Stark Added phenotypes Muscular dystrophy, limb-girdle, type 2L for gene: ANO5
Additional findings_Paediatric v0.2 ANO10 Zornitza Stark Added phenotypes Spinocerebellar ataxia, autosomal recessive 10 for gene: ANO10
Additional findings_Paediatric v0.2 ANKRD26 Zornitza Stark Added phenotypes Thrombocytopenia 2 for gene: ANKRD26
Additional findings_Paediatric v0.2 ANKH Zornitza Stark Added phenotypes Craniometaphyseal dysplasia for gene: ANKH
Additional findings_Paediatric v0.2 ANK1 Zornitza Stark Added phenotypes Spherocytosis for gene: ANK1
Additional findings_Paediatric v0.2 AMT Zornitza Stark Added phenotypes Hyperglycinaemia, non-ketotic for gene: AMT
Additional findings_Paediatric v0.2 AMN Zornitza Stark Added phenotypes Megaloblastic anemia-1, Norwegian type for gene: AMN
Additional findings_Paediatric v0.2 AMELX Zornitza Stark Added phenotypes Amelogenesis imperfecta for gene: AMELX
Additional findings_Paediatric v0.2 ALX4 Zornitza Stark Added phenotypes Parietal foramina 2 for gene: ALX4
Additional findings_Paediatric v0.2 ALS2 Zornitza Stark Added phenotypes Amyotrophic lateral sclerosis for gene: ALS2
Additional findings_Paediatric v0.2 ALPL Zornitza Stark Added phenotypes Hypophosphatasia for gene: ALPL
Additional findings_Paediatric v0.2 ALOXE3 Zornitza Stark Added phenotypes Ichthyosis, congenital, autosomal recessive for gene: ALOXE3
Additional findings_Paediatric v0.2 ALOX12B Zornitza Stark Added phenotypes Ichthyosis, congenital, autosomal recessive for gene: ALOX12B
Additional findings_Paediatric v0.2 ALMS1 Zornitza Stark Added phenotypes Alstrom syndrome for gene: ALMS1
Additional findings_Paediatric v0.2 ALG8 Zornitza Stark Added phenotypes Congenital disorder of glycosylation, type Ih for gene: ALG8
Additional findings_Paediatric v0.2 ALG6 Zornitza Stark Added phenotypes Congenital disorder of glycosylation, type Ic for gene: ALG6
Additional findings_Paediatric v0.2 ALG3 Zornitza Stark Added phenotypes Congenital disorder of glycosylation, type Id for gene: ALG3
Additional findings_Paediatric v0.2 ALG12 Zornitza Stark Added phenotypes Congenital disorder of glycosylation, type Ig for gene: ALG12
Additional findings_Paediatric v0.2 ALG1 Zornitza Stark Added phenotypes Congenital disorder of glycosylation, type Ik for gene: ALG1
Additional findings_Paediatric v0.2 ALDOB Zornitza Stark Added phenotypes Fructose intolerance for gene: ALDOB
Additional findings_Paediatric v0.2 ALDH5A1 Zornitza Stark Added phenotypes Succinic semialdehyde dehydrogenase deficiency for gene: ALDH5A1
Additional findings_Paediatric v0.2 ALDH3A2 Zornitza Stark Added phenotypes Sjogren-Larsson syndrome for gene: ALDH3A2
Additional findings_Paediatric v0.2 ALDH18A1 Zornitza Stark Added phenotypes Cutis laxa, autosomal recessive, type IIIA for gene: ALDH18A1
Additional findings_Paediatric v0.2 ALB Zornitza Stark Added phenotypes Analbuminemia for gene: ALB
Additional findings_Paediatric v0.2 ALAS2 Zornitza Stark Added phenotypes Anemia, sideroblastic, X-linked for gene: ALAS2
Additional findings_Paediatric v0.2 AKR1D1 Zornitza Stark Added phenotypes Bile acid synthesis defect, congenital, 2 for gene: AKR1D1
Additional findings_Paediatric v0.2 AIRE Zornitza Stark Added phenotypes Autoimmune polyendocrinopathy syndrome , type I, with or without reversible metaphyseal dysplasia for gene: AIRE
Additional findings_Paediatric v0.2 AIFM1 Zornitza Stark Added phenotypes Cowchock syndrome for gene: AIFM1
Additional findings_Paediatric v0.2 AHI1 Zornitza Stark Added phenotypes Joubert syndrome-3 for gene: AHI1
Additional findings_Paediatric v0.2 AGXT Zornitza Stark Added phenotypes Hyperoxaluria, primary, type 1 for gene: AGXT
Additional findings_Paediatric v0.2 AGRN Zornitza Stark Added phenotypes Myasthenia, limb-girdle, familial for gene: AGRN
Additional findings_Paediatric v0.2 AGL Zornitza Stark Added phenotypes Glycogen storage disease IIIa for gene: AGL
Additional findings_Paediatric v0.2 AGA Zornitza Stark Added phenotypes Aspartylglucosaminuria for gene: AGA
Additional findings_Paediatric v0.2 ADK Zornitza Stark Added phenotypes Hypermethioninemia due to adenosine kinase deficiency for gene: ADK
Additional findings_Paediatric v0.2 ADAR Zornitza Stark Mode of inheritance for gene ADAR was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Dyschromatosis symmetrica hereditaria for gene: ADAR
Additional findings_Paediatric v0.2 ADAR Zornitza Stark Mode of inheritance for gene ADAR was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to BIALLELIC, autosomal or pseudoautosomal
Added phenotypes Aicardi-Goutieres syndrome for gene: ADAR
Additional findings_Paediatric v0.2 ADAMTSL2 Zornitza Stark Added phenotypes Geleophysic dysplasia 1 for gene: ADAMTSL2
Additional findings_Paediatric v0.2 ADAMTS13 Zornitza Stark Added phenotypes Thrombotic thrombocytopenic purpura, familial for gene: ADAMTS13
Additional findings_Paediatric v0.2 ADA Zornitza Stark Added phenotypes Severe combined immunodeficiency due to ADA deficiency for gene: ADA
Additional findings_Paediatric v0.2 ACVRL1 Zornitza Stark Added phenotypes Telangiectasia, hereditary hemorrhagic, type 2 for gene: ACVRL1
Additional findings_Paediatric v0.2 ACVR1 Zornitza Stark Added phenotypes Fibrodysplasia ossificans progressiva for gene: ACVR1
Additional findings_Paediatric v0.2 ACTN4 Zornitza Stark Added phenotypes Glomerulosclerosis, focal segmental, 1 for gene: ACTN4
Additional findings_Paediatric v0.2 ACTN1 Zornitza Stark Added phenotypes Macrothrombocytopenia for gene: ACTN1
Additional findings_Paediatric v0.2 ACTG2 Zornitza Stark Added phenotypes Megacystis-microcolon-intestinal hypoperistalsis syndrome for gene: ACTG2
Additional findings_Paediatric v0.2 ACTG1 Zornitza Stark Added phenotypes Baraitser-Winter syndrome for gene: ACTG1
Additional findings_Paediatric v0.2 ACTG1 Zornitza Stark Added phenotypes Deafness, autosomal dominant for gene: ACTG1
Additional findings_Paediatric v0.2 ACTB Zornitza Stark Added phenotypes Baraitser-Winter syndrome for gene: ACTB
Additional findings_Paediatric v0.2 ACTA1 Zornitza Stark Added phenotypes Nemaline myopathy for gene: ACTA1
Additional findings_Paediatric v0.2 ACSF3 Zornitza Stark Added phenotypes Combined malonic and methylmalonic aciduria for gene: ACSF3
Additional findings_Paediatric v0.2 ACOX1 Zornitza Stark Added phenotypes Peroxisomal acyl-CoA oxidase deficiency for gene: ACOX1
Additional findings_Paediatric v0.2 ACE Zornitza Stark Added phenotypes Renal tubular dysgenesis for gene: ACE
Additional findings_Paediatric v0.2 ACAT1 Zornitza Stark Added phenotypes Alpha-methylacetoacetic aciduria for gene: ACAT1
Additional findings_Paediatric v0.2 ACADVL Zornitza Stark Added phenotypes VLCAD deficiency for gene: ACADVL
Additional findings_Paediatric v0.2 ACADM Zornitza Stark Added phenotypes Medium chain acyl CoA dehydrogenase deficiency for gene: ACADM
Additional findings_Paediatric v0.2 ACAD9 Zornitza Stark Added phenotypes ACAD9 deficiency for gene: ACAD9
Additional findings_Paediatric v0.2 ACAD8 Zornitza Stark Added phenotypes Isobutyryl-CoA dehydrogenase deficiency for gene: ACAD8
Additional findings_Paediatric v0.2 ABCG5 Zornitza Stark Added phenotypes Sitosterolemia for gene: ABCG5
Additional findings_Paediatric v0.2 ABCD1 Zornitza Stark Added phenotypes Adrenoleukodystrophy for gene: ABCD1
Additional findings_Paediatric v0.2 ABCC9 Zornitza Stark Added phenotypes Hypertrichotic osteochondrodysplasia for gene: ABCC9
Additional findings_Paediatric v0.2 ABCC8 Zornitza Stark Added phenotypes Hyperinsulinemic hypoglycemia, familial for gene: ABCC8
Additional findings_Paediatric v0.2 ABCC6 Zornitza Stark Added phenotypes Pseudoxanthoma elasticum for gene: ABCC6
Additional findings_Paediatric v0.2 ABCB4 Zornitza Stark Added phenotypes Cholestasis, progressive familial intrahepatic 3 for gene: ABCB4
Additional findings_Paediatric v0.2 ABCB11 Zornitza Stark Added phenotypes Cholestasis, progressive familial intrahepatic 2 for gene: ABCB11
Additional findings_Paediatric v0.2 ABCA4 Zornitza Stark Added phenotypes Stargardt disease for gene: ABCA4
Additional findings_Paediatric v0.2 ABCA3 Zornitza Stark Added phenotypes Surfactant metabolism dysfunction, pulmonary, 3 for gene: ABCA3
Additional findings_Paediatric v0.2 ABCA12 Zornitza Stark Added phenotypes Ichthyosis, congenital, autosomal recessive for gene: ABCA12
Additional findings_Paediatric v0.2 AARS Zornitza Stark Added phenotypes Charcot-Marie-Tooth disease for gene: AARS
Additional findings_Paediatric v0.2 AAAS Zornitza Stark Added phenotypes Achalasia-addisonianism-alacrimia syndrome for gene: AAAS
Periventricular Grey Matter Heterotopia v0.18 FAT4 Zornitza Stark Marked gene: FAT4 as ready
Periventricular Grey Matter Heterotopia v0.18 FAT4 Zornitza Stark Gene: fat4 has been classified as Amber List (Moderate Evidence).
Periventricular Grey Matter Heterotopia v0.18 FAT4 Zornitza Stark Phenotypes for gene: FAT4 were changed from to Van Maldergem syndrome 2, MIM# 615546
Periventricular Grey Matter Heterotopia v0.17 FAT4 Zornitza Stark Publications for gene: FAT4 were set to
Periventricular Grey Matter Heterotopia v0.16 FAT4 Zornitza Stark Mode of inheritance for gene: FAT4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Periventricular Grey Matter Heterotopia v0.15 FAT4 Zornitza Stark Classified gene: FAT4 as Amber List (moderate evidence)
Periventricular Grey Matter Heterotopia v0.15 FAT4 Zornitza Stark Gene: fat4 has been classified as Amber List (Moderate Evidence).
Periventricular Grey Matter Heterotopia v0.14 FAT4 Zornitza Stark reviewed gene: FAT4: Rating: AMBER; Mode of pathogenicity: None; Publications: 22473091, 24056717; Phenotypes: Van Maldergem syndrome 2, MIM# 615546; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Additional findings_Paediatric v0.0 PDZD7 Zornitza Stark gene: PDZD7 was added
gene: PDZD7 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: PDZD7 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: PDZD7 were set to Usher syndrome
Additional findings_Paediatric v0.0 ADGRG1 Zornitza Stark gene: ADGRG1 was added
gene: ADGRG1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ADGRG1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ADGRG1 were set to Polymicrogyria, bilateral frontoparietal
Additional findings_Paediatric v0.0 GPR143 Zornitza Stark gene: GPR143 was added
gene: GPR143 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GPR143 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: GPR143 were set to Ocular albinism, type I
Additional findings_Paediatric v0.0 GPC3 Zornitza Stark gene: GPC3 was added
gene: GPC3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GPC3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: GPC3 were set to Simpson-Golabi-Behmel syndrome
Additional findings_Paediatric v0.0 GNS Zornitza Stark gene: GNS was added
gene: GNS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GNS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GNS were set to Mucopolysaccharidosis IIId
Additional findings_Paediatric v0.0 GNPTG Zornitza Stark gene: GNPTG was added
gene: GNPTG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GNPTG was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GNPTG were set to Mucolipidosis III gamma
Additional findings_Paediatric v0.0 GNPTAB Zornitza Stark gene: GNPTAB was added
gene: GNPTAB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GNPTAB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GNPTAB were set to Mucolipidosis II
Additional findings_Paediatric v0.0 GNE Zornitza Stark gene: GNE was added
gene: GNE was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GNE was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GNE were set to Inclusion body myopathy
Additional findings_Paediatric v0.0 GNAS Zornitza Stark Added phenotypes Pseudopseudohypoparathyroidism for gene: GNAS
Additional findings_Paediatric v0.0 GNAS Zornitza Stark gene: GNAS was added
gene: GNAS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GNAS was set to Unknown
Phenotypes for gene: GNAS were set to Pseudohypoparathyroidism
Additional findings_Paediatric v0.0 GLUD1 Zornitza Stark gene: GLUD1 was added
gene: GLUD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GLUD1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GLUD1 were set to Hyperinsulinism
Additional findings_Paediatric v0.0 GLRA1 Zornitza Stark gene: GLRA1 was added
gene: GLRA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GLRA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GLRA1 were set to Hyperekplexia, hereditary 1, autosomal dominant or recessive
Additional findings_Paediatric v0.0 GLI3 Zornitza Stark gene: GLI3 was added
gene: GLI3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GLI3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GLI3 were set to Greig cephalopolysyndactyly syndrome
Additional findings_Paediatric v0.0 GLDC Zornitza Stark gene: GLDC was added
gene: GLDC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GLDC was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GLDC were set to Glycine encephalopathy
Additional findings_Paediatric v0.0 GLB1 Zornitza Stark gene: GLB1 was added
gene: GLB1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GLB1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GLB1 were set to Gangliosidosis GM1
Additional findings_Paediatric v0.0 GLA Zornitza Stark gene: GLA was added
gene: GLA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GLA was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: GLA were set to Fabry disease
Additional findings_Paediatric v0.0 GJC2 Zornitza Stark gene: GJC2 was added
gene: GJC2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GJC2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GJC2 were set to Pelizaeus-Merzbacher-like disease
Additional findings_Paediatric v0.0 GJB2 Zornitza Stark Mode of inheritance for gene GJB2 was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Deafness and palmoplantar keratoderma for gene: GJB2
Additional findings_Paediatric v0.0 GJB2 Zornitza Stark gene: GJB2 was added
gene: GJB2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GJB2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GJB2 were set to Deafness
Additional findings_Paediatric v0.0 GJB1 Zornitza Stark gene: GJB1 was added
gene: GJB1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GJB1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: GJB1 were set to Charcot-Marie-Tooth neuropathy
Additional findings_Paediatric v0.0 GJA1 Zornitza Stark gene: GJA1 was added
gene: GJA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GJA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GJA1 were set to Oculodentodigital dysplasia
Additional findings_Paediatric v0.0 GIPC3 Zornitza Stark gene: GIPC3 was added
gene: GIPC3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GIPC3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GIPC3 were set to Hearing loss
Additional findings_Paediatric v0.0 GFPT1 Zornitza Stark gene: GFPT1 was added
gene: GFPT1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GFPT1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GFPT1 were set to Congenital myasthenic syndrome, limb-girdle
Additional findings_Paediatric v0.0 GFM1 Zornitza Stark gene: GFM1 was added
gene: GFM1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GFM1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GFM1 were set to Combined oxidative phosphorylation deficiency 1
Additional findings_Paediatric v0.0 GFAP Zornitza Stark gene: GFAP was added
gene: GFAP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GFAP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GFAP were set to Alexander disease
Additional findings_Paediatric v0.0 GDAP1 Zornitza Stark gene: GDAP1 was added
gene: GDAP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GDAP1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GDAP1 were set to Charcot-Marie-Tooth disease
Additional findings_Paediatric v0.0 GCK Zornitza Stark gene: GCK was added
gene: GCK was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GCK was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GCK were set to Hyperinsulinemic hypoglycemia, familial
Additional findings_Paediatric v0.0 GCDH Zornitza Stark gene: GCDH was added
gene: GCDH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GCDH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GCDH were set to Glutaricaciduria, type I
Additional findings_Paediatric v0.0 GBE1 Zornitza Stark gene: GBE1 was added
gene: GBE1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GBE1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GBE1 were set to Glycogen storage disease IV
Additional findings_Paediatric v0.0 GBA Zornitza Stark gene: GBA was added
gene: GBA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GBA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GBA were set to Gaucher disease 1
Additional findings_Paediatric v0.0 GATA4 Zornitza Stark gene: GATA4 was added
gene: GATA4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GATA4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: GATA4 were set to Congenital heart defects
Additional findings_Paediatric v0.0 GATA1 Zornitza Stark gene: GATA1 was added
gene: GATA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GATA1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: GATA1 were set to Dyserythropoietic anemia with thrombocytopenia
Additional findings_Paediatric v0.0 GAN Zornitza Stark gene: GAN was added
gene: GAN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GAN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GAN were set to Giant axonal neuropathy
Additional findings_Paediatric v0.0 GALT Zornitza Stark gene: GALT was added
gene: GALT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GALT was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GALT were set to Galactosaemia
Additional findings_Paediatric v0.0 GALNS Zornitza Stark gene: GALNS was added
gene: GALNS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GALNS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GALNS were set to Mucopolysaccharidosis IVA
Additional findings_Paediatric v0.0 GALK1 Zornitza Stark gene: GALK1 was added
gene: GALK1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GALK1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GALK1 were set to Galactokinase deficiency with cataracts
Additional findings_Paediatric v0.0 GALC Zornitza Stark gene: GALC was added
gene: GALC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GALC was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GALC were set to Krabbe disease
Additional findings_Paediatric v0.0 GAA Zornitza Stark gene: GAA was added
gene: GAA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: GAA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: GAA were set to Glycogen storage disease II
Additional findings_Paediatric v0.0 G6PD Zornitza Stark gene: G6PD was added
gene: G6PD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: G6PD was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: G6PD were set to Glucose-6-phosphate dehydrogenase deficiency
Additional findings_Paediatric v0.0 G6PC3 Zornitza Stark gene: G6PC3 was added
gene: G6PC3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: G6PC3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: G6PC3 were set to Neutropaenia, congenital
Additional findings_Paediatric v0.0 G6PC Zornitza Stark gene: G6PC was added
gene: G6PC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: G6PC was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: G6PC were set to Glycogen storage disease Ia
Additional findings_Paediatric v0.0 FXN Zornitza Stark gene: FXN was added
gene: FXN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FXN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FXN were set to Friedreich ataxia
Additional findings_Paediatric v0.0 FUCA1 Zornitza Stark gene: FUCA1 was added
gene: FUCA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FUCA1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FUCA1 were set to Fucosidosis
Additional findings_Paediatric v0.0 FTL Zornitza Stark gene: FTL was added
gene: FTL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FTL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: FTL were set to Neuroferritinopathy
Additional findings_Paediatric v0.0 FRAS1 Zornitza Stark gene: FRAS1 was added
gene: FRAS1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FRAS1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FRAS1 were set to Fraser syndrome
Additional findings_Paediatric v0.0 FOXP3 Zornitza Stark gene: FOXP3 was added
gene: FOXP3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FOXP3 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: FOXP3 were set to IPEX syndrome
Additional findings_Paediatric v0.0 FOXF1 Zornitza Stark gene: FOXF1 was added
gene: FOXF1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FOXF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: FOXF1 were set to Alveolar capillary dysplasia with misalignment of pulmonary veins
Additional findings_Paediatric v0.0 FOXC2 Zornitza Stark gene: FOXC2 was added
gene: FOXC2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FOXC2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: FOXC2 were set to Lymphoedema, primary
Additional findings_Paediatric v0.0 FOXC1 Zornitza Stark gene: FOXC1 was added
gene: FOXC1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FOXC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: FOXC1 were set to Axenfeld-Rieger syndrome
Additional findings_Paediatric v0.0 FLNA Zornitza Stark gene: FLNA was added
gene: FLNA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FLNA was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: FLNA were set to Otopalatodigital spectrum disorder
Additional findings_Paediatric v0.0 FLCN Zornitza Stark gene: FLCN was added
gene: FLCN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FLCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: FLCN were set to Birt-Hogg-Dube syndrome
Additional findings_Paediatric v0.0 FKTN Zornitza Stark Added phenotypes Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies for gene: FKTN
Additional findings_Paediatric v0.0 FKTN Zornitza Stark gene: FKTN was added
gene: FKTN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FKTN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FKTN were set to Muscular dystrophy, Fukuyama
Additional findings_Paediatric v0.0 FKRP Zornitza Stark Added phenotypes Muscle-eye-brain disease for gene: FKRP
Additional findings_Paediatric v0.0 FKRP Zornitza Stark gene: FKRP was added
gene: FKRP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FKRP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FKRP were set to Muscular dystrophy, limb girdle 2I
Additional findings_Paediatric v0.0 FHL1 Zornitza Stark gene: FHL1 was added
gene: FHL1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FHL1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: FHL1 were set to Emery-Dreifuss muscular dystrophy
Additional findings_Paediatric v0.0 FH Zornitza Stark gene: FH was added
gene: FH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FH were set to Fumarase deficiency
Additional findings_Paediatric v0.0 FGG Zornitza Stark gene: FGG was added
gene: FGG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FGG was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FGG were set to Afibrinogenaemia
Additional findings_Paediatric v0.0 FGFR3 Zornitza Stark Added phenotypes Muenke syndrome for gene: FGFR3
Additional findings_Paediatric v0.0 FGFR3 Zornitza Stark Added phenotypes Thanatophoric dysplasia type 1 for gene: FGFR3
Additional findings_Paediatric v0.0 FGFR3 Zornitza Stark Added phenotypes Crouzon syndrome with acanthosis nigricans for gene: FGFR3
Additional findings_Paediatric v0.0 FGFR3 Zornitza Stark Added phenotypes Hypochondroplasia for gene: FGFR3
Additional findings_Paediatric v0.0 FGFR3 Zornitza Stark gene: FGFR3 was added
gene: FGFR3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FGFR3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: FGFR3 were set to Achondroplasia
Additional findings_Paediatric v0.0 FGFR2 Zornitza Stark Added phenotypes Jackson-Weiss syndrome for gene: FGFR2
Additional findings_Paediatric v0.0 FGFR2 Zornitza Stark Added phenotypes Beare-Stevenson cutis gyrata syndrome for gene: FGFR2
Additional findings_Paediatric v0.0 FGFR2 Zornitza Stark Added phenotypes Crouzon syndrome for gene: FGFR2
Additional findings_Paediatric v0.0 FGFR2 Zornitza Stark Added phenotypes Apert syndrome for gene: FGFR2
Additional findings_Paediatric v0.0 FGFR2 Zornitza Stark gene: FGFR2 was added
gene: FGFR2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FGFR2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: FGFR2 were set to Pfeiffer syndrome
Additional findings_Paediatric v0.0 FGFR1 Zornitza Stark gene: FGFR1 was added
gene: FGFR1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FGFR1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: FGFR1 were set to Kallmann syndrome
Additional findings_Paediatric v0.0 FGF3 Zornitza Stark gene: FGF3 was added
gene: FGF3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FGF3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FGF3 were set to Deafness, congenital with inner ear agenesis, microtia, and microdontia
Additional findings_Paediatric v0.0 FGD4 Zornitza Stark gene: FGD4 was added
gene: FGD4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FGD4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FGD4 were set to Charcot-Marie-Tooth disease
Additional findings_Paediatric v0.0 FGD1 Zornitza Stark gene: FGD1 was added
gene: FGD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FGD1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: FGD1 were set to Aarskog-Scott syndrome
Additional findings_Paediatric v0.0 FGB Zornitza Stark gene: FGB was added
gene: FGB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FGB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FGB were set to Afibrinogenaemia
Additional findings_Paediatric v0.0 FGA Zornitza Stark gene: FGA was added
gene: FGA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FGA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FGA were set to Afibrinogenaemia
Additional findings_Paediatric v0.0 FBN2 Zornitza Stark gene: FBN2 was added
gene: FBN2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FBN2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: FBN2 were set to Contractural arachnodactyly
Additional findings_Paediatric v0.0 FBN1 Zornitza Stark gene: FBN1 was added
gene: FBN1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FBN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: FBN1 were set to Marfan's syndrome
Additional findings_Paediatric v0.0 FBLN5 Zornitza Stark gene: FBLN5 was added
gene: FBLN5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FBLN5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FBLN5 were set to Cutis laxa
Additional findings_Paediatric v0.0 FANCI Zornitza Stark gene: FANCI was added
gene: FANCI was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FANCI was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FANCI were set to Fanconi anaemia
Additional findings_Paediatric v0.0 FANCG Zornitza Stark gene: FANCG was added
gene: FANCG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FANCG was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FANCG were set to Fanconi anaemia
Additional findings_Paediatric v0.0 FANCD2 Zornitza Stark gene: FANCD2 was added
gene: FANCD2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FANCD2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FANCD2 were set to Fanconi anaemia
Additional findings_Paediatric v0.0 FANCC Zornitza Stark gene: FANCC was added
gene: FANCC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FANCC was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FANCC were set to Fanconi anaemia
Additional findings_Paediatric v0.0 FANCB Zornitza Stark gene: FANCB was added
gene: FANCB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FANCB was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: FANCB were set to Fanconi anaemia
Additional findings_Paediatric v0.0 FANCA Zornitza Stark gene: FANCA was added
gene: FANCA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FANCA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FANCA were set to Fanconi anaemia
Additional findings_Paediatric v0.0 FAM58A Zornitza Stark gene: FAM58A was added
gene: FAM58A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FAM58A was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: FAM58A were set to Syndactyly - telecanthus - anogenital and renal malformations
Additional findings_Paediatric v0.0 FAM20C Zornitza Stark gene: FAM20C was added
gene: FAM20C was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FAM20C was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FAM20C were set to Osteosclerotic bone dysplasia
Additional findings_Paediatric v0.0 FAM161A Zornitza Stark gene: FAM161A was added
gene: FAM161A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FAM161A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FAM161A were set to Retinal dystrophy
Additional findings_Paediatric v0.0 FAM126A Zornitza Stark gene: FAM126A was added
gene: FAM126A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FAM126A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FAM126A were set to Hypomyelination and congenital cataract
Additional findings_Paediatric v0.0 FAH Zornitza Stark gene: FAH was added
gene: FAH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: FAH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: FAH were set to Tyrosinemia, type I
Additional findings_Paediatric v0.0 F9 Zornitza Stark gene: F9 was added
gene: F9 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: F9 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: F9 were set to Hemophilia B
Additional findings_Paediatric v0.0 F8 Zornitza Stark gene: F8 was added
gene: F8 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: F8 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: F8 were set to Hemophilia A
Additional findings_Paediatric v0.0 F2 Zornitza Stark gene: F2 was added
gene: F2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: F2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: F2 were set to Prothrombin deficiency
Additional findings_Paediatric v0.0 F11 Zornitza Stark gene: F11 was added
gene: F11 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: F11 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: F11 were set to Factor XI deficiency
Additional findings_Paediatric v0.0 EZH2 Zornitza Stark gene: EZH2 was added
gene: EZH2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: EZH2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: EZH2 were set to Weaver syndrome 2
Additional findings_Paediatric v0.0 EYA4 Zornitza Stark gene: EYA4 was added
gene: EYA4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: EYA4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: EYA4 were set to Deafness, autosomal dominant
Additional findings_Paediatric v0.0 EYA1 Zornitza Stark gene: EYA1 was added
gene: EYA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: EYA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: EYA1 were set to Branchiootorenal syndrome
Additional findings_Paediatric v0.0 EXT2 Zornitza Stark gene: EXT2 was added
gene: EXT2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: EXT2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: EXT2 were set to Exostoses, multiple, type 2
Additional findings_Paediatric v0.0 EXT1 Zornitza Stark gene: EXT1 was added
gene: EXT1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: EXT1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: EXT1 were set to Exostoses, multiple, type 1
Additional findings_Paediatric v0.0 EVC2 Zornitza Stark gene: EVC2 was added
gene: EVC2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: EVC2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: EVC2 were set to Ellis-van Creveld syndrome
Additional findings_Paediatric v0.0 EVC Zornitza Stark gene: EVC was added
gene: EVC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: EVC was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: EVC were set to Ellis-van Creveld syndrome
Additional findings_Paediatric v0.0 ETHE1 Zornitza Stark gene: ETHE1 was added
gene: ETHE1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ETHE1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ETHE1 were set to Ethylmalonic encephalopathy
Additional findings_Paediatric v0.0 ETFDH Zornitza Stark gene: ETFDH was added
gene: ETFDH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ETFDH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ETFDH were set to Glutaric acidemia IIC
Additional findings_Paediatric v0.0 ETFB Zornitza Stark gene: ETFB was added
gene: ETFB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ETFB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ETFB were set to Glutaric acidemia IIB
Additional findings_Paediatric v0.0 ETFA Zornitza Stark gene: ETFA was added
gene: ETFA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ETFA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ETFA were set to Glutaric acidemia IIA
Additional findings_Paediatric v0.0 ESRRB Zornitza Stark gene: ESRRB was added
gene: ESRRB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ESRRB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ESRRB were set to Hearing loss
Additional findings_Paediatric v0.0 ESCO2 Zornitza Stark gene: ESCO2 was added
gene: ESCO2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ESCO2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ESCO2 were set to Roberts syndrome
Additional findings_Paediatric v0.0 ERCC8 Zornitza Stark gene: ERCC8 was added
gene: ERCC8 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ERCC8 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ERCC8 were set to Cockayne syndrome
Additional findings_Paediatric v0.0 ERCC6 Zornitza Stark gene: ERCC6 was added
gene: ERCC6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ERCC6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ERCC6 were set to Cockayne syndrome
Additional findings_Paediatric v0.0 ERCC5 Zornitza Stark gene: ERCC5 was added
gene: ERCC5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ERCC5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ERCC5 were set to Xeroderma pigmentosum
Additional findings_Paediatric v0.0 ERCC2 Zornitza Stark gene: ERCC2 was added
gene: ERCC2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ERCC2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ERCC2 were set to Xeroderma pigmentosum
Additional findings_Paediatric v0.0 EPM2A Zornitza Stark gene: EPM2A was added
gene: EPM2A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: EPM2A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: EPM2A were set to Epilepsy, progressive myoclonic 2A (Lafora)
Additional findings_Paediatric v0.0 ENPP1 Zornitza Stark gene: ENPP1 was added
gene: ENPP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ENPP1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ENPP1 were set to Arterial calcification, generalized, of infancy, 1
Additional findings_Paediatric v0.0 ENG Zornitza Stark gene: ENG was added
gene: ENG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ENG was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ENG were set to Telangiectasia, hereditary hemorrhagic, type 1
Additional findings_Paediatric v0.0 EMD Zornitza Stark gene: EMD was added
gene: EMD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: EMD was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: EMD were set to Muscular dystrophy, Emery-Dreifuss
Additional findings_Paediatric v0.0 ELN Zornitza Stark gene: ELN was added
gene: ELN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ELN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ELN were set to Supravalvar aortic stenosis
Additional findings_Paediatric v0.0 ELANE Zornitza Stark gene: ELANE was added
gene: ELANE was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ELANE was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ELANE were set to Neutropenia, congenital
Additional findings_Paediatric v0.0 EIF2AK3 Zornitza Stark gene: EIF2AK3 was added
gene: EIF2AK3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: EIF2AK3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: EIF2AK3 were set to Wolcott-Rallison syndrome
Additional findings_Paediatric v0.0 EGR2 Zornitza Stark gene: EGR2 was added
gene: EGR2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: EGR2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: EGR2 were set to Charcot-Marie-Tooth disease
Additional findings_Paediatric v0.0 EFTUD2 Zornitza Stark gene: EFTUD2 was added
gene: EFTUD2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: EFTUD2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: EFTUD2 were set to Mandibulofacial dysostosis with microcephaly
Additional findings_Paediatric v0.0 EFHC1 Zornitza Stark gene: EFHC1 was added
gene: EFHC1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: EFHC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: EFHC1 were set to Myoclonic epilepsy
Additional findings_Paediatric v0.0 EDARADD Zornitza Stark gene: EDARADD was added
gene: EDARADD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: EDARADD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: EDARADD were set to Ectodermal dysplasia, hypohidrotic
Additional findings_Paediatric v0.0 EDAR Zornitza Stark gene: EDAR was added
gene: EDAR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: EDAR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: EDAR were set to Ectodermal dysplasia, hypohidrotic
Additional findings_Paediatric v0.0 EDA Zornitza Stark gene: EDA was added
gene: EDA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: EDA was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: EDA were set to Ectodermal dysplasia, hypohidrotic
Additional findings_Paediatric v0.0 DYSF Zornitza Stark Added phenotypes Miyoshi muscular dystrophy 1 for gene: DYSF
Additional findings_Paediatric v0.0 DYSF Zornitza Stark gene: DYSF was added
gene: DYSF was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: DYSF was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DYSF were set to Muscular dystrophy, limb-girdle, type 2B
Additional findings_Paediatric v0.0 DUOX2 Zornitza Stark gene: DUOX2 was added
gene: DUOX2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: DUOX2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DUOX2 were set to Thyroid dyshormonogenesis
Additional findings_Paediatric v0.0 DSP Zornitza Stark gene: DSP was added
gene: DSP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: DSP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DSP were set to Epidermolysis bullosa, lethal acantholytic
Additional findings_Paediatric v0.0 DPAGT1 Zornitza Stark gene: DPAGT1 was added
gene: DPAGT1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: DPAGT1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DPAGT1 were set to Congenital disorder of glycosylation, type Ij
Additional findings_Paediatric v0.0 DOK7 Zornitza Stark gene: DOK7 was added
gene: DOK7 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: DOK7 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DOK7 were set to Congenital myasthenic syndrome
Additional findings_Paediatric v0.0 DOCK8 Zornitza Stark gene: DOCK8 was added
gene: DOCK8 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: DOCK8 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DOCK8 were set to Hyper-IgE syndrome
Additional findings_Paediatric v0.0 DNMT3B Zornitza Stark gene: DNMT3B was added
gene: DNMT3B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: DNMT3B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DNMT3B were set to Immunodeficiency-centromeric instability-facial anomalies syndrome 1
Additional findings_Paediatric v0.0 DNM2 Zornitza Stark Added phenotypes Charcot-Marie-Tooth disease, axonal, type 2M for gene: DNM2
Additional findings_Paediatric v0.0 DNM2 Zornitza Stark gene: DNM2 was added
gene: DNM2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: DNM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DNM2 were set to Myopathy, centronuclear
Additional findings_Paediatric v0.0 DNAJB6 Zornitza Stark gene: DNAJB6 was added
gene: DNAJB6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: DNAJB6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DNAJB6 were set to Muscular dystrophy, limb girdle
Additional findings_Paediatric v0.0 DNAI1 Zornitza Stark gene: DNAI1 was added
gene: DNAI1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: DNAI1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DNAI1 were set to Primary ciliary dyskinesia
Additional findings_Paediatric v0.0 DNAH5 Zornitza Stark gene: DNAH5 was added
gene: DNAH5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: DNAH5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DNAH5 were set to Primary ciliary dyskinesia
Additional findings_Paediatric v0.0 DNAH11 Zornitza Stark gene: DNAH11 was added
gene: DNAH11 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: DNAH11 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DNAH11 were set to Primary ciliary dyskinesia
Additional findings_Paediatric v0.0 DNAAF1 Zornitza Stark gene: DNAAF1 was added
gene: DNAAF1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: DNAAF1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DNAAF1 were set to Primary ciliary dyskinesia
Additional findings_Paediatric v0.0 DMPK Zornitza Stark gene: DMPK was added
gene: DMPK was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: DMPK was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DMPK were set to Myotonic dystrophy 1
Additional findings_Paediatric v0.0 DMP1 Zornitza Stark gene: DMP1 was added
gene: DMP1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: DMP1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DMP1 were set to Hypophosphatemic rickets, AR
Additional findings_Paediatric v0.0 DMD Zornitza Stark Added phenotypes Becker muscular dystrophy for gene: DMD
Additional findings_Paediatric v0.0 DMD Zornitza Stark gene: DMD was added
gene: DMD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: DMD was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: DMD were set to Duchenne muscular dystrophy
Additional findings_Paediatric v0.0 DLL3 Zornitza Stark gene: DLL3 was added
gene: DLL3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: DLL3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DLL3 were set to Spondylocostal dysostosis, autosomal recessive, 1
Additional findings_Paediatric v0.0 DLD Zornitza Stark gene: DLD was added
gene: DLD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: DLD was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DLD were set to Maple syrup urine disease, type III
Additional findings_Paediatric v0.0 DHCR7 Zornitza Stark gene: DHCR7 was added
gene: DHCR7 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: DHCR7 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DHCR7 were set to Smith-Lemli-Opitz syndrome
Additional findings_Paediatric v0.0 DGUOK Zornitza Stark gene: DGUOK was added
gene: DGUOK was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: DGUOK was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DGUOK were set to Mitochondrial DNA depletion syndrome
Additional findings_Paediatric v0.0 DFNB59 Zornitza Stark gene: DFNB59 was added
gene: DFNB59 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: DFNB59 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DFNB59 were set to Hearing loss
Additional findings_Paediatric v0.0 DFNA5 Zornitza Stark gene: DFNA5 was added
gene: DFNA5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: DFNA5 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DFNA5 were set to Hearing loss
Additional findings_Paediatric v0.0 DES Zornitza Stark gene: DES was added
gene: DES was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: DES was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: DES were set to Myopathy, myofibrillar
Additional findings_Paediatric v0.0 DDC Zornitza Stark gene: DDC was added
gene: DDC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: DDC was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DDC were set to Aromatic L-amino acid decarboxylase deficiency
Additional findings_Paediatric v0.0 DDB2 Zornitza Stark gene: DDB2 was added
gene: DDB2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: DDB2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DDB2 were set to Xeroderma pigmentosum
Additional findings_Paediatric v0.0 DCX Zornitza Stark gene: DCX was added
gene: DCX was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: DCX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: DCX were set to Lissencephaly, X-linked
Additional findings_Paediatric v0.0 DCLRE1C Zornitza Stark gene: DCLRE1C was added
gene: DCLRE1C was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: DCLRE1C was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DCLRE1C were set to Severe combined immunodeficiency, Athabascan type
Additional findings_Paediatric v0.0 DBT Zornitza Stark gene: DBT was added
gene: DBT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: DBT was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: DBT were set to Maple syrup urine disease
Additional findings_Paediatric v0.0 D2HGDH Zornitza Stark gene: D2HGDH was added
gene: D2HGDH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: D2HGDH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: D2HGDH were set to D-2-hydroxyglutaric aciduria
Additional findings_Paediatric v0.0 CYP4F22 Zornitza Stark gene: CYP4F22 was added
gene: CYP4F22 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CYP4F22 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CYP4F22 were set to Ichthyosis, congenital, autosomal recessive
Additional findings_Paediatric v0.0 CYP27B1 Zornitza Stark gene: CYP27B1 was added
gene: CYP27B1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CYP27B1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CYP27B1 were set to Vitamin D-dependent rickets, type I
Additional findings_Paediatric v0.0 CYP27A1 Zornitza Stark gene: CYP27A1 was added
gene: CYP27A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CYP27A1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CYP27A1 were set to Cerebrotendinous xanthomatosis
Additional findings_Paediatric v0.0 CYP21A2 Zornitza Stark gene: CYP21A2 was added
gene: CYP21A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CYP21A2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CYP21A2 were set to Adrenal hyperplasia, congenital, due to 21-hydroxylase deficiency
Additional findings_Paediatric v0.0 CYP11B1 Zornitza Stark gene: CYP11B1 was added
gene: CYP11B1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CYP11B1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CYP11B1 were set to Adrenal hyperplasia, congenital, due to 11-beta-hydroxylase deficiency
Additional findings_Paediatric v0.0 CYP11A1 Zornitza Stark gene: CYP11A1 was added
gene: CYP11A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CYP11A1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CYP11A1 were set to Adrenal insufficiency, congenital, with 46XY sex reversal, partial or complete
Additional findings_Paediatric v0.0 CYBB Zornitza Stark gene: CYBB was added
gene: CYBB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CYBB was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: CYBB were set to Chronic granulomatous disease
Additional findings_Paediatric v0.0 CYBA Zornitza Stark gene: CYBA was added
gene: CYBA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CYBA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CYBA were set to Chronic granulomatous disease
Additional findings_Paediatric v0.0 CUL7 Zornitza Stark gene: CUL7 was added
gene: CUL7 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CUL7 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CUL7 were set to 3-M syndrome
Additional findings_Paediatric v0.0 CUBN Zornitza Stark gene: CUBN was added
gene: CUBN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CUBN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CUBN were set to Megaloblastic anemia-1, Finnish type
Additional findings_Paediatric v0.0 CTSK Zornitza Stark gene: CTSK was added
gene: CTSK was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CTSK was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CTSK were set to Pycnodysostosis
Additional findings_Paediatric v0.0 CTSD Zornitza Stark gene: CTSD was added
gene: CTSD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CTSD was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CTSD were set to Ceroid lipofuscinosis, neuronal, 10
Additional findings_Paediatric v0.0 CTNS Zornitza Stark gene: CTNS was added
gene: CTNS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CTNS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CTNS were set to Cystinosis
Additional findings_Paediatric v0.0 CTC1 Zornitza Stark gene: CTC1 was added
gene: CTC1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CTC1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CTC1 were set to Coats plus syndrome
Additional findings_Paediatric v0.0 CSTB Zornitza Stark gene: CSTB was added
gene: CSTB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CSTB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CSTB were set to Epilepsy, progressive myoclonic 1A
Additional findings_Paediatric v0.0 CSF2RA Zornitza Stark gene: CSF2RA was added
gene: CSF2RA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CSF2RA was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: CSF2RA were set to Pulmonary alveolar proteinosis
Additional findings_Paediatric v0.0 CRYAB Zornitza Stark gene: CRYAB was added
gene: CRYAB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CRYAB was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CRYAB were set to Myofibrillar myopathy
Additional findings_Paediatric v0.0 CRTAP Zornitza Stark gene: CRTAP was added
gene: CRTAP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CRTAP was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CRTAP were set to Osteogenesis imperfecta, type VII
Additional findings_Paediatric v0.0 CRLF1 Zornitza Stark gene: CRLF1 was added
gene: CRLF1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CRLF1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CRLF1 were set to Crisponi syndrome
Additional findings_Paediatric v0.0 CREBBP Zornitza Stark gene: CREBBP was added
gene: CREBBP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CREBBP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CREBBP were set to Rubinstein-Taybi syndrome
Additional findings_Paediatric v0.0 CPT2 Zornitza Stark gene: CPT2 was added
gene: CPT2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CPT2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CPT2 were set to Carnitine palmitoyltransferase 2 deficiency
Additional findings_Paediatric v0.0 CPT1A Zornitza Stark gene: CPT1A was added
gene: CPT1A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CPT1A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CPT1A were set to Carnitine palmitoyltransferase I deficiency
Additional findings_Paediatric v0.0 CPS1 Zornitza Stark gene: CPS1 was added
gene: CPS1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CPS1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CPS1 were set to Carbamoylphosphate synthetase I deficiency
Additional findings_Paediatric v0.0 COLQ Zornitza Stark gene: COLQ was added
gene: COLQ was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: COLQ was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: COLQ were set to Congenital myasthenic syndrome
Additional findings_Paediatric v0.0 COL7A1 Zornitza Stark gene: COL7A1 was added
gene: COL7A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: COL7A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: COL7A1 were set to Epidermolysis bullosa dystrophica
Additional findings_Paediatric v0.0 COL6A3 Zornitza Stark gene: COL6A3 was added
gene: COL6A3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: COL6A3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: COL6A3 were set to Ullrich congenital muscular dystrophy
Additional findings_Paediatric v0.0 COL6A2 Zornitza Stark gene: COL6A2 was added
gene: COL6A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: COL6A2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: COL6A2 were set to Ullrich congenital muscular dystrophy
Additional findings_Paediatric v0.0 COL6A1 Zornitza Stark gene: COL6A1 was added
gene: COL6A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: COL6A1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: COL6A1 were set to Ullrich congenital muscular dystrophy
Additional findings_Paediatric v0.0 COL5A2 Zornitza Stark gene: COL5A2 was added
gene: COL5A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: COL5A2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: COL5A2 were set to Ehlers-Danlos syndrome
Additional findings_Paediatric v0.0 COL5A1 Zornitza Stark gene: COL5A1 was added
gene: COL5A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: COL5A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: COL5A1 were set to Ehlers-Danlos syndrome, type I
Additional findings_Paediatric v0.0 COL4A5 Zornitza Stark gene: COL4A5 was added
gene: COL4A5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: COL4A5 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: COL4A5 were set to Alport syndrome
Additional findings_Paediatric v0.0 COL4A4 Zornitza Stark gene: COL4A4 was added
gene: COL4A4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: COL4A4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: COL4A4 were set to Alport syndrome
Additional findings_Paediatric v0.0 COL4A3 Zornitza Stark gene: COL4A3 was added
gene: COL4A3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: COL4A3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: COL4A3 were set to Alport syndrome
Additional findings_Paediatric v0.0 COL3A1 Zornitza Stark gene: COL3A1 was added
gene: COL3A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: COL3A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: COL3A1 were set to Ehlers-Danlos syndrome, type IV
Additional findings_Paediatric v0.0 COL2A1 Zornitza Stark gene: COL2A1 was added
gene: COL2A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: COL2A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: COL2A1 were set to Stickler syndrome
Additional findings_Paediatric v0.0 COL1A2 Zornitza Stark gene: COL1A2 was added
gene: COL1A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: COL1A2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: COL1A2 were set to Osteogenesis imperfecta, type II
Additional findings_Paediatric v0.0 COL1A1 Zornitza Stark gene: COL1A1 was added
gene: COL1A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: COL1A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: COL1A1 were set to Osteogenesis imperfecta, type I
Additional findings_Paediatric v0.0 COL17A1 Zornitza Stark gene: COL17A1 was added
gene: COL17A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: COL17A1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: COL17A1 were set to Epidermolysis bullosa, junctional, non-Herlitz type
Additional findings_Paediatric v0.0 COL11A2 Zornitza Stark gene: COL11A2 was added
gene: COL11A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: COL11A2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: COL11A2 were set to Otospondylomegaepiphyseal dysplasia
Additional findings_Paediatric v0.0 COL11A1 Zornitza Stark gene: COL11A1 was added
gene: COL11A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: COL11A1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: COL11A1 were set to Stickler syndrome
Additional findings_Paediatric v0.0 COCH Zornitza Stark gene: COCH was added
gene: COCH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: COCH was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: COCH were set to Deafness, non-syndromic, autosomal dominant
Additional findings_Paediatric v0.0 CNGB3 Zornitza Stark gene: CNGB3 was added
gene: CNGB3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CNGB3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CNGB3 were set to Achromatopsia-3
Additional findings_Paediatric v0.0 CLRN1 Zornitza Stark gene: CLRN1 was added
gene: CLRN1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CLRN1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CLRN1 were set to Usher syndrome, type 3A
Additional findings_Paediatric v0.0 CLN8 Zornitza Stark gene: CLN8 was added
gene: CLN8 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CLN8 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CLN8 were set to Ceroid lipofuscinosis, neuronal, 8
Additional findings_Paediatric v0.0 CLN6 Zornitza Stark gene: CLN6 was added
gene: CLN6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CLN6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CLN6 were set to Ceroid lipofuscinosis, neuronal, 6
Additional findings_Paediatric v0.0 CLN5 Zornitza Stark gene: CLN5 was added
gene: CLN5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CLN5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CLN5 were set to Ceroid lipofuscinosis, neuronal, 5
Additional findings_Paediatric v0.0 CLN3 Zornitza Stark gene: CLN3 was added
gene: CLN3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CLN3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CLN3 were set to Ceroid lipofuscinosis, neuronal, 3
Additional findings_Paediatric v0.0 CLDN19 Zornitza Stark gene: CLDN19 was added
gene: CLDN19 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CLDN19 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CLDN19 were set to Hypomagnesemia 5, renal, with ocular involvement
Additional findings_Paediatric v0.0 CLDN14 Zornitza Stark gene: CLDN14 was added
gene: CLDN14 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CLDN14 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CLDN14 were set to Hearing loss, non-syndromic, autosomal recessive
Additional findings_Paediatric v0.0 CLCN5 Zornitza Stark gene: CLCN5 was added
gene: CLCN5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CLCN5 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: CLCN5 were set to Dent disease
Additional findings_Paediatric v0.0 CHRNG Zornitza Stark gene: CHRNG was added
gene: CHRNG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CHRNG was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CHRNG were set to Pterygium syndrome
Additional findings_Paediatric v0.0 CHRNE Zornitza Stark gene: CHRNE was added
gene: CHRNE was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CHRNE was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CHRNE were set to Congenital myasthenic syndrome
Additional findings_Paediatric v0.0 CHRND Zornitza Stark gene: CHRND was added
gene: CHRND was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CHRND was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CHRND were set to Congenital myasthenic syndrome
Additional findings_Paediatric v0.0 CHRNA1 Zornitza Stark gene: CHRNA1 was added
gene: CHRNA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CHRNA1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CHRNA1 were set to Congenital myasthenic syndrome
Additional findings_Paediatric v0.0 CHM Zornitza Stark gene: CHM was added
gene: CHM was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CHM was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: CHM were set to Choroideremia
Additional findings_Paediatric v0.0 CHKB Zornitza Stark gene: CHKB was added
gene: CHKB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CHKB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CHKB were set to Muscular dystrophy, congenital, megaconial type
Additional findings_Paediatric v0.0 CHD7 Zornitza Stark gene: CHD7 was added
gene: CHD7 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CHD7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CHD7 were set to CHARGE syndrome
Additional findings_Paediatric v0.0 CHD2 Zornitza Stark gene: CHD2 was added
gene: CHD2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CHD2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CHD2 were set to Developmental delay, intellectual disability, epilepsy
Additional findings_Paediatric v0.0 CHAT Zornitza Stark gene: CHAT was added
gene: CHAT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CHAT was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CHAT were set to Congenital myasthenic syndrome
Additional findings_Paediatric v0.0 CFTR Zornitza Stark gene: CFTR was added
gene: CFTR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CFTR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CFTR were set to Cystic fibrosis
Additional findings_Paediatric v0.0 CFP Zornitza Stark gene: CFP was added
gene: CFP was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CFP was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: CFP were set to Properdin deficiency, X-linked
Additional findings_Paediatric v0.0 CFL2 Zornitza Stark gene: CFL2 was added
gene: CFL2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CFL2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CFL2 were set to Nemaline myopathy
Additional findings_Paediatric v0.0 CFC1 Zornitza Stark gene: CFC1 was added
gene: CFC1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CFC1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CFC1 were set to Congenital heart defects
Additional findings_Paediatric v0.0 CEP290 Zornitza Stark gene: CEP290 was added
gene: CEP290 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CEP290 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CEP290 were set to Joubert syndrome
Additional findings_Paediatric v0.0 CEP152 Zornitza Stark gene: CEP152 was added
gene: CEP152 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CEP152 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CEP152 were set to Seckel syndrome
Additional findings_Paediatric v0.0 CDSN Zornitza Stark gene: CDSN was added
gene: CDSN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CDSN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CDSN were set to Hypotrichosis
Additional findings_Paediatric v0.0 CDKN1C Zornitza Stark gene: CDKN1C was added
gene: CDKN1C was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CDKN1C was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CDKN1C were set to Beckwith-Wiedemann syndrome
Additional findings_Paediatric v0.0 CDKL5 Zornitza Stark gene: CDKL5 was added
gene: CDKL5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CDKL5 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: CDKL5 were set to Epileptic encephalopathy, early infantile, 2
Additional findings_Paediatric v0.0 CDH23 Zornitza Stark Added phenotypes Usher syndrome, type 1D for gene: CDH23
Additional findings_Paediatric v0.0 CDH23 Zornitza Stark gene: CDH23 was added
gene: CDH23 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CDH23 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CDH23 were set to Deafness, autosomal recessive
Additional findings_Paediatric v0.0 CDAN1 Zornitza Stark gene: CDAN1 was added
gene: CDAN1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CDAN1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CDAN1 were set to Anemia, congenital dyserythropoietic, type I
Additional findings_Paediatric v0.0 CD40LG Zornitza Stark gene: CD40LG was added
gene: CD40LG was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CD40LG was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: CD40LG were set to Immunodeficiency, X-linked, with hyper-IgM
Additional findings_Paediatric v0.0 CCDC40 Zornitza Stark gene: CCDC40 was added
gene: CCDC40 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CCDC40 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CCDC40 were set to Primary ciliary dyskinesia
Additional findings_Paediatric v0.0 CCDC39 Zornitza Stark gene: CCDC39 was added
gene: CCDC39 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CCDC39 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CCDC39 were set to Primary ciliary dyskinesia
Additional findings_Paediatric v0.0 CC2D2A Zornitza Stark gene: CC2D2A was added
gene: CC2D2A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CC2D2A was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CC2D2A were set to Joubert syndrome
Additional findings_Paediatric v0.0 CBS Zornitza Stark gene: CBS was added
gene: CBS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CBS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CBS were set to Homocystinuria, B6-responsive and nonresponsive types
Additional findings_Paediatric v0.0 CBL Zornitza Stark gene: CBL was added
gene: CBL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CBL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CBL were set to Noonan syndrome-like disorder with or without juvenile meylomonocytic leukemia
Additional findings_Paediatric v0.0 CAV3 Zornitza Stark Added phenotypes Caveolinopathy for gene: CAV3
Additional findings_Paediatric v0.0 CAV3 Zornitza Stark gene: CAV3 was added
gene: CAV3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CAV3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CAV3 were set to Muscular dystrophy, limb-girdle, type IC,
Additional findings_Paediatric v0.0 CASQ2 Zornitza Stark gene: CASQ2 was added
gene: CASQ2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CASQ2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CASQ2 were set to Ventricular tachycardia, catecholaminergic polymorphic
Additional findings_Paediatric v0.0 CASK Zornitza Stark gene: CASK was added
gene: CASK was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CASK was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: CASK were set to Mental retardation and microcephaly with pontine and cerebellar hypoplasia
Additional findings_Paediatric v0.0 CAPN3 Zornitza Stark gene: CAPN3 was added
gene: CAPN3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CAPN3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CAPN3 were set to Muscular dystrophy, limb-girdle, type 2A
Additional findings_Paediatric v0.0 CACNA1F Zornitza Stark gene: CACNA1F was added
gene: CACNA1F was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CACNA1F was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: CACNA1F were set to Night blindness, congenital stationary (complete), 1A, X-linked
Additional findings_Paediatric v0.0 CACNA1A Zornitza Stark gene: CACNA1A was added
gene: CACNA1A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CACNA1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: CACNA1A were set to Episodic ataxia, type 2
Additional findings_Paediatric v0.0 CA2 Zornitza Stark gene: CA2 was added
gene: CA2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: CA2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: CA2 were set to Osteopetrosis, autosomal recessive 3, with renal tubular acidosis
Additional findings_Paediatric v0.0 TWNK Zornitza Stark gene: TWNK was added
gene: TWNK was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: TWNK was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: TWNK were set to Spinocerebellar ataxia infantile-onset
Additional findings_Paediatric v0.0 BTK Zornitza Stark gene: BTK was added
gene: BTK was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: BTK was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: BTK were set to Agammaglobulinemia, X-linked 1
Additional findings_Paediatric v0.0 BTD Zornitza Stark gene: BTD was added
gene: BTD was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: BTD was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BTD were set to Biotinidase deficiency
Additional findings_Paediatric v0.0 BSND Zornitza Stark gene: BSND was added
gene: BSND was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: BSND was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BSND were set to Bartter syndrome with sensorineural deafness
Additional findings_Paediatric v0.0 BSCL2 Zornitza Stark gene: BSCL2 was added
gene: BSCL2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: BSCL2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BSCL2 were set to Berardinelli-Seip lipodystrophy
Additional findings_Paediatric v0.0 BRCA2 Zornitza Stark gene: BRCA2 was added
gene: BRCA2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: BRCA2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BRCA2 were set to Fanconi anemia, complementation group D1
Additional findings_Paediatric v0.0 BRAF Zornitza Stark gene: BRAF was added
gene: BRAF was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: BRAF was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: BRAF were set to Cardiofaciocutaneous syndrome
Additional findings_Paediatric v0.0 BMPR1A Zornitza Stark gene: BMPR1A was added
gene: BMPR1A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: BMPR1A was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: BMPR1A were set to Juvenile polyposis syndrome
Additional findings_Paediatric v0.0 BLM Zornitza Stark gene: BLM was added
gene: BLM was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: BLM was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BLM were set to Bloom syndrome
Additional findings_Paediatric v0.0 BIN1 Zornitza Stark gene: BIN1 was added
gene: BIN1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: BIN1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BIN1 were set to Myopathy, centronuclear, autosomal recessive
Additional findings_Paediatric v0.0 BICD2 Zornitza Stark gene: BICD2 was added
gene: BICD2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: BICD2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: BICD2 were set to Congenital spinal muscular atrophy
Additional findings_Paediatric v0.0 BCS1L Zornitza Stark gene: BCS1L was added
gene: BCS1L was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: BCS1L was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BCS1L were set to Complex 3 deficiency
Additional findings_Paediatric v0.0 BCKDHB Zornitza Stark gene: BCKDHB was added
gene: BCKDHB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: BCKDHB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BCKDHB were set to Maple syrup urine disease
Additional findings_Paediatric v0.0 BCKDHA Zornitza Stark gene: BCKDHA was added
gene: BCKDHA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: BCKDHA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BCKDHA were set to Maple syrup urine disease
Additional findings_Paediatric v0.0 BBS9 Zornitza Stark gene: BBS9 was added
gene: BBS9 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: BBS9 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BBS9 were set to Bardet-Biedl syndrome
Additional findings_Paediatric v0.0 BBS7 Zornitza Stark gene: BBS7 was added
gene: BBS7 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: BBS7 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BBS7 were set to Bardet-Biedl syndrome
Additional findings_Paediatric v0.0 BBS5 Zornitza Stark gene: BBS5 was added
gene: BBS5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: BBS5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BBS5 were set to Bardet-Biedl syndrome
Additional findings_Paediatric v0.0 BBS4 Zornitza Stark gene: BBS4 was added
gene: BBS4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: BBS4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BBS4 were set to Bardet-Biedl syndrome
Additional findings_Paediatric v0.0 BBS2 Zornitza Stark gene: BBS2 was added
gene: BBS2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: BBS2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BBS2 were set to Bardet-Biedl syndrome
Additional findings_Paediatric v0.0 BBS12 Zornitza Stark gene: BBS12 was added
gene: BBS12 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: BBS12 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BBS12 were set to Bardet-Biedl syndrome
Additional findings_Paediatric v0.0 BBS10 Zornitza Stark gene: BBS10 was added
gene: BBS10 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: BBS10 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BBS10 were set to Bardet-Biedl syndrome
Additional findings_Paediatric v0.0 BBS1 Zornitza Stark gene: BBS1 was added
gene: BBS1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: BBS1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BBS1 were set to Bardet-Biedl syndrome
Additional findings_Paediatric v0.0 BAAT Zornitza Stark gene: BAAT was added
gene: BAAT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: BAAT was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: BAAT were set to Bile acid amidation defect
Additional findings_Paediatric v0.0 B3GLCT Zornitza Stark gene: B3GLCT was added
gene: B3GLCT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: B3GLCT was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: B3GLCT were set to Peters-Plus syndrome
Additional findings_Paediatric v0.0 AVPR2 Zornitza Stark gene: AVPR2 was added
gene: AVPR2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: AVPR2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: AVPR2 were set to Diabetes insipidus, nephrogenic
Additional findings_Paediatric v0.0 AUH Zornitza Stark gene: AUH was added
gene: AUH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: AUH was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AUH were set to 3-methylglutaconic aciduria, type I
Additional findings_Paediatric v0.0 ATRX Zornitza Stark gene: ATRX was added
gene: ATRX was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ATRX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: ATRX were set to Alpha-thalassemia/mental retardation syndrome
Additional findings_Paediatric v0.0 ATP8B1 Zornitza Stark gene: ATP8B1 was added
gene: ATP8B1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ATP8B1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ATP8B1 were set to Cholestasis, progressive familial intrahepatic 1
Additional findings_Paediatric v0.0 ATP7B Zornitza Stark gene: ATP7B was added
gene: ATP7B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ATP7B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ATP7B were set to Wilson disease
Additional findings_Paediatric v0.0 ATP7A Zornitza Stark Added phenotypes Occipital horn syndrome for gene: ATP7A
Additional findings_Paediatric v0.0 ATP7A Zornitza Stark gene: ATP7A was added
gene: ATP7A was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ATP7A was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: ATP7A were set to Menkes syndrome
Additional findings_Paediatric v0.0 ATP6V1B1 Zornitza Stark gene: ATP6V1B1 was added
gene: ATP6V1B1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ATP6V1B1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ATP6V1B1 were set to Renal tubular acidosis & hearing loss
Additional findings_Paediatric v0.0 ATP6V0A2 Zornitza Stark gene: ATP6V0A2 was added
gene: ATP6V0A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ATP6V0A2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ATP6V0A2 were set to Cutis laxa, autosomal recessive, type IIA
Additional findings_Paediatric v0.0 ATP2A1 Zornitza Stark gene: ATP2A1 was added
gene: ATP2A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ATP2A1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ATP2A1 were set to Brody myopathy
Additional findings_Paediatric v0.0 ATP1A2 Zornitza Stark gene: ATP1A2 was added
gene: ATP1A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ATP1A2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ATP1A2 were set to Hemiplegic migraine
Additional findings_Paediatric v0.0 ATM Zornitza Stark gene: ATM was added
gene: ATM was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ATM was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ATM were set to Ataxia-telangiectasia
Additional findings_Paediatric v0.0 ASS1 Zornitza Stark gene: ASS1 was added
gene: ASS1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ASS1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ASS1 were set to Citrullinemia
Additional findings_Paediatric v0.0 ASPA Zornitza Stark gene: ASPA was added
gene: ASPA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ASPA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ASPA were set to Canavan disease
Additional findings_Paediatric v0.0 ASL Zornitza Stark gene: ASL was added
gene: ASL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ASL was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ASL were set to Argininosuccinic aciduria
Additional findings_Paediatric v0.0 ARX Zornitza Stark gene: ARX was added
gene: ARX was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ARX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: ARX were set to Lissencephaly, X-linked 2
Additional findings_Paediatric v0.0 ARSB Zornitza Stark gene: ARSB was added
gene: ARSB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ARSB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ARSB were set to Mucopolysaccharidosis type VI (Maroteaux-Lamy)
Additional findings_Paediatric v0.0 ARSA Zornitza Stark gene: ARSA was added
gene: ARSA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ARSA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ARSA were set to Metachromatic leukodystrophy
Additional findings_Paediatric v0.0 ARMC4 Zornitza Stark gene: ARMC4 was added
gene: ARMC4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ARMC4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ARMC4 were set to Primary ciliary dyskinesia
Additional findings_Paediatric v0.0 ARID1B Zornitza Stark gene: ARID1B was added
gene: ARID1B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ARID1B was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ARID1B were set to Coffin-Siris syndrome
Additional findings_Paediatric v0.0 ARG1 Zornitza Stark gene: ARG1 was added
gene: ARG1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ARG1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ARG1 were set to Arginase deficiency
Additional findings_Paediatric v0.0 ARFGEF2 Zornitza Stark gene: ARFGEF2 was added
gene: ARFGEF2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ARFGEF2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ARFGEF2 were set to Periventricular heterotopia with microcephaly
Additional findings_Paediatric v0.0 AR Zornitza Stark gene: AR was added
gene: AR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: AR was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: AR were set to Androgen insensitivity
Additional findings_Paediatric v0.0 APTX Zornitza Stark gene: APTX was added
gene: APTX was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: APTX was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: APTX were set to Ataxia, early-onset, with oculomotor apraxia and hypoalbuminemia
Additional findings_Paediatric v0.0 APOB Zornitza Stark gene: APOB was added
gene: APOB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: APOB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: APOB were set to Apolipoprotein B deficiency
Additional findings_Paediatric v0.0 APC Zornitza Stark Added phenotypes Adenomatous polyposis coli, attenuated for gene: APC
Additional findings_Paediatric v0.0 APC Zornitza Stark gene: APC was added
gene: APC was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: APC was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: APC were set to Adenomatous polyposis coli
Additional findings_Paediatric v0.0 AP3B1 Zornitza Stark gene: AP3B1 was added
gene: AP3B1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: AP3B1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AP3B1 were set to Hermansky-Pudlak syndrome 2
Additional findings_Paediatric v0.0 ANTXR2 Zornitza Stark gene: ANTXR2 was added
gene: ANTXR2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ANTXR2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ANTXR2 were set to Hyaline fibromatosis syndrome
Additional findings_Paediatric v0.0 ANO5 Zornitza Stark gene: ANO5 was added
gene: ANO5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ANO5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ANO5 were set to Muscular dystrophy, limb-girdle, type 2L
Additional findings_Paediatric v0.0 ANO10 Zornitza Stark gene: ANO10 was added
gene: ANO10 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ANO10 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ANO10 were set to Spinocerebellar ataxia, autosomal recessive 10
Additional findings_Paediatric v0.0 ANKRD26 Zornitza Stark gene: ANKRD26 was added
gene: ANKRD26 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ANKRD26 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ANKRD26 were set to Thrombocytopenia 2
Additional findings_Paediatric v0.0 ANKH Zornitza Stark gene: ANKH was added
gene: ANKH was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ANKH was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ANKH were set to Craniometaphyseal dysplasia
Additional findings_Paediatric v0.0 ANK1 Zornitza Stark gene: ANK1 was added
gene: ANK1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ANK1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ANK1 were set to Spherocytosis
Additional findings_Paediatric v0.0 AMT Zornitza Stark gene: AMT was added
gene: AMT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: AMT was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AMT were set to Hyperglycinaemia, non-ketotic
Additional findings_Paediatric v0.0 AMN Zornitza Stark gene: AMN was added
gene: AMN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: AMN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AMN were set to Megaloblastic anemia-1, Norwegian type
Additional findings_Paediatric v0.0 AMELX Zornitza Stark gene: AMELX was added
gene: AMELX was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: AMELX was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: AMELX were set to Amelogenesis imperfecta
Additional findings_Paediatric v0.0 ALX4 Zornitza Stark gene: ALX4 was added
gene: ALX4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ALX4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ALX4 were set to Parietal foramina 2
Additional findings_Paediatric v0.0 ALS2 Zornitza Stark gene: ALS2 was added
gene: ALS2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ALS2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ALS2 were set to Amyotrophic lateral sclerosis
Additional findings_Paediatric v0.0 ALPL Zornitza Stark gene: ALPL was added
gene: ALPL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ALPL was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ALPL were set to Hypophosphatasia
Additional findings_Paediatric v0.0 ALOXE3 Zornitza Stark gene: ALOXE3 was added
gene: ALOXE3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ALOXE3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ALOXE3 were set to Ichthyosis, congenital, autosomal recessive
Additional findings_Paediatric v0.0 ALOX12B Zornitza Stark gene: ALOX12B was added
gene: ALOX12B was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ALOX12B was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ALOX12B were set to Ichthyosis, congenital, autosomal recessive
Additional findings_Paediatric v0.0 ALMS1 Zornitza Stark gene: ALMS1 was added
gene: ALMS1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ALMS1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ALMS1 were set to Alstrom syndrome
Additional findings_Paediatric v0.0 ALG8 Zornitza Stark gene: ALG8 was added
gene: ALG8 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ALG8 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ALG8 were set to Congenital disorder of glycosylation, type Ih
Additional findings_Paediatric v0.0 ALG6 Zornitza Stark gene: ALG6 was added
gene: ALG6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ALG6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ALG6 were set to Congenital disorder of glycosylation, type Ic
Additional findings_Paediatric v0.0 ALG3 Zornitza Stark gene: ALG3 was added
gene: ALG3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ALG3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ALG3 were set to Congenital disorder of glycosylation, type Id
Additional findings_Paediatric v0.0 ALG12 Zornitza Stark gene: ALG12 was added
gene: ALG12 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ALG12 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ALG12 were set to Congenital disorder of glycosylation, type Ig
Additional findings_Paediatric v0.0 ALG1 Zornitza Stark gene: ALG1 was added
gene: ALG1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ALG1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ALG1 were set to Congenital disorder of glycosylation, type Ik
Additional findings_Paediatric v0.0 ALDOB Zornitza Stark gene: ALDOB was added
gene: ALDOB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ALDOB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ALDOB were set to Fructose intolerance
Additional findings_Paediatric v0.0 ALDH5A1 Zornitza Stark gene: ALDH5A1 was added
gene: ALDH5A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ALDH5A1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ALDH5A1 were set to Succinic semialdehyde dehydrogenase deficiency
Additional findings_Paediatric v0.0 ALDH3A2 Zornitza Stark gene: ALDH3A2 was added
gene: ALDH3A2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ALDH3A2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ALDH3A2 were set to Sjogren-Larsson syndrome
Additional findings_Paediatric v0.0 ALDH18A1 Zornitza Stark gene: ALDH18A1 was added
gene: ALDH18A1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ALDH18A1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ALDH18A1 were set to Cutis laxa, autosomal recessive, type IIIA
Additional findings_Paediatric v0.0 ALB Zornitza Stark gene: ALB was added
gene: ALB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ALB was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ALB were set to Analbuminemia
Additional findings_Paediatric v0.0 ALAS2 Zornitza Stark gene: ALAS2 was added
gene: ALAS2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ALAS2 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: ALAS2 were set to Anemia, sideroblastic, X-linked
Additional findings_Paediatric v0.0 AKR1D1 Zornitza Stark gene: AKR1D1 was added
gene: AKR1D1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: AKR1D1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AKR1D1 were set to Bile acid synthesis defect, congenital, 2
Additional findings_Paediatric v0.0 AIRE Zornitza Stark gene: AIRE was added
gene: AIRE was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: AIRE was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AIRE were set to Autoimmune polyendocrinopathy syndrome , type I, with or without reversible metaphyseal dysplasia
Additional findings_Paediatric v0.0 AIFM1 Zornitza Stark gene: AIFM1 was added
gene: AIFM1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: AIFM1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: AIFM1 were set to Cowchock syndrome
Additional findings_Paediatric v0.0 AHI1 Zornitza Stark gene: AHI1 was added
gene: AHI1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: AHI1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AHI1 were set to Joubert syndrome-3
Additional findings_Paediatric v0.0 AGXT Zornitza Stark gene: AGXT was added
gene: AGXT was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: AGXT was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AGXT were set to Hyperoxaluria, primary, type 1
Additional findings_Paediatric v0.0 AGRN Zornitza Stark gene: AGRN was added
gene: AGRN was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: AGRN was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AGRN were set to Myasthenia, limb-girdle, familial
Additional findings_Paediatric v0.0 AGL Zornitza Stark gene: AGL was added
gene: AGL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: AGL was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AGL were set to Glycogen storage disease IIIa
Additional findings_Paediatric v0.0 AGA Zornitza Stark gene: AGA was added
gene: AGA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: AGA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AGA were set to Aspartylglucosaminuria
Additional findings_Paediatric v0.0 ADK Zornitza Stark gene: ADK was added
gene: ADK was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ADK was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ADK were set to Hypermethioninemia due to adenosine kinase deficiency
Additional findings_Paediatric v0.0 ADAR Zornitza Stark Mode of inheritance for gene ADAR was changed from BIALLELIC, autosomal or pseudoautosomal to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Added phenotypes Dyschromatosis symmetrica hereditaria for gene: ADAR
Additional findings_Paediatric v0.0 ADAR Zornitza Stark gene: ADAR was added
gene: ADAR was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ADAR was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ADAR were set to Aicardi-Goutieres syndrome
Additional findings_Paediatric v0.0 ADAMTSL2 Zornitza Stark gene: ADAMTSL2 was added
gene: ADAMTSL2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ADAMTSL2 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ADAMTSL2 were set to Geleophysic dysplasia 1
Additional findings_Paediatric v0.0 ADAMTS13 Zornitza Stark gene: ADAMTS13 was added
gene: ADAMTS13 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ADAMTS13 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ADAMTS13 were set to Thrombotic thrombocytopenic purpura, familial
Additional findings_Paediatric v0.0 ADA Zornitza Stark gene: ADA was added
gene: ADA was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ADA was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ADA were set to Severe combined immunodeficiency due to ADA deficiency
Additional findings_Paediatric v0.0 ACVRL1 Zornitza Stark gene: ACVRL1 was added
gene: ACVRL1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ACVRL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ACVRL1 were set to Telangiectasia, hereditary hemorrhagic, type 2
Additional findings_Paediatric v0.0 ACVR1 Zornitza Stark gene: ACVR1 was added
gene: ACVR1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ACVR1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ACVR1 were set to Fibrodysplasia ossificans progressiva
Additional findings_Paediatric v0.0 ACTN4 Zornitza Stark gene: ACTN4 was added
gene: ACTN4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ACTN4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ACTN4 were set to Glomerulosclerosis, focal segmental, 1
Additional findings_Paediatric v0.0 ACTN1 Zornitza Stark gene: ACTN1 was added
gene: ACTN1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ACTN1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ACTN1 were set to Macrothrombocytopenia
Additional findings_Paediatric v0.0 ACTG2 Zornitza Stark gene: ACTG2 was added
gene: ACTG2 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ACTG2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ACTG2 were set to Megacystis-microcolon-intestinal hypoperistalsis syndrome
Additional findings_Paediatric v0.0 ACTG1 Zornitza Stark Added phenotypes Baraitser-Winter syndrome for gene: ACTG1
Additional findings_Paediatric v0.0 ACTG1 Zornitza Stark gene: ACTG1 was added
gene: ACTG1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ACTG1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ACTG1 were set to Deafness, autosomal dominant
Additional findings_Paediatric v0.0 ACTB Zornitza Stark gene: ACTB was added
gene: ACTB was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ACTB was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ACTB were set to Baraitser-Winter syndrome
Additional findings_Paediatric v0.0 ACTA1 Zornitza Stark gene: ACTA1 was added
gene: ACTA1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ACTA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ACTA1 were set to Nemaline myopathy
Additional findings_Paediatric v0.0 ACSF3 Zornitza Stark gene: ACSF3 was added
gene: ACSF3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ACSF3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ACSF3 were set to Combined malonic and methylmalonic aciduria
Additional findings_Paediatric v0.0 ACOX1 Zornitza Stark gene: ACOX1 was added
gene: ACOX1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ACOX1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ACOX1 were set to Peroxisomal acyl-CoA oxidase deficiency
Additional findings_Paediatric v0.0 ACE Zornitza Stark gene: ACE was added
gene: ACE was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ACE was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ACE were set to Renal tubular dysgenesis
Additional findings_Paediatric v0.0 ACAT1 Zornitza Stark gene: ACAT1 was added
gene: ACAT1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ACAT1 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ACAT1 were set to Alpha-methylacetoacetic aciduria
Additional findings_Paediatric v0.0 ACADVL Zornitza Stark gene: ACADVL was added
gene: ACADVL was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ACADVL was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ACADVL were set to VLCAD deficiency
Additional findings_Paediatric v0.0 ACADM Zornitza Stark gene: ACADM was added
gene: ACADM was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ACADM was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ACADM were set to Medium chain acyl CoA dehydrogenase deficiency
Additional findings_Paediatric v0.0 ACAD9 Zornitza Stark gene: ACAD9 was added
gene: ACAD9 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ACAD9 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ACAD9 were set to ACAD9 deficiency
Additional findings_Paediatric v0.0 ACAD8 Zornitza Stark gene: ACAD8 was added
gene: ACAD8 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ACAD8 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ACAD8 were set to Isobutyryl-CoA dehydrogenase deficiency
Additional findings_Paediatric v0.0 ABCG5 Zornitza Stark gene: ABCG5 was added
gene: ABCG5 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ABCG5 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ABCG5 were set to Sitosterolemia
Additional findings_Paediatric v0.0 ABCD1 Zornitza Stark gene: ABCD1 was added
gene: ABCD1 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ABCD1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Phenotypes for gene: ABCD1 were set to Adrenoleukodystrophy
Additional findings_Paediatric v0.0 ABCC9 Zornitza Stark gene: ABCC9 was added
gene: ABCC9 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ABCC9 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: ABCC9 were set to Hypertrichotic osteochondrodysplasia
Additional findings_Paediatric v0.0 ABCC8 Zornitza Stark gene: ABCC8 was added
gene: ABCC8 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ABCC8 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ABCC8 were set to Hyperinsulinemic hypoglycemia, familial
Additional findings_Paediatric v0.0 ABCC6 Zornitza Stark gene: ABCC6 was added
gene: ABCC6 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ABCC6 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ABCC6 were set to Pseudoxanthoma elasticum
Additional findings_Paediatric v0.0 ABCB4 Zornitza Stark gene: ABCB4 was added
gene: ABCB4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ABCB4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ABCB4 were set to Cholestasis, progressive familial intrahepatic 3
Additional findings_Paediatric v0.0 ABCB11 Zornitza Stark gene: ABCB11 was added
gene: ABCB11 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ABCB11 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ABCB11 were set to Cholestasis, progressive familial intrahepatic 2
Additional findings_Paediatric v0.0 ABCA4 Zornitza Stark gene: ABCA4 was added
gene: ABCA4 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ABCA4 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ABCA4 were set to Stargardt disease
Additional findings_Paediatric v0.0 ABCA3 Zornitza Stark gene: ABCA3 was added
gene: ABCA3 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ABCA3 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ABCA3 were set to Surfactant metabolism dysfunction, pulmonary, 3
Additional findings_Paediatric v0.0 ABCA12 Zornitza Stark gene: ABCA12 was added
gene: ABCA12 was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: ABCA12 was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: ABCA12 were set to Ichthyosis, congenital, autosomal recessive
Additional findings_Paediatric v0.0 AARS Zornitza Stark gene: AARS was added
gene: AARS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: AARS was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes for gene: AARS were set to Charcot-Marie-Tooth disease
Additional findings_Paediatric v0.0 AAAS Zornitza Stark gene: AAAS was added
gene: AAAS was added to Newborn Screening_BabySeq. Sources: Expert Review Green,BabySeq Category A gene
Mode of inheritance for gene: AAAS was set to BIALLELIC, autosomal or pseudoautosomal
Phenotypes for gene: AAAS were set to Achalasia-addisonianism-alacrimia syndrome
Additional findings_Paediatric v0.0 Zornitza Stark Added panel Newborn Screening_BabySeq
Early-onset Dementia v0.68 C9orf72 Bryony Thompson Classified gene: C9orf72 as Green List (high evidence)
Early-onset Dementia v0.68 C9orf72 Bryony Thompson Added comment: Comment on list classification: Only reported cause of disease is a hexanucleotide repeat (GGGGCC) located between the noncoding exons 1a and 1b. RNA toxicity or proteotoxicity is the expected mechanism of disease.
Early-onset Dementia v0.68 C9orf72 Bryony Thompson Gene: c9orf72 has been classified as Green List (High Evidence).
Ataxia - adult onset v0.97 EPM1 Bryony Thompson Classified STR: EPM1 as Green List (high evidence)
Ataxia - adult onset v0.97 EPM1 Bryony Thompson Str: epm1 has been classified as Green List (High Evidence).
Ataxia - adult onset v0.96 EPM1 Bryony Thompson STR: EPM1 was added
STR: EPM1 was added to Ataxia - adult onset. Sources: Literature
STR tags were added to STR: EPM1.
Mode of inheritance for STR: EPM1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: EPM1 were set to 29325606; 20301321
Phenotypes for STR: EPM1 were set to Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800
Review for STR: EPM1 was set to GREEN
STR: EPM1 was marked as clinically relevant
Added comment: NM_000100​.4:c.-179CCCCGCCCCGCG[X]
Loss of function, other disease-associated variants can cause loss of function too. Ataxia age of onset usually occurs a couple of years after PME.
Normal: 2-3 dodecamer repeats
Uncertain significance: 12-17 dodecamer repeats (unstable, but not clinically characterized)
Pathogenic (full penetrance): ≥30 dodecamer repeats
Sources: Literature
Ataxia - adult onset v0.95 FMR1 Bryony Thompson Classified gene: FMR1 as Green List (high evidence)
Ataxia - adult onset v0.95 FMR1 Bryony Thompson Added comment: Comment on list classification: CCG repeat expansion is the only reported cause of ataxia (FXTAS). The SNVs are associated with intellectual disability in FXS.
Ataxia - adult onset v0.95 FMR1 Bryony Thompson Gene: fmr1 has been classified as Green List (High Evidence).
Ataxia - adult onset v0.94 FMR1 Bryony Thompson Deleted their review
Ataxia - adult onset v0.94 FRDA Bryony Thompson Classified STR: FRDA as Green List (high evidence)
Ataxia - adult onset v0.94 FRDA Bryony Thompson Str: frda has been classified as Green List (High Evidence).
Ataxia - adult onset v0.93 FRDA Bryony Thompson STR: FRDA was added
STR: FRDA was added to Ataxia - adult onset. Sources: Expert list
STR tags were added to STR: FRDA.
Mode of inheritance for STR: FRDA was set to BIALLELIC, autosomal or pseudoautosomal
Publications for STR: FRDA were set to 20301458
Phenotypes for STR: FRDA were set to Friedreich ataxia MIM#229300
Review for STR: FRDA was set to GREEN
STR: FRDA was marked as clinically relevant
Added comment: NM_000144.4:c.165+1340GAA[X]
Loss of function is the mechanism of disease
Normal: 5-33 repeats
Mutable normal (premutation): 34-65 repeats
Borderline: 44-66 repeats
Full-penetrance: ≥66 repeats
Sources: Expert list
Early-onset Dementia v0.67 HDL2 Bryony Thompson Classified STR: HDL2 as Green List (high evidence)
Early-onset Dementia v0.67 HDL2 Bryony Thompson Str: hdl2 has been classified as Green List (High Evidence).
Early-onset Dementia v0.66 HDL2 Bryony Thompson STR: HDL2 was added
STR: HDL2 was added to Early-onset Dementia. Sources: Expert list
STR tags were added to STR: HDL2.
Mode of inheritance for STR: HDL2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: HDL2 were set to 20301701
Phenotypes for STR: HDL2 were set to Huntington disease-like 2 MIM#606438
Review for STR: HDL2 was set to GREEN
STR: HDL2 was marked as clinically relevant
Added comment: NM_001271604.2:c.431CTG[X] or NM_020655.4:c.382+760CTG[X]
In an alternatively spliced exon, the repeat can be transcribed in both directions, leading to CUG (more common) or CAG (less common) repeat-containing transcripts. While a dominant RNA toxic effect may occur, the repeat expansion also reduces levels of the Junctophilin-3 protein
Normal: ≤28 repeats
Questionable significance: 29-39 repeats, mutable normal or reduced penetrance included
Full penetrance: ≥40 repeats
Sources: Expert list
Ataxia - adult onset v0.92 SCA36 Bryony Thompson Classified STR: SCA36 as Green List (high evidence)
Ataxia - adult onset v0.92 SCA36 Bryony Thompson Str: sca36 has been classified as Green List (High Evidence).
Ataxia - adult onset v0.91 SCA36 Bryony Thompson STR: SCA36 was added
STR: SCA36 was added to Ataxia - adult onset. Sources: Expert list
STR tags were added to STR: SCA36.
Mode of inheritance for STR: SCA36 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA36 were set to 25101480
Phenotypes for STR: SCA36 were set to Spinocerebellar ataxia 36 MIM#614153
Review for STR: SCA36 was set to GREEN
STR: SCA36 was marked as clinically relevant
Added comment: NM_006392​.3:c.3+71GGCCTG[X]
Toxic RNA effect is suggested mechanism of disease
Normal: 3-14 repeats
Uncertain significance: 15-650 repeats
Pathogenic: ≥650 repeats
Sources: Expert list
Ataxia - adult onset v0.90 NOP56 Bryony Thompson Classified gene: NOP56 as Green List (high evidence)
Ataxia - adult onset v0.90 NOP56 Bryony Thompson Added comment: Comment on list classification: A hexanucleotide (GGCCTG) repeat expansion in the first intron of the NOP56 gene is the only reported cause of disease.
Ataxia - adult onset v0.90 NOP56 Bryony Thompson Gene: nop56 has been classified as Green List (High Evidence).
Ataxia - adult onset v0.89 NOP56 Bryony Thompson Publications for gene: NOP56 were set to
Ataxia - adult onset v0.88 NOP56 Bryony Thompson Tag STR tag was added to gene: NOP56.
Ataxia - adult onset v0.88 NOP56 Bryony Thompson Phenotypes for gene: NOP56 were changed from Spinocerebellarataxia36,614153 to Spinocerebellar ataxia 36, 614153
Mendeliome v0.3952 BCLAF1 Zornitza Stark Marked gene: BCLAF1 as ready
Mendeliome v0.3952 BCLAF1 Zornitza Stark Gene: bclaf1 has been classified as Red List (Low Evidence).
Mendeliome v0.3952 BCLAF1 Zornitza Stark Classified gene: BCLAF1 as Red List (low evidence)
Mendeliome v0.3952 BCLAF1 Zornitza Stark Gene: bclaf1 has been classified as Red List (Low Evidence).
Ataxia - adult onset v0.87 SCA12 Bryony Thompson Classified STR: SCA12 as Green List (high evidence)
Ataxia - adult onset v0.87 SCA12 Bryony Thompson Str: sca12 has been classified as Green List (High Evidence).
Ataxia - adult onset v0.86 SCA12 Bryony Thompson STR: SCA12 was added
STR: SCA12 was added to Ataxia - adult onset. Sources: Expert list
STR tags were added to STR: SCA12.
Mode of inheritance for STR: SCA12 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA12 were set to 29325606; 20301381
Phenotypes for STR: SCA12 were set to Spinocerebellar ataxia 12 MIM#604326
Review for STR: SCA12 was set to GREEN
STR: SCA12 was marked as clinically relevant
Added comment: NM_181675.3:c.27CAG[X]
Uncertain if CAG repeat encodes polyglutamine or instead effects expression of specific splice variants of the encoded phosphatase
Normal: ≤32 repeats
Reduced penetrance: ~40-66 repeats
Full penetrance: ≥66 repeats
Sources: Expert list
Mendeliome v0.3951 BCLAF1 Naomi Baker reviewed gene: BCLAF1: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Ataxia - adult onset v0.85 SCA10 Bryony Thompson Classified STR: SCA10 as Green List (high evidence)
Ataxia - adult onset v0.85 SCA10 Bryony Thompson Str: sca10 has been classified as Green List (High Evidence).
Ataxia - adult onset v0.84 SCA10 Bryony Thompson STR: SCA10 was added
STR: SCA10 was added to Ataxia - adult onset. Sources: Expert list
STR tags were added to STR: SCA10.
Mode of inheritance for STR: SCA10 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA10 were set to 20301354
Phenotypes for STR: SCA10 were set to Spinocerebellar ataxia 10 MIM#603516
STR: SCA10 was marked as clinically relevant
Added comment: NM_013236​.2:c.1430+54822ATTCT[X]
Toxic RNA gain-of-function mechanism of disease
Normal alleles: 10-32 ATTCT repeats
Alleles of questionable significance: 33-280 ATTCT repeats
Reduced-penetrance alleles: 33-850 repeats
Full-penetrance alleles: 800-4,500 ATTCT repeats
Sources: Expert list
Ataxia - adult onset v0.83 SCA8 Bryony Thompson Classified STR: SCA8 as Green List (high evidence)
Ataxia - adult onset v0.83 SCA8 Bryony Thompson Str: sca8 has been classified as Green List (High Evidence).
Ataxia - adult onset v0.82 SCA8 Bryony Thompson STR: SCA8 was added
STR: SCA8 was added to Ataxia - adult onset. Sources: Expert list
STR tags were added to STR: SCA8.
Mode of inheritance for STR: SCA8 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA8 were set to 20301445
Phenotypes for STR: SCA8 were set to Spinocerebellar ataxia 8 MIM#608768
Review for STR: SCA8 was set to GREEN
STR: SCA8 was marked as clinically relevant
Added comment: NR_002717.2:n.1073CTA[X]1103CTG[X]
ATXN8 (CAG)n(TAG)n vs ATXN8OS on opposite strand (CTA)n(CTG)n
Both toxic RNA and toxic protein gain of function mechanisms likely contribute to disease mechanism
Normal alleles: 15-50 combined (CTA·TAG)n(CTG·CAG)n repeats
Alleles of questionable significance: 50-70 repeats.
Reduced penetrance allele size: found for (CTA·TAG)n(CTG·CAG)n repeats of all sizes
Higher penetrance allele size: ≥80 (CTA·TAG)n(CTG·CAG)n repeats most often seen in individuals with ataxia; however, repeat sizes ranging from 71 to more than 1300 repeats have been found both in individuals who develop ataxia and in those who do not.
Sources: Expert list
Ataxia - adult onset v0.81 SCA17 Bryony Thompson Classified STR: SCA17 as Green List (high evidence)
Ataxia - adult onset v0.81 SCA17 Bryony Thompson Str: sca17 has been classified as Green List (High Evidence).
Ataxia - adult onset v0.80 SCA17 Bryony Thompson STR: SCA17 was added
STR: SCA17 was added to Ataxia - adult onset. Sources: Expert list
STR tags were added to STR: SCA17.
Mode of inheritance for STR: SCA17 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA17 were set to 20301611; 29325606
Phenotypes for STR: SCA17 were set to Spinocerebellar ataxia 17 MIM#607136
Review for STR: SCA17 was set to GREEN
STR: SCA17 was marked as clinically relevant
Added comment: NM_003194.4:c.172_174[X]
Mechanism of disease expected to be gain of function
Normal: ≤ 40 CAG/CAA repeats
Reduced-penetrance: 41-48 CAG/CAA repeats, individual may or may not develop symptoms.
Full-penetrance: ≥49 CAG/CAA repeats
Sources: Expert list
Arthrogryposis v0.204 MYO9A Alison Yeung Marked gene: MYO9A as ready
Arthrogryposis v0.204 MYO9A Alison Yeung Gene: myo9a has been classified as Green List (High Evidence).
Arthrogryposis v0.204 MYO9A Alison Yeung Classified gene: MYO9A as Green List (high evidence)
Arthrogryposis v0.204 MYO9A Alison Yeung Gene: myo9a has been classified as Green List (High Evidence).
Arthrogryposis v0.203 MYO9A Alison Yeung gene: MYO9A was added
gene: MYO9A was added to Arthrogryposis. Sources: Literature
Mode of inheritance for gene: MYO9A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: MYO9A were set to 26752647; 27259756
Phenotypes for gene: MYO9A were set to MYASTHENIC SYNDROME, CONGENITAL, 24 OMIM# 618198
Review for gene: MYO9A was set to GREEN
Added comment: Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2881 ALG12 Zornitza Stark Marked gene: ALG12 as ready
Intellectual disability syndromic and non-syndromic v0.2881 ALG12 Zornitza Stark Gene: alg12 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2881 ALG12 Zornitza Stark Phenotypes for gene: ALG12 were changed from to Congenital disorder of glycosylation, type Ig, MIM# 607143
Intellectual disability syndromic and non-syndromic v0.2880 ALG12 Zornitza Stark Publications for gene: ALG12 were set to
Intellectual disability syndromic and non-syndromic v0.2879 ALG12 Zornitza Stark Mode of inheritance for gene: ALG12 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2878 ALG12 Zornitza Stark reviewed gene: ALG12: Rating: GREEN; Mode of pathogenicity: None; Publications: 31481313; Phenotypes: Congenital disorder of glycosylation, type Ig, MIM# 607143; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3951 ALG12 Zornitza Stark Marked gene: ALG12 as ready
Mendeliome v0.3951 ALG12 Zornitza Stark Gene: alg12 has been classified as Green List (High Evidence).
Mendeliome v0.3951 ALG12 Zornitza Stark Phenotypes for gene: ALG12 were changed from to Congenital disorder of glycosylation, type Ig, MIM# 607143
Ataxia - adult onset v0.79 SCA7 Bryony Thompson Classified STR: SCA7 as Green List (high evidence)
Ataxia - adult onset v0.79 SCA7 Bryony Thompson Str: sca7 has been classified as Green List (High Evidence).
Ataxia - adult onset v0.78 SCA7 Bryony Thompson STR: SCA7 was added
STR: SCA7 was added to Ataxia - adult onset. Sources: Expert list
STR tags were added to STR: SCA7.
Mode of inheritance for STR: SCA7 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA7 were set to 29325606; 20301433
Phenotypes for STR: SCA7 were set to Spinocerebellar ataxia 7 MIM#164500
Review for STR: SCA7 was set to GREEN
STR: SCA7 was marked as clinically relevant
Added comment: NM_000333​.3:c.89_91AGC[X]
Gain of function mechanism of disease
Normal: ≤27 repeats
Mutable normal: 28-33 repeats, meiotically unstable, but not associated with an abnormal phenotype.
Pathogenic reduced penetrance: 34-36 repeats, when manifestations occur, they are more likely to be later onset and milder than average
Pathogenic full penetrance: 37-460 repeats
Sources: Expert list
Mendeliome v0.3950 SEC61A1 Zornitza Stark Marked gene: SEC61A1 as ready
Mendeliome v0.3950 SEC61A1 Zornitza Stark Gene: sec61a1 has been classified as Green List (High Evidence).
Mendeliome v0.3950 SEC61A1 Zornitza Stark Phenotypes for gene: SEC61A1 were changed from to Hyperuricemic nephropathy, familial juvenile, 4, MIM# 617056; Hypogammaglobulinaemia; Neutropaenia
Mendeliome v0.3949 SEC61A1 Zornitza Stark Publications for gene: SEC61A1 were set to
Mendeliome v0.3948 SEC61A1 Zornitza Stark Mode of inheritance for gene: SEC61A1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3947 SEC61A1 Zornitza Stark reviewed gene: SEC61A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27392076, 32325141, 28782633; Phenotypes: Hyperuricemic nephropathy, familial juvenile, 4, MIM# 617056, Hypogammaglobulinaemia, Neutropaenia; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Renal Tubulointerstitial Disease v0.25 SEC61A1 Zornitza Stark Marked gene: SEC61A1 as ready
Renal Tubulointerstitial Disease v0.25 SEC61A1 Zornitza Stark Gene: sec61a1 has been classified as Green List (High Evidence).
Renal Tubulointerstitial Disease v0.25 SEC61A1 Zornitza Stark Phenotypes for gene: SEC61A1 were changed from to Hyperuricemic nephropathy, familial juvenile, 4, MIM# 617056
Renal Tubulointerstitial Disease v0.24 SEC61A1 Zornitza Stark Publications for gene: SEC61A1 were set to
Renal Tubulointerstitial Disease v0.23 SEC61A1 Zornitza Stark Mode of inheritance for gene: SEC61A1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Renal Tubulointerstitial Disease v0.22 SEC61A1 Zornitza Stark reviewed gene: SEC61A1: Rating: GREEN; Mode of pathogenicity: None; Publications: 27392076; Phenotypes: Hyperuricemic nephropathy, familial juvenile, 4, MIM# 617056; Mode of inheritance: None
Mendeliome v0.3947 ALG12 Zornitza Stark Publications for gene: ALG12 were set to
Mendeliome v0.3946 ALG12 Zornitza Stark Mode of inheritance for gene: ALG12 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3945 ALG12 Zornitza Stark reviewed gene: ALG12: Rating: GREEN; Mode of pathogenicity: None; Publications: 31481313; Phenotypes: Congenital disorder of glycosylation, type Ig, MIM# 607143; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Congenital Disorders of Glycosylation v0.160 ALG12 Zornitza Stark Marked gene: ALG12 as ready
Congenital Disorders of Glycosylation v0.160 ALG12 Zornitza Stark Gene: alg12 has been classified as Green List (High Evidence).
Congenital Disorders of Glycosylation v0.160 ALG12 Zornitza Stark Phenotypes for gene: ALG12 were changed from to Congenital disorder of glycosylation, type Ig 607143
Congenital Disorders of Glycosylation v0.159 ALG12 Zornitza Stark Publications for gene: ALG12 were set to
Congenital Disorders of Glycosylation v0.158 ALG12 Zornitza Stark Mode of inheritance for gene: ALG12 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2878 ALG11 Zornitza Stark Marked gene: ALG11 as ready
Intellectual disability syndromic and non-syndromic v0.2878 ALG11 Zornitza Stark Gene: alg11 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2878 ALG11 Zornitza Stark Phenotypes for gene: ALG11 were changed from to Congenital disorder of glycosylation, type Ip, MIM# 613661
Intellectual disability syndromic and non-syndromic v0.2877 ALG11 Zornitza Stark Publications for gene: ALG11 were set to
Renal Macrocystic Disease v0.37 ALG9 Zornitza Stark changed review comment from: Two individuals with mono-allelic variants reported with polycystic kidney disease, and ALG9 LOF variants over-represented in a population-based cohort. However, penetrance and expressivity seem variable, and also it is unclear whether parents of children affected by the AR CDG have renal cysts. Bi-allelic variants cause CDG: kidney cysts reported as part of phenotype but note this is generally a severe multi-system disorder.
Sources: Literature; to: Two individuals with mono-allelic variants reported with polycystic kidney disease, and ALG9 LOF variants over-represented in a population-based cohort. However, penetrance and expressivity seem variable, and also it is unclear whether parents of children affected by the AR CDG have renal cysts. Bi-allelic variants cause CDG: kidney cysts reported as part of phenotype but note this is generally a severe multi-system disorder. It is unclear at present whether the mechanism is the same for both. It may be that bi-allelic LOF is perinatal lethal, hence CDG carriers for missense variants are less likely to manifest renal cysts.
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2876 ALG11 Zornitza Stark Mode of inheritance for gene: ALG11 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2875 ALG11 Zornitza Stark reviewed gene: ALG11: Rating: GREEN; Mode of pathogenicity: None; Publications: 30676690; Phenotypes: Congenital disorder of glycosylation, type Ip, MIM# 613661; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Genetic Epilepsy v0.804 ALG11 Zornitza Stark Marked gene: ALG11 as ready
Genetic Epilepsy v0.804 ALG11 Zornitza Stark Gene: alg11 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.804 ALG11 Zornitza Stark Phenotypes for gene: ALG11 were changed from to Congenital disorder of glycosylation, type Ip, MIM# 613661
Genetic Epilepsy v0.803 ALG11 Zornitza Stark Publications for gene: ALG11 were set to
Genetic Epilepsy v0.802 ALG11 Zornitza Stark Mode of inheritance for gene: ALG11 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Genetic Epilepsy v0.801 ALG11 Zornitza Stark reviewed gene: ALG11: Rating: GREEN; Mode of pathogenicity: None; Publications: 30676690; Phenotypes: Congenital disorder of glycosylation, type Ip, MIM# 613661; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3945 ALG11 Zornitza Stark Marked gene: ALG11 as ready
Mendeliome v0.3945 ALG11 Zornitza Stark Gene: alg11 has been classified as Green List (High Evidence).
Mendeliome v0.3945 ALG11 Zornitza Stark Phenotypes for gene: ALG11 were changed from to Congenital disorder of glycosylation, type Ip, MIM# 613661
Renal Macrocystic Disease v0.37 ALG9 Zornitza Stark edited their review of gene: ALG9: Added comment: Additional individual reported in PMID 30676690 as part of a large cohort.; Changed publications: 31395617, 32398770; Changed phenotypes: Congenital disorder of glycosylation, type Il, MIM# 608776, Gillessen-Kaesbach-Nishimura syndrome, MIM#263210, Polycystic kidney disease
Mendeliome v0.3944 ALG11 Zornitza Stark Publications for gene: ALG11 were set to
Mendeliome v0.3943 ALG11 Zornitza Stark Mode of inheritance for gene: ALG11 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3942 ALG11 Zornitza Stark reviewed gene: ALG11: Rating: GREEN; Mode of pathogenicity: None; Publications: 30676690; Phenotypes: Congenital disorder of glycosylation, type Ip, MIM# 613661; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Congenital Disorders of Glycosylation v0.157 ALG11 Zornitza Stark Marked gene: ALG11 as ready
Congenital Disorders of Glycosylation v0.157 ALG11 Zornitza Stark Gene: alg11 has been classified as Green List (High Evidence).
Congenital Disorders of Glycosylation v0.157 ALG11 Zornitza Stark Phenotypes for gene: ALG11 were changed from to Congenital disorder of glycosylation, type Ip, MIM# 613661
Congenital Disorders of Glycosylation v0.156 ALG11 Zornitza Stark Publications for gene: ALG11 were set to
Congenital Disorders of Glycosylation v0.155 ALG11 Zornitza Stark Mode of inheritance for gene: ALG11 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Congenital Disorders of Glycosylation v0.154 ALG1 Zornitza Stark Marked gene: ALG1 as ready
Congenital Disorders of Glycosylation v0.154 ALG1 Zornitza Stark Gene: alg1 has been classified as Green List (High Evidence).
Congenital Disorders of Glycosylation v0.154 ALG1 Zornitza Stark Phenotypes for gene: ALG1 were changed from to Congenital disorder of glycosylation, type Ik 608540
Congenital Disorders of Glycosylation v0.153 ALG1 Zornitza Stark Publications for gene: ALG1 were set to
Congenital Disorders of Glycosylation v0.152 ALG1 Zornitza Stark Mode of inheritance for gene: ALG1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.70 KATNB1 Zornitza Stark Marked gene: KATNB1 as ready
Lissencephaly and Band Heterotopia v0.70 KATNB1 Zornitza Stark Gene: katnb1 has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.70 TUBGCP2 Zornitza Stark Marked gene: TUBGCP2 as ready
Lissencephaly and Band Heterotopia v0.70 TUBGCP2 Zornitza Stark Gene: tubgcp2 has been classified as Green List (High Evidence).
Polymicrogyria and Schizencephaly v0.137 L1CAM Zornitza Stark Marked gene: L1CAM as ready
Polymicrogyria and Schizencephaly v0.137 L1CAM Zornitza Stark Gene: l1cam has been classified as Amber List (Moderate Evidence).
Polymicrogyria and Schizencephaly v0.137 L1CAM Zornitza Stark Phenotypes for gene: L1CAM were changed from to L1CAM-related disease
Polymicrogyria and Schizencephaly v0.136 L1CAM Zornitza Stark Publications for gene: L1CAM were set to
Polymicrogyria and Schizencephaly v0.135 L1CAM Zornitza Stark Mode of inheritance for gene: L1CAM was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Polymicrogyria and Schizencephaly v0.134 L1CAM Zornitza Stark Classified gene: L1CAM as Amber List (moderate evidence)
Polymicrogyria and Schizencephaly v0.134 L1CAM Zornitza Stark Gene: l1cam has been classified as Amber List (Moderate Evidence).
Polymicrogyria and Schizencephaly v0.133 RAB3GAP2 Zornitza Stark Marked gene: RAB3GAP2 as ready
Polymicrogyria and Schizencephaly v0.133 RAB3GAP2 Zornitza Stark Gene: rab3gap2 has been classified as Green List (High Evidence).
Polymicrogyria and Schizencephaly v0.133 RAB3GAP2 Zornitza Stark Phenotypes for gene: RAB3GAP2 were changed from to Warburg micro syndrome 2 614225
Polymicrogyria and Schizencephaly v0.132 RAB3GAP2 Zornitza Stark Publications for gene: RAB3GAP2 were set to
Polymicrogyria and Schizencephaly v0.131 RAB3GAP2 Zornitza Stark Mode of inheritance for gene: RAB3GAP2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Polymicrogyria and Schizencephaly v0.130 TUBA8 Zornitza Stark Marked gene: TUBA8 as ready
Polymicrogyria and Schizencephaly v0.130 TUBA8 Zornitza Stark Gene: tuba8 has been classified as Red List (Low Evidence).
Polymicrogyria and Schizencephaly v0.130 PEX16 Zornitza Stark Marked gene: PEX16 as ready
Polymicrogyria and Schizencephaly v0.130 PEX16 Zornitza Stark Gene: pex16 has been classified as Amber List (Moderate Evidence).
Polymicrogyria and Schizencephaly v0.130 PEX16 Zornitza Stark Classified gene: PEX16 as Amber List (moderate evidence)
Polymicrogyria and Schizencephaly v0.130 PEX16 Zornitza Stark Gene: pex16 has been classified as Amber List (Moderate Evidence).
Polymicrogyria and Schizencephaly v0.129 PEX14 Zornitza Stark Marked gene: PEX14 as ready
Polymicrogyria and Schizencephaly v0.129 PEX14 Zornitza Stark Gene: pex14 has been classified as Amber List (Moderate Evidence).
Polymicrogyria and Schizencephaly v0.129 PEX14 Zornitza Stark Classified gene: PEX14 as Amber List (moderate evidence)
Polymicrogyria and Schizencephaly v0.129 PEX14 Zornitza Stark Gene: pex14 has been classified as Amber List (Moderate Evidence).
Polymicrogyria and Schizencephaly v0.128 PEX13 Zornitza Stark Marked gene: PEX13 as ready
Polymicrogyria and Schizencephaly v0.128 PEX13 Zornitza Stark Gene: pex13 has been classified as Amber List (Moderate Evidence).
Polymicrogyria and Schizencephaly v0.128 PEX13 Zornitza Stark Classified gene: PEX13 as Amber List (moderate evidence)
Polymicrogyria and Schizencephaly v0.128 PEX13 Zornitza Stark Gene: pex13 has been classified as Amber List (Moderate Evidence).
Polymicrogyria and Schizencephaly v0.127 PEX12 Zornitza Stark Marked gene: PEX12 as ready
Polymicrogyria and Schizencephaly v0.127 PEX12 Zornitza Stark Gene: pex12 has been classified as Amber List (Moderate Evidence).
Polymicrogyria and Schizencephaly v0.127 PEX12 Zornitza Stark Classified gene: PEX12 as Amber List (moderate evidence)
Polymicrogyria and Schizencephaly v0.127 PEX12 Zornitza Stark Gene: pex12 has been classified as Amber List (Moderate Evidence).
Congenital Disorders of Glycosylation v0.151 ALG14 Sarah Donoghue reviewed gene: ALG14: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 30221345, PMID: 28733338, PMID: 23404334; Phenotypes: Intellectual disability, epilepsy, dysmorphic features, myasthenia, hypotonia, cerebral atrophy, contractures, congenital myasthenia; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Polymicrogyria and Schizencephaly v0.126 PEX19 Zornitza Stark Marked gene: PEX19 as ready
Polymicrogyria and Schizencephaly v0.126 PEX19 Zornitza Stark Gene: pex19 has been classified as Amber List (Moderate Evidence).
Polymicrogyria and Schizencephaly v0.126 PEX19 Zornitza Stark Classified gene: PEX19 as Amber List (moderate evidence)
Polymicrogyria and Schizencephaly v0.126 PEX19 Zornitza Stark Gene: pex19 has been classified as Amber List (Moderate Evidence).
Congenital Disorders of Glycosylation v0.151 ALG12 Sarah Donoghue edited their review of gene: ALG12: Added comment: Usually type I CDG pattern; Changed phenotypes: Dysmorphic features, Psychomotor delay, Seizures, Ocular abnormalities, Sensorineural hearing loss, Hypotonia, Failure to thrive/short stature, Cardiac Abnormalities, Genitourinary abnormalities, Recurrent infections, Hypogammaglobulinaemia, Coagulation abnormalities, Abnormal liver enzymes, Lipid abnormalities, Abnormal transferrin IEF, Abnormal brain imaging, Microcephaly, Skeletal malformations
Congenital Disorders of Glycosylation v0.151 ALG12 Sarah Donoghue reviewed gene: ALG12: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 31481313; Phenotypes: Dysmorphic features, Psychomotor delay, Seizures, Ocular abnormalities, Sensorineural hearing loss, Hypotonia, Failure to thrive/short stature, Cardiac Abnormalities, Genitourinary abnormalities, Recurrent infections, Hypogammaglobulinaemia, Coagulation abnormalities, Abnormal liver enzymes; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Congenital Disorders of Glycosylation v0.151 ALG11 Sarah Donoghue reviewed gene: ALG11: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 30676690; Phenotypes: Developmental disability, Epilepsy, Dysmorphic features, Microcephaly, Hypotonia, Hypertonia, Hyperreflexia, Sensorineural deafness, Eye/Visual Problems, Feeding problems; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Congenital Disorders of Glycosylation v0.151 ALG1 Sarah Donoghue reviewed gene: ALG1: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 26931382; Phenotypes: Developmental delay, Intellectual disability, Hypotonia, Seizure/Epilepsy, Visual Involvement, Microcephaly, Abnormal Brain Imaging, Facial Dysmorphism, Haematological, Gastrointestinal, Skeletal Abnormalities, Hypoalbuminaemia, Recurrent infections, Liver dysfunction, Cardiac Abnormalities, Renal Abnormalities; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Mendeliome v0.3942 NPRL2 Zornitza Stark Marked gene: NPRL2 as ready
Mendeliome v0.3942 NPRL2 Zornitza Stark Gene: nprl2 has been classified as Green List (High Evidence).
Mendeliome v0.3942 NPRL2 Zornitza Stark Phenotypes for gene: NPRL2 were changed from to Epilepsy, familial focal, with variable foci 2, MIM# 617116; focal seizures; frontal lobe epilepsy; nocturnal frontal lobe epilepsy; temporal lobe epilepsy; focal cortical dysplasia
Mendeliome v0.3941 NPRL2 Zornitza Stark Publications for gene: NPRL2 were set to
Mendeliome v0.3940 NPRL2 Zornitza Stark Mode of inheritance for gene: NPRL2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Polymicrogyria and Schizencephaly v0.125 PEX13 Ain Roesley gene: PEX13 was added
gene: PEX13 was added to Polymicrogyria and Schizencephaly. Sources: Literature
Mode of inheritance for gene: PEX13 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PEX13 were set to 21031596; 19449432
Phenotypes for gene: PEX13 were set to Peroxisome biogenesis disorder 11A (Zellweger) (MIM#614883)
Penetrance for gene: PEX13 were set to unknown
Review for gene: PEX13 was set to AMBER
Added comment: Accounts for ~1.5% of Zellweger Spectrum Disorder (ZSD) (GeneReviews), for which Polymicrogyria is a feature

PMID: 19449432;
- 1x ZSD proband with PMG
Sources: Literature
Polymicrogyria and Schizencephaly v0.125 PEX14 Paul De Fazio gene: PEX14 was added
gene: PEX14 was added to Polymicrogyria and Schizencephaly. Sources: Literature
Mode of inheritance for gene: PEX14 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PEX14 were set to 21031596; 18285423; 15146459; 30224891
Phenotypes for gene: PEX14 were set to Peroxisome biogenesis disorder 8A (Zellweger) MIM#614876
Review for gene: PEX14 was set to AMBER
gene: PEX14 was marked as current diagnostic
Added comment: Accounts for ~0.5% of Zellweger Spectrum Disorder (GeneReviews https://www.ncbi.nlm.nih.gov/books/NBK1448/). At least 3 independent patients have been reported with a homozygous nonsense variant, a rare missense variant, and a whole-exon deletion (PMID: 18285423, 15146459, 30224891) so gene-disease association is established.

Reports of patients with polymicrogyria specifically were not identified, but as Zellweger has the potential to present with polymicrogyria this gene has been rated Amber.
Sources: Literature
Polymicrogyria and Schizencephaly v0.125 PEX12 Ain Roesley gene: PEX12 was added
gene: PEX12 was added to Polymicrogyria and Schizencephaly. Sources: Literature
Mode of inheritance for gene: PEX12 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PEX12 were set to 21031596
Phenotypes for gene: PEX12 were set to Peroxisome biogenesis disorder 3A (Zellweger) (MIM#614859)
Penetrance for gene: PEX12 were set to unknown
Review for gene: PEX12 was set to AMBER
Added comment: Accounts for ~7.6% of Zellweger Spectrum Disorder (ZSD) (GeneReviews), for which Polymicrogyria is a feature
Sources: Literature
Polymicrogyria and Schizencephaly v0.125 PEX11B Zornitza Stark Marked gene: PEX11B as ready
Polymicrogyria and Schizencephaly v0.125 PEX11B Zornitza Stark Added comment: Comment when marking as ready: Aware of another family tested through our service, but agree gene-disease association limited, and no specific reports of PMG.
Polymicrogyria and Schizencephaly v0.125 PEX11B Zornitza Stark Gene: pex11b has been classified as Red List (Low Evidence).
Polymicrogyria and Schizencephaly v0.125 PEX16 Paul De Fazio gene: PEX16 was added
gene: PEX16 was added to Polymicrogyria and Schizencephaly. Sources: Literature
Mode of inheritance for gene: PEX16 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PEX16 were set to 21031596
Phenotypes for gene: PEX16 were set to Peroxisome biogenesis disorder 8A (Zellweger) MIM#614876
Review for gene: PEX16 was set to AMBER
gene: PEX16 was marked as current diagnostic
Added comment: Accounts for ~1.1% of Zellweger Spectrum Disorder (GeneReviews https://www.ncbi.nlm.nih.gov/books/NBK1448/). Reports of patients with polymicrogyria specifically were not identified, but as Zellweger has the potential to present with polymicrogyria this gene has been rated Amber.
Sources: Literature
Polymicrogyria and Schizencephaly v0.125 PEX11B Zornitza Stark Classified gene: PEX11B as Red List (low evidence)
Polymicrogyria and Schizencephaly v0.125 PEX11B Zornitza Stark Gene: pex11b has been classified as Red List (Low Evidence).
Polymicrogyria and Schizencephaly v0.124 PEX10 Zornitza Stark Marked gene: PEX10 as ready
Polymicrogyria and Schizencephaly v0.124 PEX10 Zornitza Stark Gene: pex10 has been classified as Amber List (Moderate Evidence).
Polymicrogyria and Schizencephaly v0.124 PEX10 Zornitza Stark Classified gene: PEX10 as Amber List (moderate evidence)
Polymicrogyria and Schizencephaly v0.124 PEX10 Zornitza Stark Gene: pex10 has been classified as Amber List (Moderate Evidence).
Polymicrogyria and Schizencephaly v0.123 PEX2 Zornitza Stark Marked gene: PEX2 as ready
Polymicrogyria and Schizencephaly v0.123 PEX2 Zornitza Stark Gene: pex2 has been classified as Amber List (Moderate Evidence).
Polymicrogyria and Schizencephaly v0.123 PEX2 Zornitza Stark Classified gene: PEX2 as Amber List (moderate evidence)
Polymicrogyria and Schizencephaly v0.123 PEX2 Zornitza Stark Gene: pex2 has been classified as Amber List (Moderate Evidence).
Polymicrogyria and Schizencephaly v0.122 PEX26 Zornitza Stark Marked gene: PEX26 as ready
Polymicrogyria and Schizencephaly v0.122 PEX26 Zornitza Stark Gene: pex26 has been classified as Amber List (Moderate Evidence).
Polymicrogyria and Schizencephaly v0.122 PEX26 Zornitza Stark Classified gene: PEX26 as Amber List (moderate evidence)
Polymicrogyria and Schizencephaly v0.122 PEX26 Zornitza Stark Gene: pex26 has been classified as Amber List (Moderate Evidence).
Polymicrogyria and Schizencephaly v0.121 PEX19 Paul De Fazio gene: PEX19 was added
gene: PEX19 was added to Polymicrogyria and Schizencephaly. Sources: Literature
Mode of inheritance for gene: PEX19 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PEX19 were set to 21031596
Phenotypes for gene: PEX19 were set to Peroxisome biogenesis disorder 12A (Zellweger) MIM#614886
Review for gene: PEX19 was set to AMBER
gene: PEX19 was marked as current diagnostic
Added comment: Accounts for ~0.6% of Zellweger Spectrum Disorder (GeneReviews https://www.ncbi.nlm.nih.gov/books/NBK1448/). Reports of patients with polymicrogyria specifically were not identified, but as Zellweger has the potential to present with polymicrogyria this gene has been rated Amber.
Sources: Literature
Polymicrogyria and Schizencephaly v0.121 PEX3 Zornitza Stark Marked gene: PEX3 as ready
Polymicrogyria and Schizencephaly v0.121 PEX3 Zornitza Stark Gene: pex3 has been classified as Amber List (Moderate Evidence).
Polymicrogyria and Schizencephaly v0.121 PEX3 Zornitza Stark Classified gene: PEX3 as Amber List (moderate evidence)
Polymicrogyria and Schizencephaly v0.121 PEX3 Zornitza Stark Gene: pex3 has been classified as Amber List (Moderate Evidence).
Polymicrogyria and Schizencephaly v0.120 PEX11B Ain Roesley gene: PEX11B was added
gene: PEX11B was added to Polymicrogyria and Schizencephaly. Sources: Literature
Mode of inheritance for gene: PEX11B was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PEX11B were set to 22581968
Phenotypes for gene: PEX11B were set to ?Peroxisome biogenesis disorder 14B (MIM#614920)
Penetrance for gene: PEX11B were set to unknown
Review for gene: PEX11B was set to RED
Added comment: Accounts for ~0.1% of Zellweger Spectrum Disorder (ZSD) (GeneReviews), for which Polymicrogyria is a feature

PMID: 22581968;
Sinlge patient reported
Sources: Literature
Polymicrogyria and Schizencephaly v0.120 PEX10 Ain Roesley gene: PEX10 was added
gene: PEX10 was added to Polymicrogyria and Schizencephaly. Sources: Literature
Mode of inheritance for gene: PEX10 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PEX10 were set to 21031596
Phenotypes for gene: PEX10 were set to Peroxisome biogenesis disorder 6A (Zellweger) (MIM#614870)
Penetrance for gene: PEX10 were set to unknown
Review for gene: PEX10 was set to AMBER
Added comment: Accounts for ~3.4% of Zellweger Spectrum Disorder (ZSD) (GeneReviews), for which Polymicrogyria is a feature
Sources: Literature
Polymicrogyria and Schizencephaly v0.120 PEX2 Paul De Fazio gene: PEX2 was added
gene: PEX2 was added to Polymicrogyria and Schizencephaly. Sources: Literature
Mode of inheritance for gene: PEX2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PEX2 were set to 21031596
Phenotypes for gene: PEX2 were set to Peroxisome biogenesis disorder 5A (Zellweger) MIM#614866
Review for gene: PEX2 was set to AMBER
gene: PEX2 was marked as current diagnostic
Added comment: Accounts for ~3.1% of Zellweger Spectrum Disorder (GeneReviews https://www.ncbi.nlm.nih.gov/books/NBK1448/). Reports of patients with polymicrogyria specifically were not identified, but as Zellweger has the potential to present with polymicrogyria this gene has been rated Amber.
Sources: Literature
Polymicrogyria and Schizencephaly v0.120 PEX26 Paul De Fazio gene: PEX26 was added
gene: PEX26 was added to Polymicrogyria and Schizencephaly. Sources: Literature
Mode of inheritance for gene: PEX26 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PEX26 were set to 21031596
Phenotypes for gene: PEX26 were set to Peroxisome biogenesis disorder 7A (Zellweger) MIM#614872
Review for gene: PEX26 was set to AMBER
gene: PEX26 was marked as current diagnostic
Added comment: Accounts for ~4.2% of Zellweger Spectrum Disorder (GeneReviews https://www.ncbi.nlm.nih.gov/books/NBK1448/). Reports of patients with polymicrogyria specifically were not identified, but as Zellweger has the potential to present with polymicrogyria this gene has been rated Amber.
Sources: Literature
Polymicrogyria and Schizencephaly v0.120 PEX3 Paul De Fazio edited their review of gene: PEX3: Changed rating: AMBER; Changed phenotypes: Peroxisome biogenesis disorder 10A (Zellweger) 614882
Polymicrogyria and Schizencephaly v0.120 PEX3 Paul De Fazio gene: PEX3 was added
gene: PEX3 was added to Polymicrogyria and Schizencephaly. Sources: Literature
Mode of inheritance for gene: PEX3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PEX3 were set to 21031596
Phenotypes for gene: PEX3 were set to Peroxisome biogenesis disorder 10A (Zellweger) 614882
gene: PEX3 was marked as current diagnostic
Added comment: Accounts for ~0.7% of Zellweger Spectrum Disorder (GeneReviews https://www.ncbi.nlm.nih.gov/books/NBK1448/). Reports of patients with polymicrogyria specifically were not identified, but as Zellweger has the potential to present with polymicrogyria this gene has been rated Amber.
Sources: Literature
Polymicrogyria and Schizencephaly v0.120 PEX1 Zornitza Stark Marked gene: PEX1 as ready
Polymicrogyria and Schizencephaly v0.120 PEX1 Zornitza Stark Gene: pex1 has been classified as Green List (High Evidence).
Polymicrogyria and Schizencephaly v0.120 PEX1 Zornitza Stark Classified gene: PEX1 as Green List (high evidence)
Polymicrogyria and Schizencephaly v0.120 PEX1 Zornitza Stark Gene: pex1 has been classified as Green List (High Evidence).
Polymicrogyria and Schizencephaly v0.119 PEX5 Zornitza Stark Marked gene: PEX5 as ready
Polymicrogyria and Schizencephaly v0.119 PEX5 Zornitza Stark Gene: pex5 has been classified as Amber List (Moderate Evidence).
Polymicrogyria and Schizencephaly v0.119 PEX5 Zornitza Stark Classified gene: PEX5 as Amber List (moderate evidence)
Polymicrogyria and Schizencephaly v0.119 PEX5 Zornitza Stark Gene: pex5 has been classified as Amber List (Moderate Evidence).
Polymicrogyria and Schizencephaly v0.118 PEX1 Ain Roesley gene: PEX1 was added
gene: PEX1 was added to Polymicrogyria and Schizencephaly. Sources: Literature
Mode of inheritance for gene: PEX1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PEX1 were set to 21031596
Phenotypes for gene: PEX1 were set to Peroxisome biogenesis disorder 1A (Zellweger) (MIM#214100)
Penetrance for gene: PEX1 were set to unknown
Review for gene: PEX1 was set to GREEN
Added comment: Accounts for ~60.5% of Zellweger Spectrum Disorder (ZSD) (GeneReviews), for which Polymicrogyria is a feature
Sources: Literature
Polymicrogyria and Schizencephaly v0.118 PEX5 Paul De Fazio gene: PEX5 was added
gene: PEX5 was added to Polymicrogyria and Schizencephaly. Sources: Literature
Mode of inheritance for gene: PEX5 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PEX5 were set to 21031596
Phenotypes for gene: PEX5 were set to Peroxisome biogenesis disorder 2A (Zellweger) (MIM#214110)
Review for gene: PEX5 was set to AMBER
gene: PEX5 was marked as current diagnostic
Added comment: Accounts for ~2% of Zellweger Spectrum Disorder (GeneReviews https://www.ncbi.nlm.nih.gov/books/NBK1448/). Reports of patients with polymicrogyria specifically were not identified, but as Zellweger has the potential to present with polymicrogyria this gene has been rated Amber.
Sources: Literature
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.23 STRADA Seb Lunke Marked gene: STRADA as ready
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.23 STRADA Seb Lunke Gene: strada has been classified as Amber List (Moderate Evidence).
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.23 STRADA Seb Lunke Publications for gene: STRADA were set to
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.22 STRADA Seb Lunke Mode of inheritance for gene: STRADA was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.21 STRADA Seb Lunke Classified gene: STRADA as Amber List (moderate evidence)
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.21 STRADA Seb Lunke Added comment: Comment on list classification: megalencephaly link well established, but no conclusive evidence of hemi-megalencephaly
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.21 STRADA Seb Lunke Gene: strada has been classified as Amber List (Moderate Evidence).
Polymicrogyria and Schizencephaly v0.118 SHH Zornitza Stark Marked gene: SHH as ready
Polymicrogyria and Schizencephaly v0.118 SHH Zornitza Stark Gene: shh has been classified as Red List (Low Evidence).
Polymicrogyria and Schizencephaly v0.118 SHH Zornitza Stark Tag disputed tag was added to gene: SHH.
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.20 NPRL3 Zornitza Stark Marked gene: NPRL3 as ready
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.20 NPRL3 Zornitza Stark Gene: nprl3 has been classified as Green List (High Evidence).
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.20 NPRL3 Zornitza Stark Phenotypes for gene: NPRL3 were changed from to Epilepsy, familial focal, with variable foci 3 (MIM#617118)
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.19 NPRL3 Zornitza Stark Publications for gene: NPRL3 were set to
Polymicrogyria and Schizencephaly v0.118 SHH Zornitza Stark Phenotypes for gene: SHH were changed from to Schizencephaly (MIM#269160)
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.18 NPRL3 Zornitza Stark Mode of inheritance for gene: NPRL3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.17 STRADA Paul De Fazio edited their review of gene: STRADA: Changed rating: GREEN
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.17 STRADA Paul De Fazio changed review comment from: Associated with PMSE (Polyhydramnios, megalencephaly, and symptomatic epilepsy). Link to TSC seems tenuous and is limited to the authors of PMID: 17522105 citing similarities to TSC in histological findings in an individual with biallelic STRADA deletions, and the fact that this gene is implicated in the mTORC pathway.

This gene is an upstream inhibitor of mTORC1. Treatment with rapamycin reduces seizures in a mouse model (PMID: 23616120).; to: Associated with PMSE (Polyhydramnios, megalencephaly, and symptomatic epilepsy). Link to TSC seems tenuous and is limited to the authors of PMID: 17522105 citing similarities to TSC in histological findings in an individual with biallelic STRADA deletions, and the fact that this gene is implicated in the mTORC pathway. However megalencephaly is a common characteristic in almost all patients (summarised in PMID: 27170158). Reported patients include 7 distantly-related Mennonite children with the same 7kb deletion, plus two other separate unrelated individuals.

This gene is an upstream inhibitor of mTORC1. Treatment with rapamycin reduces seizures in a mouse model (PMID: 23616120).
Polymicrogyria and Schizencephaly v0.117 PEX6 Seb Lunke Marked gene: PEX6 as ready
Polymicrogyria and Schizencephaly v0.117 PEX6 Seb Lunke Gene: pex6 has been classified as Green List (High Evidence).
Polymicrogyria and Schizencephaly v0.117 PEX6 Seb Lunke Classified gene: PEX6 as Green List (high evidence)
Polymicrogyria and Schizencephaly v0.117 PEX6 Seb Lunke Gene: pex6 has been classified as Green List (High Evidence).
Polymicrogyria and Schizencephaly v0.116 SHH Zornitza Stark Publications for gene: SHH were set to
Polymicrogyria and Schizencephaly v0.115 SHH Zornitza Stark Mode of inheritance for gene: SHH was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Polymicrogyria and Schizencephaly v0.114 SIX3 Seb Lunke Marked gene: SIX3 as ready
Polymicrogyria and Schizencephaly v0.114 SIX3 Seb Lunke Gene: six3 has been classified as Red List (Low Evidence).
Polymicrogyria and Schizencephaly v0.114 SIX3 Seb Lunke Mode of inheritance for gene: SIX3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Polymicrogyria and Schizencephaly v0.113 SIX3 Seb Lunke Publications for gene: SIX3 were set to
Polymicrogyria and Schizencephaly v0.113 SHH Zornitza Stark Classified gene: SHH as Red List (low evidence)
Polymicrogyria and Schizencephaly v0.113 SHH Zornitza Stark Gene: shh has been classified as Red List (Low Evidence).
Polymicrogyria and Schizencephaly v0.112 SHH Zornitza Stark Classified gene: SHH as Red List (low evidence)
Polymicrogyria and Schizencephaly v0.112 SHH Zornitza Stark Gene: shh has been classified as Red List (Low Evidence).
Polymicrogyria and Schizencephaly v0.112 SIX3 Seb Lunke Classified gene: SIX3 as Red List (low evidence)
Polymicrogyria and Schizencephaly v0.112 SIX3 Seb Lunke Added comment: Comment on list classification: Missense variants too common in gnomAD. Left with one novel nonsense, insufficient evidence for association with schizencephaly at this stage.
Polymicrogyria and Schizencephaly v0.112 SIX3 Seb Lunke Gene: six3 has been classified as Red List (Low Evidence).
Mendeliome v0.3939 NPRL2 Dean Phelan reviewed gene: NPRL2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 26505888, 27173016, 28199897, 31594065; Phenotypes: focal seizures, frontal lobe epilepsy, nocturnal frontal lobe epilepsy, temporal lobe epilepsy, focal cortical dysplasia; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Genetic Epilepsy v0.801 NPRL2 Zornitza Stark Marked gene: NPRL2 as ready
Genetic Epilepsy v0.801 NPRL2 Zornitza Stark Gene: nprl2 has been classified as Green List (High Evidence).
Genetic Epilepsy v0.801 NPRL2 Zornitza Stark Phenotypes for gene: NPRL2 were changed from to Epilepsy, familial focal, with variable foci 2 617116; focal seizures; frontal lobe epilepsy; nocturnal frontal lobe epilepsy; temporal lobe epilepsy; focal cortical dysplasia
Genetic Epilepsy v0.800 NPRL2 Zornitza Stark Publications for gene: NPRL2 were set to
Genetic Epilepsy v0.799 NPRL2 Zornitza Stark Mode of inheritance for gene: NPRL2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.17 NPRL2 Zornitza Stark Marked gene: NPRL2 as ready
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.17 NPRL2 Zornitza Stark Gene: nprl2 has been classified as Amber List (Moderate Evidence).
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.17 NPRL2 Zornitza Stark Phenotypes for gene: NPRL2 were changed from to Focal epilepsy; Focal cortical dysplasia
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.16 NPRL2 Zornitza Stark Publications for gene: NPRL2 were set to
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.15 NPRL2 Zornitza Stark Mode of inheritance for gene: NPRL2 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.14 NPRL2 Zornitza Stark Classified gene: NPRL2 as Amber List (moderate evidence)
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.14 NPRL2 Zornitza Stark Gene: nprl2 has been classified as Amber List (Moderate Evidence).
Polymicrogyria and Schizencephaly v0.111 SNAP29 Seb Lunke Marked gene: SNAP29 as ready
Polymicrogyria and Schizencephaly v0.111 SNAP29 Seb Lunke Gene: snap29 has been classified as Green List (High Evidence).
Polymicrogyria and Schizencephaly v0.111 SNAP29 Seb Lunke Classified gene: SNAP29 as Green List (high evidence)
Polymicrogyria and Schizencephaly v0.111 SNAP29 Seb Lunke Gene: snap29 has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.70 SNAP29 Zornitza Stark Marked gene: SNAP29 as ready
Lissencephaly and Band Heterotopia v0.70 SNAP29 Zornitza Stark Gene: snap29 has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.70 SNAP29 Zornitza Stark Phenotypes for gene: SNAP29 were changed from to Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome (MIM#609528)
Polymicrogyria and Schizencephaly v0.110 SRD5A3 Seb Lunke Marked gene: SRD5A3 as ready
Polymicrogyria and Schizencephaly v0.110 SRD5A3 Seb Lunke Gene: srd5a3 has been classified as Red List (Low Evidence).
Lissencephaly and Band Heterotopia v0.69 SNAP29 Zornitza Stark Publications for gene: SNAP29 were set to
Lissencephaly and Band Heterotopia v0.68 SNAP29 Zornitza Stark Mode of inheritance for gene: SNAP29 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Polymicrogyria and Schizencephaly v0.110 SRD5A3 Seb Lunke Classified gene: SRD5A3 as Red List (low evidence)
Polymicrogyria and Schizencephaly v0.110 SRD5A3 Seb Lunke Gene: srd5a3 has been classified as Red List (Low Evidence).
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.13 DEPDC5 Zornitza Stark Marked gene: DEPDC5 as ready
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.13 DEPDC5 Zornitza Stark Gene: depdc5 has been classified as Green List (High Evidence).
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.13 DEPDC5 Zornitza Stark Phenotypes for gene: DEPDC5 were changed from to Epilepsy, familial focal, with variable foci 1 (MIM#604364)
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.12 DEPDC5 Zornitza Stark Publications for gene: DEPDC5 were set to 31444548
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.12 DEPDC5 Zornitza Stark Publications for gene: DEPDC5 were set to
Lissencephaly and Band Heterotopia v0.67 SRD5A3 Zornitza Stark Marked gene: SRD5A3 as ready
Lissencephaly and Band Heterotopia v0.67 SRD5A3 Zornitza Stark Gene: srd5a3 has been classified as Red List (Low Evidence).
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.11 DEPDC5 Zornitza Stark Mode of inheritance for gene: DEPDC5 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.67 SRD5A3 Zornitza Stark Phenotypes for gene: SRD5A3 were changed from to Congenital disorder of glycosylation, type Iq (MIM#612379)
Lissencephaly and Band Heterotopia v0.66 SRD5A3 Zornitza Stark Publications for gene: SRD5A3 were set to
Lissencephaly and Band Heterotopia v0.65 DCHS1 Seb Lunke Marked gene: DCHS1 as ready
Lissencephaly and Band Heterotopia v0.65 DCHS1 Seb Lunke Gene: dchs1 has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.65 DCHS1 Seb Lunke Classified gene: DCHS1 as Green List (high evidence)
Lissencephaly and Band Heterotopia v0.65 DCHS1 Seb Lunke Gene: dchs1 has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.65 SRD5A3 Zornitza Stark Mode of inheritance for gene: SRD5A3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.64 SRD5A3 Zornitza Stark Classified gene: SRD5A3 as Red List (low evidence)
Lissencephaly and Band Heterotopia v0.64 SRD5A3 Zornitza Stark Gene: srd5a3 has been classified as Red List (Low Evidence).
Lissencephaly and Band Heterotopia v0.63 NSDHL Zornitza Stark Marked gene: NSDHL as ready
Lissencephaly and Band Heterotopia v0.63 NSDHL Zornitza Stark Gene: nsdhl has been classified as Amber List (Moderate Evidence).
Lissencephaly and Band Heterotopia v0.63 NSDHL Zornitza Stark Classified gene: NSDHL as Amber List (moderate evidence)
Lissencephaly and Band Heterotopia v0.63 NSDHL Zornitza Stark Gene: nsdhl has been classified as Amber List (Moderate Evidence).
Polymicrogyria and Schizencephaly v0.109 NSDHL Zornitza Stark Marked gene: NSDHL as ready
Polymicrogyria and Schizencephaly v0.109 NSDHL Zornitza Stark Gene: nsdhl has been classified as Amber List (Moderate Evidence).
Polymicrogyria and Schizencephaly v0.109 NSDHL Zornitza Stark Phenotypes for gene: NSDHL were changed from to CK syndrome 300831
Polymicrogyria and Schizencephaly v0.108 NSDHL Zornitza Stark Publications for gene: NSDHL were set to
Polymicrogyria and Schizencephaly v0.107 DAG1 Seb Lunke Marked gene: DAG1 as ready
Polymicrogyria and Schizencephaly v0.107 DAG1 Seb Lunke Gene: dag1 has been classified as Red List (Low Evidence).
Polymicrogyria and Schizencephaly v0.107 NSDHL Zornitza Stark Mode of inheritance for gene: NSDHL was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Polymicrogyria and Schizencephaly v0.107 DAG1 Seb Lunke Classified gene: DAG1 as Red List (low evidence)
Polymicrogyria and Schizencephaly v0.107 DAG1 Seb Lunke Gene: dag1 has been classified as Red List (Low Evidence).
Polymicrogyria and Schizencephaly v0.106 NSDHL Zornitza Stark Classified gene: NSDHL as Amber List (moderate evidence)
Polymicrogyria and Schizencephaly v0.106 NSDHL Zornitza Stark Gene: nsdhl has been classified as Amber List (Moderate Evidence).
Polymicrogyria and Schizencephaly v0.106 DAG1 Seb Lunke Classified gene: DAG1 as Red List (low evidence)
Polymicrogyria and Schizencephaly v0.106 DAG1 Seb Lunke Gene: dag1 has been classified as Red List (Low Evidence).
Polymicrogyria and Schizencephaly v0.105 TMEM216 Zornitza Stark Marked gene: TMEM216 as ready
Polymicrogyria and Schizencephaly v0.105 TMEM216 Zornitza Stark Gene: tmem216 has been classified as Red List (Low Evidence).
Polymicrogyria and Schizencephaly v0.105 TMEM216 Zornitza Stark Phenotypes for gene: TMEM216 were changed from Joubert syndrome 2 (MIM#608091) to Joubert syndrome 2 (MIM#608091)
Polymicrogyria and Schizencephaly v0.104 TMEM216 Zornitza Stark Publications for gene: TMEM216 were set to 20512146
Polymicrogyria and Schizencephaly v0.103 TMEM216 Zornitza Stark Mode of inheritance for gene: TMEM216 was changed from BIALLELIC, autosomal or pseudoautosomal to BIALLELIC, autosomal or pseudoautosomal
Polymicrogyria and Schizencephaly v0.102 TMEM216 Zornitza Stark Classified gene: TMEM216 as Red List (low evidence)
Polymicrogyria and Schizencephaly v0.102 TMEM216 Zornitza Stark Gene: tmem216 has been classified as Red List (Low Evidence).
Polymicrogyria and Schizencephaly v0.101 TMEM216 Zornitza Stark Marked gene: TMEM216 as ready
Polymicrogyria and Schizencephaly v0.101 TMEM216 Zornitza Stark Gene: tmem216 has been classified as Red List (Low Evidence).
Polymicrogyria and Schizencephaly v0.101 TMEM216 Zornitza Stark Phenotypes for gene: TMEM216 were changed from to Joubert syndrome 2 (MIM#608091)
Polymicrogyria and Schizencephaly v0.100 TMEM216 Zornitza Stark Publications for gene: TMEM216 were set to
Polymicrogyria and Schizencephaly v0.99 TMEM216 Zornitza Stark Mode of inheritance for gene: TMEM216 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Polymicrogyria and Schizencephaly v0.98 PEX6 Paul De Fazio gene: PEX6 was added
gene: PEX6 was added to Polymicrogyria and Schizencephaly. Sources: Literature
Mode of inheritance for gene: PEX6 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PEX6 were set to 21031596; 9877282; 26700162
Phenotypes for gene: PEX6 were set to Peroxisome biogenesis disorder 4A (Zellweger) (MIM#614862)
Review for gene: PEX6 was set to GREEN
gene: PEX6 was marked as current diagnostic
Added comment: Variants in this gene account for 14.5% of Zellweger Spectrum Disorder patients according to GeneReviews (https://www.ncbi.nlm.nih.gov/books/NBK1448/). Genetic spectrum of 77 patients reviewed in PMID: 19877282.

PMID: 26700162, 22894767, and 28452594 describe three patients with polymicrogyria. Did not look further for others but they possibly exist.
Sources: Literature
Polymicrogyria and Schizencephaly v0.98 TMEM216 Zornitza Stark Classified gene: TMEM216 as Red List (low evidence)
Polymicrogyria and Schizencephaly v0.98 TMEM216 Zornitza Stark Gene: tmem216 has been classified as Red List (Low Evidence).
Lissencephaly and Band Heterotopia v0.62 OSGEP Zornitza Stark Marked gene: OSGEP as ready
Lissencephaly and Band Heterotopia v0.62 OSGEP Zornitza Stark Gene: osgep has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.62 OSGEP Zornitza Stark Classified gene: OSGEP as Green List (high evidence)
Lissencephaly and Band Heterotopia v0.62 OSGEP Zornitza Stark Gene: osgep has been classified as Green List (High Evidence).
Cobblestone Malformations v0.9 DAG1 Zornitza Stark Marked gene: DAG1 as ready
Cobblestone Malformations v0.9 DAG1 Zornitza Stark Gene: dag1 has been classified as Red List (Low Evidence).
Cobblestone Malformations v0.9 DAG1 Zornitza Stark Classified gene: DAG1 as Red List (low evidence)
Cobblestone Malformations v0.9 DAG1 Zornitza Stark Gene: dag1 has been classified as Red List (Low Evidence).
Lissencephaly and Band Heterotopia v0.61 CSNK2A1 Zornitza Stark Marked gene: CSNK2A1 as ready
Lissencephaly and Band Heterotopia v0.61 CSNK2A1 Zornitza Stark Gene: csnk2a1 has been classified as Amber List (Moderate Evidence).
Lissencephaly and Band Heterotopia v0.61 CSNK2A1 Zornitza Stark Classified gene: CSNK2A1 as Amber List (moderate evidence)
Lissencephaly and Band Heterotopia v0.61 CSNK2A1 Zornitza Stark Gene: csnk2a1 has been classified as Amber List (Moderate Evidence).
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.10 NPRL3 Ain Roesley reviewed gene: NPRL3: Rating: GREEN; Mode of pathogenicity: None; Publications: 27173016, 26285051; Phenotypes: Epilepsy, familial focal, with variable foci 3 (MIM#617118); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Polymicrogyria and Schizencephaly v0.97 SHH Paul De Fazio reviewed gene: SHH: Rating: RED; Mode of pathogenicity: None; Publications: 19533790; Phenotypes: Schizencephaly (MIM#269160); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown; Current diagnostic: yes
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.10 NPRL2 Ain Roesley Deleted their review
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.10 NPRL2 Ain Roesley reviewed gene: NPRL2: Rating: GREEN; Mode of pathogenicity: None; Publications: 30093711, 27173016; Phenotypes: Epilepsy, familial focal, with variable foci 2 (MIM#617116); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Polymicrogyria and Schizencephaly v0.97 SIX3 Paul De Fazio reviewed gene: SIX3: Rating: AMBER; Mode of pathogenicity: None; Publications: 20157829; Phenotypes: Schizencephaly (MIM#269160); Mode of inheritance: None; Current diagnostic: yes
Genetic Epilepsy v0.798 NPRL2 Dean Phelan reviewed gene: NPRL2: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 26505888, 27173016, 28199897, 31594065; Phenotypes: focal seizures, frontal lobe epilepsy, nocturnal frontal lobe epilepsy, temporal lobe epilepsy, focal cortical dysplasia; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.10 NPRL2 Dean Phelan reviewed gene: NPRL2: Rating: AMBER; Mode of pathogenicity: None; Publications: PMID: 29281825, 27173016, 31625153; Phenotypes: Focal epilepsy, Focal cortical dysplasia; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Polymicrogyria and Schizencephaly v0.97 SNAP29 Paul De Fazio gene: SNAP29 was added
gene: SNAP29 was added to Polymicrogyria and Schizencephaly. Sources: Literature
Mode of inheritance for gene: SNAP29 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SNAP29 were set to 29051910; 21073448; 30793783
Phenotypes for gene: SNAP29 were set to Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome (MIM#609528)
Review for gene: SNAP29 was set to GREEN
gene: SNAP29 was marked as current diagnostic
Added comment: Associated with CEDNIK syndrome. Both pachygyria and polymicrogyria, and additionally dysgenesis of the corpus callosum, are reported in multiple patients from unrelated families with pathogenic variants in this gene (at least 5 patients from 3 families with both pachygyria and polymicrogyria, and at least 5 patients from 3 families with polymicrogyria alone (PMID: 29051910, 30793783)).
Sources: Literature
Lissencephaly and Band Heterotopia v0.60 SNAP29 Paul De Fazio changed review comment from: Associated with CEDNIK syndrome. Both pachygyria and polymicrogyria, and additionally dysgenesis of the corpus callosum, are reported in multiple patients from unrelated families with pathogenic variants in this gene (4 patients from 2 families with both pachygyria and polymicrogyria, and 5 patients from 3 families with polymicrogyria, in 12 patients from 5 families reviewed in PMID: 29051910).; to: Associated with CEDNIK syndrome. Both pachygyria and polymicrogyria, and additionally dysgenesis of the corpus callosum, are reported in multiple patients from unrelated families with pathogenic variants in this gene (at least 5 patients from 3 families with both pachygyria and polymicrogyria, and at least 5 patients from 3 families with polymicrogyria alone (PMID: 29051910, 30793783)).
Lissencephaly and Band Heterotopia v0.60 SNAP29 Paul De Fazio changed review comment from: Associated with CEDNIK syndrome. Both pachygyria and polymicrogyria, and additionally dysgenesis of the corpus callosum, are reported in multiple patients from 5 families with pathogenic variants in this gene (4 patients with pachygyria and 9 patients with polymicrogyria, in 12 patients from 5 families reviewed in PMID: 29051910).; to: Associated with CEDNIK syndrome. Both pachygyria and polymicrogyria, and additionally dysgenesis of the corpus callosum, are reported in multiple patients from unrelated families with pathogenic variants in this gene (4 patients from 2 families with both pachygyria and polymicrogyria, and 5 patients from 3 families with polymicrogyria, in 12 patients from 5 families reviewed in PMID: 29051910).
Lissencephaly and Band Heterotopia v0.60 SNAP29 Paul De Fazio changed review comment from: Associated with CEDNIK syndrome. Both pachygyria and polymicrogyria, and additionally dysgenesis of the corpus callosum, are reported in multiple unrelated patients with pathogenic variants in this gene (4 patients with pachygyria and 9 patients with polymicrogyria, in 12 patients reviewed in PMID: 29051910).; to: Associated with CEDNIK syndrome. Both pachygyria and polymicrogyria, and additionally dysgenesis of the corpus callosum, are reported in multiple patients from 5 families with pathogenic variants in this gene (4 patients with pachygyria and 9 patients with polymicrogyria, in 12 patients from 5 families reviewed in PMID: 29051910).
Lissencephaly and Band Heterotopia v0.60 SNAP29 Paul De Fazio reviewed gene: SNAP29: Rating: GREEN; Mode of pathogenicity: None; Publications: 29051910, 21073448, 30793783; Phenotypes: Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome (MIM#609528); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Polymicrogyria and Schizencephaly v0.97 SRD5A3 Paul De Fazio gene: SRD5A3 was added
gene: SRD5A3 was added to Polymicrogyria and Schizencephaly. Sources: Literature
Mode of inheritance for gene: SRD5A3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: SRD5A3 were set to 18271001; 20637498; 31638560; 27480077
Phenotypes for gene: SRD5A3 were set to Congenital disorder of glycosylation, type Iq (MIM#612379)
Review for gene: SRD5A3 was set to RED
gene: SRD5A3 was marked as current diagnostic
Added comment: Associated with a CDG. Brain abnormalities reported include vermis hypoplasia, hypoplastic corpus callosum, cerebral atrophy. Polymicrogyria has been reported in 2 individuals from the same family in PMID: 18271001, but given that it is only this one family I have rated it red.
Sources: Literature
Lissencephaly and Band Heterotopia v0.60 SRD5A3 Paul De Fazio changed review comment from: Associated with a CDG. Brain abnormalities reported include vermis hypoplasia, hypoplastic corpus callosum, cerebral atrophy. Polymicrogyria has been reported (2 individuals from the same family in PMID: 18271001), but lissencephaly or band heterotopia are not reported.; to: Associated with a CDG. Brain abnormalities reported include vermis hypoplasia, hypoplastic corpus callosum, cerebral atrophy. Polymicrogyria has been reported (2 individuals from the same family in PMID: 18271001), but lissencephaly or band heterotopia are not reported.

Not sure this gene should be on this panel. Have added to polymicrogyria panel instead.
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.10 DEPDC5 Ain Roesley reviewed gene: DEPDC5: Rating: GREEN; Mode of pathogenicity: None; Publications: 31444548; Phenotypes: Epilepsy, familial focal, with variable foci 1 (MIM#604364); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Lissencephaly and Band Heterotopia v0.60 SRD5A3 Paul De Fazio reviewed gene: SRD5A3: Rating: RED; Mode of pathogenicity: None; Publications: 18271001, 20637498, 31638560, 27480077; Phenotypes: Congenital disorder of glycosylation, type Iq (MIM#612379); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Lissencephaly and Band Heterotopia v0.60 DCHS1 Ain Roesley gene: DCHS1 was added
gene: DCHS1 was added to Lissencephaly and Band Heterotopia. Sources: Literature
Mode of inheritance for gene: DCHS1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DCHS1 were set to 27262615; 22473091
Phenotypes for gene: DCHS1 were set to Van Maldergem syndrome 1 (MIM#601390)
Penetrance for gene: DCHS1 were set to unknown
Review for gene: DCHS1 was set to GREEN
Added comment: PMID: 27262615;
- cohort of 26x periventricular band heterotopias however 2x had additional phenotype of pachygyria
- 2nd cohort of 10x band heterotopias

PMID: 22473091;
- 1x patient with localised areas of cortical thickening and gyral simplification
Sources: Literature
Tuberous Sclerosis_Focal Cortical Dysplasia_Hemimegalencephaly v0.10 STRADA Paul De Fazio reviewed gene: STRADA: Rating: RED; Mode of pathogenicity: None; Publications: 28688840, 17522105, 27170158, 23616120; Phenotypes: Polyhydramnios, megalencephaly, and symptomatic epilepsy (MIM#611087); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Lissencephaly and Band Heterotopia v0.60 NSDHL Belinda Chong gene: NSDHL was added
gene: NSDHL was added to Lissencephaly and Band Heterotopia. Sources: Literature
Mode of inheritance for gene: NSDHL was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for gene: NSDHL were set to 19377476; 19842190; 21129721
Phenotypes for gene: NSDHL were set to CK syndrome 300831
Review for gene: NSDHL was set to AMBER
gene: NSDHL was marked as current diagnostic
Added comment: First described in 7 males from a five-generation family, 1-bp duplication p.(Lys232del) reported by Tarpey et al. (2009). PMID:19377476.

Second affected family, p.(Arg367SerFs*33) reported by Tarpey et al. (2009) and McLarren et al. (2010) (PMID:19842190; 21129721). Functional studies showed that both mutations in these families result in partial loss of the function of the NSDHL protein and cause a distinct phenotype characterized by intellectual disability, seizures, microcephaly, cerebral cortical malformations, minor facial anomalies, and thin body habitus.

Third described in five- generation family (missense -p.Gly152Asp) with affected males manifesting clinical features of CK syndrome. (https://doi.org/10.1002/ajmg.a.36999). Clinical feature described in the paper similar to CK syndrome however, no mention of cortical malformation, pachygyria, polymicrogyria, features mentioned in OMIM. But one affected male has a CT scan showing atrophic changes in the brain, internal hydrocephalus, and possible subependymal gray matter heterotopia. NB: Therefore, unsure if this is the third family hence leaving as Amber.
Sources: Literature
Polymicrogyria and Schizencephaly v0.97 DAG1 Ain Roesley gene: DAG1 was added
gene: DAG1 was added to Polymicrogyria and Schizencephaly. Sources: Literature
Mode of inheritance for gene: DAG1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DAG1 were set to 24052401
Phenotypes for gene: DAG1 were set to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 9 (MIM#616538)
Penetrance for gene: DAG1 were set to unknown
Review for gene: DAG1 was set to RED
Added comment: Also known as Walker-Warburg syndrome

PMID: 24052401;
- two Libyan siblings
- MRI showed thin cortical layer resembling diffuse polymicrogyria with frontal agyria
Sources: Literature
Polymicrogyria and Schizencephaly v0.97 NSDHL Belinda Chong reviewed gene: NSDHL: Rating: AMBER; Mode of pathogenicity: None; Publications: 19377476, 19842190, 21129721; Phenotypes: CK syndrome 300831; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Polymicrogyria and Schizencephaly v0.97 TMEM216 Paul De Fazio reviewed gene: TMEM216: Rating: RED; Mode of pathogenicity: None; Publications: 20512146; Phenotypes: Joubert syndrome 2 (MIM#608091); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Lissencephaly and Band Heterotopia v0.60 OSGEP Naomi Baker changed review comment from: OSGEP mutations are associated with Galloway–Mowat syndrome, MIM#617729. Six Taiwanese patients, including two siblings, examined by either congenital MRI or cranial CT had pachygyria and hypomyelination (PMID:30558655).
Sources: Literature; to: OSGEP mutations are associated with Galloway–Mowat syndrome, MIM#617729. Six Taiwanese patients, including two siblings, examined by either congenital MRI or cranial CT had pachygyria and hypomyelination (PMID:30558655). Another reports describes OSGEP mutations in multiple individuals, with at least three reported as having pachygyria (PMID:28805828).
Sources: Literature
Lissencephaly and Band Heterotopia v0.60 OSGEP Naomi Baker gene: OSGEP was added
gene: OSGEP was added to Lissencephaly and Band Heterotopia. Sources: Literature
Mode of inheritance for gene: OSGEP was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: OSGEP were set to PMID: 30558655
Phenotypes for gene: OSGEP were set to Galloway-Mowat syndrome 3, MIM#617729
Penetrance for gene: OSGEP were set to Complete
Review for gene: OSGEP was set to GREEN
Added comment: OSGEP mutations are associated with Galloway–Mowat syndrome, MIM#617729. Six Taiwanese patients, including two siblings, examined by either congenital MRI or cranial CT had pachygyria and hypomyelination (PMID:30558655).
Sources: Literature
Cobblestone Malformations v0.8 DAG1 Ain Roesley gene: DAG1 was added
gene: DAG1 was added to Cobblestone Malformations. Sources: Literature
Mode of inheritance for gene: DAG1 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: DAG1 were set to 29337005
Phenotypes for gene: DAG1 were set to Walker-Warburg syndrome associated with tectocerebellar dysraphia; Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 9 (MIM#616538)
Penetrance for gene: DAG1 were set to unknown
Review for gene: DAG1 was set to RED
Added comment: PMID: 29337005;
- 1x consanguineous Israeli-Arab kindred with Walker-Warburg syndrome
- The imaging studies demonstrated: cobblestone cortex, hydrocephalus, z-shaped brainstem, and in addition occipital encephalocele, vermian agenesis, and an elongated and thick tectum (tectocerebellar dysraphia).
- homozygous frameshift
Sources: Literature
Lissencephaly and Band Heterotopia v0.60 CSNK2A1 Ain Roesley gene: CSNK2A1 was added
gene: CSNK2A1 was added to Lissencephaly and Band Heterotopia. Sources: Literature
Mode of inheritance for gene: CSNK2A1 was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: CSNK2A1 were set to 27048600; 29240241
Phenotypes for gene: CSNK2A1 were set to Okur-Chung neurodevelopmental syndrome (MIM#617062)
Penetrance for gene: CSNK2A1 were set to unknown
Review for gene: CSNK2A1 was set to AMBER
Added comment: PMID: 27048600;
- 5 unrelated patients
- 1x pachygyria + 1x simplified gyral cortication

PMID: 29240241;
- summary of reports thus far, no additional patients with cortical malformations

* all variants reported are de novo
Sources: Literature
Intellectual disability syndromic and non-syndromic v0.2875 PDE2A Zornitza Stark Marked gene: PDE2A as ready
Intellectual disability syndromic and non-syndromic v0.2875 PDE2A Zornitza Stark Gene: pde2a has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.2875 PDE2A Zornitza Stark Classified gene: PDE2A as Amber List (moderate evidence)
Intellectual disability syndromic and non-syndromic v0.2875 PDE2A Zornitza Stark Gene: pde2a has been classified as Amber List (Moderate Evidence).
Intellectual disability syndromic and non-syndromic v0.2874 PDE2A Zornitza Stark gene: PDE2A was added
gene: PDE2A was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list
Mode of inheritance for gene: PDE2A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PDE2A were set to 32467598; 32196122; 29392776
Phenotypes for gene: PDE2A were set to Paroxysmal dyskinesia
Review for gene: PDE2A was set to AMBER
Added comment: Four unrelated families reported with childhood-onset refractory paroxysmal dyskinesia with cognitive impairment, sometimes associated with choreodystonia and interictal baseline EEG abnormalities or epilepsy. One of the reports characterises the disorder as 'Rett-like'. Unclear at this time what proportion of affected individuals have ID as part of the phenotype.
Sources: Expert list
Mendeliome v0.3939 PDE2A Zornitza Stark Marked gene: PDE2A as ready
Mendeliome v0.3939 PDE2A Zornitza Stark Gene: pde2a has been classified as Green List (High Evidence).
Mendeliome v0.3939 PDE2A Zornitza Stark Classified gene: PDE2A as Green List (high evidence)
Mendeliome v0.3939 PDE2A Zornitza Stark Gene: pde2a has been classified as Green List (High Evidence).
Mendeliome v0.3938 PDE2A Zornitza Stark gene: PDE2A was added
gene: PDE2A was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: PDE2A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PDE2A were set to 32467598; 32196122; 29392776
Phenotypes for gene: PDE2A were set to Paroxysmal dyskinesia
Review for gene: PDE2A was set to GREEN
Added comment: Four unrelated families reported with childhood-onset refractory paroxysmal dyskinesia with cognitive impairment, sometimes associated with choreodystonia and interictal baseline EEG abnormalities or epilepsy. One of the reports characterises the disorder as 'Rett-like'.
Sources: Literature
Paroxysmal Dyskinesia v0.39 PDE2A Zornitza Stark Marked gene: PDE2A as ready
Paroxysmal Dyskinesia v0.39 PDE2A Zornitza Stark Gene: pde2a has been classified as Green List (High Evidence).
Paroxysmal Dyskinesia v0.39 PDE2A Zornitza Stark Classified gene: PDE2A as Green List (high evidence)
Paroxysmal Dyskinesia v0.39 PDE2A Zornitza Stark Gene: pde2a has been classified as Green List (High Evidence).
Paroxysmal Dyskinesia v0.38 PDE2A Zornitza Stark gene: PDE2A was added
gene: PDE2A was added to Paroxysmal Dyskinesia. Sources: Literature
Mode of inheritance for gene: PDE2A was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: PDE2A were set to 32467598; 32196122; 29392776
Phenotypes for gene: PDE2A were set to Paroxysmal dyskinesia
Review for gene: PDE2A was set to GREEN
Added comment: Four unrelated families reported with childhood-onset refractory paroxysmal dyskinesia with cognitive impairment, sometimes associated with choreodystonia and interictal baseline EEG abnormalities or epilepsy. One of the reports characterises the disorder as 'Rett-like'.
Sources: Literature
Paroxysmal Dyskinesia v0.37 Zornitza Stark Panel types changed to Victorian Clinical Genetics Services; Rare Disease
Early-onset Parkinson disease v0.54 COASY Zornitza Stark Marked gene: COASY as ready
Early-onset Parkinson disease v0.54 COASY Zornitza Stark Gene: coasy has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v0.54 COASY Zornitza Stark Phenotypes for gene: COASY were changed from to Neurodegeneration with brain iron accumulation 6, MIM# 615643
Early-onset Parkinson disease v0.53 COASY Zornitza Stark Publications for gene: COASY were set to
Early-onset Parkinson disease v0.52 COASY Zornitza Stark Mode of inheritance for gene: COASY was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.51 COASY Zornitza Stark Classified gene: COASY as Amber List (moderate evidence)
Early-onset Parkinson disease v0.51 COASY Zornitza Stark Gene: coasy has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v0.50 COASY Zornitza Stark reviewed gene: COASY: Rating: AMBER; Mode of pathogenicity: None; Publications: 28489334, 24360804; Phenotypes: Neurodegeneration with brain iron accumulation 6, MIM# 615643; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.50 CLN3 Zornitza Stark Marked gene: CLN3 as ready
Early-onset Parkinson disease v0.50 CLN3 Zornitza Stark Gene: cln3 has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.50 CLN3 Zornitza Stark Phenotypes for gene: CLN3 were changed from to Ceroid lipofuscinosis, neuronal, 3 MIM#204200
Early-onset Parkinson disease v0.49 CLN3 Zornitza Stark Publications for gene: CLN3 were set to 19489875; 11342698
Early-onset Parkinson disease v0.48 CLN3 Zornitza Stark Mode of inheritance for gene: CLN3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.48 CLN3 Zornitza Stark Publications for gene: CLN3 were set to
Early-onset Dementia v0.65 C9orf72 Zornitza Stark Marked gene: C9orf72 as ready
Early-onset Dementia v0.65 C9orf72 Zornitza Stark Gene: c9orf72 has been classified as Green List (High Evidence).
Early-onset Dementia v0.65 C9orf72 Zornitza Stark Classified gene: C9orf72 as Green List (high evidence)
Early-onset Dementia v0.65 C9orf72 Zornitza Stark Gene: c9orf72 has been classified as Green List (High Evidence).
Early-onset Dementia v0.64 C9orf72 Zornitza Stark gene: C9orf72 was added
gene: C9orf72 was added to Early-onset Dementia. Sources: Expert list
STR tags were added to gene: C9orf72.
Mode of inheritance for gene: C9orf72 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: C9orf72 were set to 31779815; 21944778; 21944779
Phenotypes for gene: C9orf72 were set to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550
Review for gene: C9orf72 was set to GREEN
Added comment: Well established gene-disease association.
Sources: Expert list
Early-onset Parkinson disease v0.47 C9orf72 Zornitza Stark Phenotypes for gene: C9orf72 were changed from to Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550
Early-onset Parkinson disease v0.46 C9orf72 Zornitza Stark Publications for gene: C9orf72 were set to
Early-onset Parkinson disease v0.45 C9orf72 Zornitza Stark Mode of inheritance for gene: C9orf72 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.44 APP Zornitza Stark Marked gene: APP as ready
Early-onset Parkinson disease v0.44 APP Zornitza Stark Gene: app has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v0.44 APP Zornitza Stark Phenotypes for gene: APP were changed from to Alzheimer disease 1, familial, MIM# 104300
Early-onset Parkinson disease v0.43 APP Zornitza Stark Mode of inheritance for gene: APP was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Early-onset Parkinson disease v0.42 APP Zornitza Stark Classified gene: APP as Amber List (moderate evidence)
Early-onset Parkinson disease v0.42 APP Zornitza Stark Gene: app has been classified as Amber List (Moderate Evidence).
Early-onset Parkinson disease v0.41 APP Zornitza Stark reviewed gene: APP: Rating: AMBER; Mode of pathogenicity: None; Publications: ; Phenotypes: Alzheimer disease 1, familial, MIM# 104300; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Ataxia - adult onset v0.77 SCA6 Bryony Thompson Classified STR: SCA6 as Green List (high evidence)
Ataxia - adult onset v0.77 SCA6 Bryony Thompson Str: sca6 has been classified as Green List (High Evidence).
Ataxia - adult onset v0.76 SCA6 Bryony Thompson STR: SCA6 was added
STR: SCA6 was added to Ataxia - adult onset. Sources: Expert list
STR tags were added to STR: SCA6.
Mode of inheritance for STR: SCA6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA6 were set to 20301319; 29325606
Phenotypes for STR: SCA6 were set to Spinocerebellar ataxia 6 MIM#183086; Episodic ataxia, type 2 MIM#108500
Review for STR: SCA6 was set to GREEN
STR: SCA6 was marked as clinically relevant
Added comment: NM_023035.2:c.6929_6931CAG[X]
PolyQ expansion alters gene binding, impairs transcription factor function, and is toxic to cells expressing the α1ACT – effects consistent with a loss of function
Normal: ≤18 repeats
Questionable significance: 19 CAG repeats
Full penetrance: ≥20 repeats
Sources: Expert list
Autoinflammatory Disorders v0.93 OTULIN Zornitza Stark Marked gene: OTULIN as ready
Autoinflammatory Disorders v0.93 OTULIN Zornitza Stark Gene: otulin has been classified as Green List (High Evidence).
Autoinflammatory Disorders v0.93 OTULIN Zornitza Stark Phenotypes for gene: OTULIN were changed from to Autoinflammation, panniculitis, and dermatosis syndrome, MIM# 617099
Autoinflammatory Disorders v0.92 OTULIN Zornitza Stark Publications for gene: OTULIN were set to
Autoinflammatory Disorders v0.91 OTULIN Zornitza Stark Mode of inheritance for gene: OTULIN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Autoinflammatory Disorders v0.90 OTULIN Zornitza Stark reviewed gene: OTULIN: Rating: GREEN; Mode of pathogenicity: None; Publications: 27523608, 27559085; Phenotypes: Autoinflammation, panniculitis, and dermatosis syndrome, MIM# 617099; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3937 OTULIN Zornitza Stark Marked gene: OTULIN as ready
Mendeliome v0.3937 OTULIN Zornitza Stark Gene: otulin has been classified as Green List (High Evidence).
Mendeliome v0.3937 OTULIN Zornitza Stark Phenotypes for gene: OTULIN were changed from to Autoinflammation, panniculitis, and dermatosis syndrome, MIM# 617099
Mendeliome v0.3936 OTULIN Zornitza Stark Publications for gene: OTULIN were set to
Mendeliome v0.3935 OTULIN Zornitza Stark Mode of inheritance for gene: OTULIN was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3934 OTULIN Zornitza Stark reviewed gene: OTULIN: Rating: GREEN; Mode of pathogenicity: None; Publications: 27523608, 27559085; Phenotypes: Autoinflammation, panniculitis, and dermatosis syndrome, MIM# 617099; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Inflammatory bowel disease v0.34 OTULIN Zornitza Stark Marked gene: OTULIN as ready
Inflammatory bowel disease v0.34 OTULIN Zornitza Stark Gene: otulin has been classified as Green List (High Evidence).
Inflammatory bowel disease v0.34 OTULIN Zornitza Stark Classified gene: OTULIN as Green List (high evidence)
Inflammatory bowel disease v0.34 OTULIN Zornitza Stark Gene: otulin has been classified as Green List (High Evidence).
Inflammatory bowel disease v0.34 OTULIN Zornitza Stark Classified gene: OTULIN as Green List (high evidence)
Inflammatory bowel disease v0.34 OTULIN Zornitza Stark Gene: otulin has been classified as Green List (High Evidence).
Inflammatory bowel disease v0.33 OTULIN Zornitza Stark gene: OTULIN was added
gene: OTULIN was added to Inflammatory bowel disease. Sources: Expert list
Mode of inheritance for gene: OTULIN was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: OTULIN were set to 27523608; 27559085
Phenotypes for gene: OTULIN were set to Autoinflammation, panniculitis, and dermatosis syndrome, MIM# 617099
Review for gene: OTULIN was set to GREEN
Added comment: Autoinflammatory disorder where diarrhoea is one of the presenting features in addition to recurrent fever, erythematous rash with painful nodules, painful joints, and lipodystrophy.
Sources: Expert list
Inflammatory bowel disease v0.32 NOD2 Zornitza Stark changed review comment from: Variants in NOD2 (particularly bi-allelic ones) are associated with increased risk of Crohn's disease.
Sources: Expert Review; to: Variants in NOD2 (particularly bi-allelic ones) are associated with increased risk of Crohn's disease. 7% of a cohort of 401 patients with Crohn's had NOD2 bi-allelic variants.
Sources: Expert Review
Inflammatory bowel disease v0.32 NOD2 Zornitza Stark edited their review of gene: NOD2: Changed publications: 11385576, 17804789, 32463623; Changed phenotypes: {Inflammatory bowel disease 1, Crohn disease} 266600, {Yao syndrome} 617321
Inflammatory bowel disease v0.32 FERMT1 Zornitza Stark Marked gene: FERMT1 as ready
Inflammatory bowel disease v0.32 FERMT1 Zornitza Stark Gene: fermt1 has been classified as Red List (Low Evidence).
Inflammatory bowel disease v0.32 FERMT1 Zornitza Stark Phenotypes for gene: FERMT1 were changed from to Kindler syndrome, MIM# 173650
Inflammatory bowel disease v0.31 FERMT1 Zornitza Stark Publications for gene: FERMT1 were set to
Inflammatory bowel disease v0.30 FERMT1 Zornitza Stark Mode of inheritance for gene: FERMT1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Inflammatory bowel disease v0.29 FERMT1 Zornitza Stark Classified gene: FERMT1 as Red List (low evidence)
Inflammatory bowel disease v0.29 FERMT1 Zornitza Stark Gene: fermt1 has been classified as Red List (Low Evidence).
Inflammatory bowel disease v0.28 FERMT1 Zornitza Stark reviewed gene: FERMT1: Rating: RED; Mode of pathogenicity: None; Publications: 19057668, 27537055, 32463623; Phenotypes: Kindler syndrome, MIM# 173650; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Ataxia - adult onset v0.75 SCA3 Bryony Thompson Classified STR: SCA3 as Green List (high evidence)
Ataxia - adult onset v0.75 SCA3 Bryony Thompson Str: sca3 has been classified as Green List (High Evidence).
Ataxia - adult onset v0.74 SCA3 Bryony Thompson STR: SCA3 was added
STR: SCA3 was added to Ataxia - adult onset. Sources: Expert list
STR tags were added to STR: SCA3.
Mode of inheritance for STR: SCA3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA3 were set to 20301375; 29325606
Phenotypes for STR: SCA3 were set to Machado-Joseph disease MIM#109150; Spinocerebellar ataxia type 3
Review for STR: SCA3 was set to GREEN
STR: SCA3 was marked as clinically relevant
Added comment: NM_004993​.5:c.886_888CAG[X]
Toxic aggregation and mislocalization in neurons is mechanism of disease
Normal: ≤44 repeats, mostly <31 repeats
Intermediate: 45-59 repeats, some intermediate alleles are not associated with classic clinical features of SCA3
Pathogenic (full penetrance): ≥60 repeats
Sources: Expert list
Ataxia - adult onset v0.73 SCA2 Bryony Thompson Classified STR: SCA2 as Green List (high evidence)
Ataxia - adult onset v0.73 SCA2 Bryony Thompson Str: sca2 has been classified as Green List (High Evidence).
Ataxia - adult onset v0.72 SCA2 Bryony Thompson STR: SCA2 was added
STR: SCA2 was added to Ataxia - adult onset. Sources: Expert list
STR tags were added to STR: SCA2.
Mode of inheritance for STR: SCA2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA2 were set to 29325606; 20301452
Phenotypes for STR: SCA2 were set to Spinocerebellar ataxia 2 MIM#183090
Review for STR: SCA2 was set to GREEN
STR: SCA2 was marked as clinically relevant
Added comment: NM_002973​.3:c.496_498CAG[X]
Toxic protein aggregation is mechanism of disease
Benign: ≤31 repeats (homozygous 31/31 repeats reported for recessive SCA2)
Uncertain: 32 repeats
ALS risk allele: 30-32 repeats
Reduced penetrance: 33-34 repeats, may not develop symptoms or only very late in life
Full penetrance: ≥35 repeats
Interruption of a CAG expanded allele by a CAA repeat does not mitigate the pathogenicity of the repeat size, but may enhance the meiotic stability of the repeat
Sources: Expert list
Ataxia - adult onset v0.71 SCA1 Bryony Thompson Classified STR: SCA1 as Green List (high evidence)
Ataxia - adult onset v0.71 SCA1 Bryony Thompson Str: sca1 has been classified as Green List (High Evidence).
Ataxia - adult onset v0.70 SCA1 Bryony Thompson changed review comment from: NM_000332.3:c.589_591CAG[X]
Toxic protein aggregation is mechanism of disease
Sources: Expert list; to: NM_000332.3:c.589_591CAG[X]
Toxic protein aggregation is mechanism of disease
Normal: ≤35 CAG repeats or 36-44 CAG repeats with CAT interruptions
Mutable normal (intermediate): 36-38 CAG repeats without CAT interruptions
Full-penetrance: ≥39 CAG repeats without CAT interruptions or ≥46 uninterrupted CAG repeats with CAT interruptions and additional CAGs
Sources: Expert list
Mendeliome v0.3934 RRAGC Zornitza Stark Publications for gene: RRAGC were set to
Mendeliome v0.3933 RRAGC Zornitza Stark Marked gene: RRAGC as ready
Mendeliome v0.3933 RRAGC Zornitza Stark Gene: rragc has been classified as Red List (Low Evidence).
Mendeliome v0.3933 RRAGC Zornitza Stark Phenotypes for gene: RRAGC were changed from to Dilated cardiomyopathy; cataract
Cardiomyopathy_Paediatric v0.4 RRAGC Zornitza Stark Marked gene: RRAGC as ready
Cardiomyopathy_Paediatric v0.4 RRAGC Zornitza Stark Gene: rragc has been classified as Red List (Low Evidence).
Cardiomyopathy_Paediatric v0.4 RRAGC Zornitza Stark Classified gene: RRAGC as Red List (low evidence)
Cardiomyopathy_Paediatric v0.4 RRAGC Zornitza Stark Gene: rragc has been classified as Red List (Low Evidence).
Cardiomyopathy_Paediatric v0.3 RRAGC Zornitza Stark reviewed gene: RRAGC: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Mendeliome v0.3932 RRAGC Zornitza Stark Mode of inheritance for gene: RRAGC was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3931 RRAGC Zornitza Stark Classified gene: RRAGC as Red List (low evidence)
Mendeliome v0.3931 RRAGC Zornitza Stark Gene: rragc has been classified as Red List (Low Evidence).
Mendeliome v0.3930 RRAGC Zornitza Stark reviewed gene: RRAGC: Rating: RED; Mode of pathogenicity: None; Publications: 27234373; Phenotypes: Dilated cardiomyopathy, cataract; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3930 RANBP17 Zornitza Stark Marked gene: RANBP17 as ready
Mendeliome v0.3930 RANBP17 Zornitza Stark Gene: ranbp17 has been classified as Red List (Low Evidence).
Mendeliome v0.3930 RANBP17 Zornitza Stark Classified gene: RANBP17 as Red List (low evidence)
Mendeliome v0.3930 RANBP17 Zornitza Stark Gene: ranbp17 has been classified as Red List (Low Evidence).
Mendeliome v0.3929 RANBP17 Zornitza Stark reviewed gene: RANBP17: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Ataxia - adult onset v0.70 SCA1 Bryony Thompson STR: SCA1 was added
STR: SCA1 was added to Ataxia - adult onset. Sources: Expert list
STR tags were added to STR: SCA1.
Mode of inheritance for STR: SCA1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: SCA1 were set to 29325606; 20301363
Phenotypes for STR: SCA1 were set to Spinocerebellar ataxia 1 MIM#164400
Review for STR: SCA1 was set to GREEN
STR: SCA1 was marked as clinically relevant
Added comment: NM_000332.3:c.589_591CAG[X]
Toxic protein aggregation is mechanism of disease
Sources: Expert list
Ataxia - adult onset v0.69 DRPLA Bryony Thompson Classified STR: DRPLA as Green List (high evidence)
Ataxia - adult onset v0.69 DRPLA Bryony Thompson Str: drpla has been classified as Green List (High Evidence).
Ataxia - adult onset v0.68 DRPLA Bryony Thompson STR: DRPLA was added
STR: DRPLA was added to Ataxia - adult onset. Sources: Expert list
STR tags were added to STR: DRPLA.
Mode of inheritance for STR: DRPLA was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: DRPLA were set to 29325606; 20301664
Phenotypes for STR: DRPLA were set to Dentatorubral-pallidoluysian atrophy MIM#125370
Review for STR: DRPLA was set to GREEN
STR: DRPLA was marked as clinically relevant
Added comment: NM_001007026​.1:c.1462_1464CAG[X]
Toxic gain of function mechanism of disease
Benign: ≤35 repeats
Mutable normal: 20-35 repeats
Pathogenic: ≥48 repeats
Age <20 years: ≥63 repeats - ataxia, myoclonus, seizures, progressive intellectual deterioration
Age 21-40 years 61-69 repeats, >40 years 48-67 repeats: ataxia, choreoathetosis, dementia, psychiatric disturbance
Sources: Expert list
Motor Neurone Disease v0.50 SBMA Bryony Thompson Classified STR: SBMA as Green List (high evidence)
Motor Neurone Disease v0.50 SBMA Bryony Thompson Str: sbma has been classified as Green List (High Evidence).
Motor Neurone Disease v0.49 SBMA Bryony Thompson STR: SBMA was added
STR: SBMA was added to Motor Neuron Disease. Sources: Expert list
STR tags were added to STR: SBMA.
Mode of inheritance for STR: SBMA was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Publications for STR: SBMA were set to 20301508; 29325606
Phenotypes for STR: SBMA were set to Spinal and bulbar muscular atrophy of Kennedy MIM#313200
Review for STR: SBMA was set to GREEN
STR: SBMA was marked as clinically relevant
Added comment: NM_000044.4:c.172_174CAG[X]
Toxic gain of function mechanism of disease
Normal: ≤34 repeats
Unknown: 35 repeats, consideration of the affected individual's clinical presentation and reconciliation with repeat sizes in family members
Reduced-penetrance: 36-37 repeats, interpreted within the context of family history, clinical presentation, genotype-phenotype correlations in other family members.
Full-penetrance: ≥38 repeats
Sources: Expert list
Early-onset Parkinson disease v0.41 HD Bryony Thompson Classified STR: HD as Green List (high evidence)
Early-onset Parkinson disease v0.41 HD Bryony Thompson Str: hd has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.40 HD Bryony Thompson STR: HD was added
STR: HD was added to Early-onset Parkinson disease. Sources: Expert list
STR tags were added to STR: HD.
Mode of inheritance for STR: HD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: HD were set to 20301482; 29325606
Phenotypes for STR: HD were set to Huntington disease MIM#143100
Review for STR: HD was set to GREEN
STR: HD was marked as clinically relevant
Added comment: NM_002111.8:c.52_54CAG[X]
Primary mechanism of disease is gain of function
Normal: ≤26 repeats
Intermediate: 27-35 repeats, no risk for proband but expansion possible in the next generation
Pathogenic (reduced penetrance): 36-39 repeats, proband at risk for HD but may not develop symptoms
Pathogenic (full penetrance): ≥40 repeats, development of HD with increased certainty assuming a normal life span
Sources: Expert list
Early-onset Parkinson disease v0.39 Bryony Thompson removed STR:HD from the panel
Cardiomyopathy_Paediatric v0.3 RRAGC Elena Savva gene: RRAGC was added
gene: RRAGC was added to Cardiomyopathy_Paediatric. Sources: Literature
Mode of inheritance for gene: RRAGC was set to MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Publications for gene: RRAGC were set to PMID: 29367541; 27234373
Phenotypes for gene: RRAGC were set to Pediatric Dilated Cardiomyopathy
Mode of pathogenicity for gene: RRAGC was set to Other
Review for gene: RRAGC was set to AMBER
Added comment: PMID: 29367541 - 1 de novo patient (missense) w/ paediatric cardiomyopathy

PMID: 27234373 - same de novo missense as above, functional studies show a GOF mechanism

MIssense variant is absent from the population (gnomAD) and in a highly constrained region (Decipher)
Sources: Literature
Early-onset Parkinson disease v0.38 HD Bryony Thompson Classified STR: HD as Green List (high evidence)
Early-onset Parkinson disease v0.38 HD Bryony Thompson Str: hd has been classified as Green List (High Evidence).
Early-onset Parkinson disease v0.37 HD Bryony Thompson STR: HD was added
STR: HD was added to Early-onset Parkinson disease. Sources: Expert list
STR tags were added to STR: HD.
Mode of inheritance for STR: HD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for STR: HD were set to 20301482; 29325606
Phenotypes for STR: HD were set to Huntington disease MIM#143100
Review for STR: HD was set to GREEN
STR: HD was marked as clinically relevant
Added comment: NM_002111.8:c.52_54CAG[X]
Primary mechanism of disease is gain of function
Normal: ≤26 repeats
Intermediate: 27-35 repeats, no risk for proband but expansion possible in the next generation
Pathogenic (reduced penetrance): 36-39 repeats, proband at risk for HD but may not develop symptoms
Pathogenic (full penetrance): ≥40 repeats, development of HD with increased certainty assuming a normal life span
Sources: Expert list
Mendeliome v0.3929 MICA Zornitza Stark Marked gene: MICA as ready
Mendeliome v0.3929 MICA Zornitza Stark Gene: mica has been classified as Red List (Low Evidence).
Mendeliome v0.3929 MICA Zornitza Stark Classified gene: MICA as Red List (low evidence)
Mendeliome v0.3929 MICA Zornitza Stark Gene: mica has been classified as Red List (Low Evidence).
Mendeliome v0.3928 MICA Zornitza Stark reviewed gene: MICA: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None
Ataxia - adult onset v0.67 FXTAS Bryony Thompson changed review comment from: HGVS nomenclature - NM_002024.5:c.-129CGG[X]
RNA-mediated toxicity may result in the FXTAS phenotype, whereas loss of function through methylation silencing of FMR1 is associated with the FXS phenotype.
Intermediate (gray zone, inconclusive, borderline): ~45 to ~54 repeats
Premutation - risk of FXTAS: ~55 to ~200 repeats
Full mutation - fragile X syndrome (FXS): >200 repeats
Sources: Expert list; to: HGVS nomenclature - NM_002024.5:c.-129_-127CGG[X]
RNA-mediated toxicity may result in the FXTAS phenotype, whereas loss of function through methylation silencing of FMR1 is associated with the FXS phenotype.
Intermediate (gray zone, inconclusive, borderline): ~45 to ~54 repeats
Premutation - risk of FXTAS: ~55 to ~200 repeats
Full mutation - fragile X syndrome (FXS): >200 repeats
Sources: Expert list
Ataxia - adult onset v0.67 FXTAS Bryony Thompson Tag STR tag was added to STR: FXTAS.
Hydrops fetalis v0.189 FLVCR2 Zornitza Stark Marked gene: FLVCR2 as ready
Hydrops fetalis v0.189 FLVCR2 Zornitza Stark Gene: flvcr2 has been classified as Red List (Low Evidence).
Hydrops fetalis v0.189 FLVCR2 Zornitza Stark Phenotypes for gene: FLVCR2 were changed from Cystic hygroma; hydrops; hydranencephal; arthrogryposis to Cystic hygroma; hydrops; hydranencephaly; arthrogryposis; Proliferative vasculopathy and hydranencephaly-hydrocephaly syndrome, MIM# 225790
Hydrops fetalis v0.188 FLVCR2 Zornitza Stark Publications for gene: FLVCR2 were set to PMID: 30712878
Hydrops fetalis v0.187 FLVCR2 Zornitza Stark Classified gene: FLVCR2 as Red List (low evidence)
Hydrops fetalis v0.187 FLVCR2 Zornitza Stark Gene: flvcr2 has been classified as Red List (Low Evidence).
Hydrops fetalis v0.186 FLVCR2 Zornitza Stark changed review comment from: Single case reported as part of big prenatal series.; to: Single case reported with cystic hygroma as part of big prenatal series. More typical presentation is with hydrocephalus, fetal akinesia, polyhydramnios.
Hydrops fetalis v0.186 FLVCR2 Zornitza Stark edited their review of gene: FLVCR2: Changed phenotypes: Cystic hygroma, Proliferative vasculopathy and hydranencephaly-hydrocephaly syndrome, MIM# 225790
Hydrops fetalis v0.186 FLVCR2 Zornitza Stark reviewed gene: FLVCR2: Rating: RED; Mode of pathogenicity: None; Publications: 30712878; Phenotypes: Cystic hygroma; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Hydrops fetalis v0.186 FLVCR2 John Christodoulou gene: FLVCR2 was added
gene: FLVCR2 was added to Hydrops fetalis. Sources: Other
Mode of inheritance for gene: FLVCR2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: FLVCR2 were set to PMID: 30712878
Phenotypes for gene: FLVCR2 were set to Cystic hygroma; hydrops; hydranencephal; arthrogryposis
Penetrance for gene: FLVCR2 were set to unknown
Review for gene: FLVCR2 was set to RED
Added comment: In this prospective cohort study, the parents of fetuses who were found to have a structural anomaly in a prenatal ultrasound were screened for possible participation in the study.

DNA samples from 234 (45%) eligible trios were therefore used for analysis of the primary outcome. By use of trio sequence data, we identified diagnostic genetic variants in 24 (10%) families. Mutations with bioinformatic signatures that were indicative of pathogenicity but with insufficient evidence to be considered diagnostic were also evaluated; 46 (20%) of the 234 fetuses assessed were found to have such signatures.
Sources: Other
Lissencephaly and Band Heterotopia v0.60 APC2 Zornitza Stark edited their review of gene: APC2: Changed rating: GREEN
Lissencephaly and Band Heterotopia v0.60 CRADD Zornitza Stark changed review comment from: At least 5 families reported though some were from the Pennsylvania Mennonite population, and had same founder variant (but at least 4 unique variants reported).; to: At least 5 families reported though some were from the Pennsylvania Mennonite population, and had same founder variant (but at least 4 unique variants reported). Brain imaging shows a mild variant of lissencephaly with anterior-predominant pachygyria with shallow and unusually wide sulci and mildly thickened cortex.
Intellectual disability syndromic and non-syndromic v0.2873 CRADD Zornitza Stark Marked gene: CRADD as ready
Intellectual disability syndromic and non-syndromic v0.2873 CRADD Zornitza Stark Gene: cradd has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2873 CRADD Zornitza Stark Phenotypes for gene: CRADD were changed from to Mental retardation, autosomal recessive 34, with variant lissencephaly, MIM# 614499
Intellectual disability syndromic and non-syndromic v0.2872 CRADD Zornitza Stark Publications for gene: CRADD were set to
Intellectual disability syndromic and non-syndromic v0.2871 CRADD Zornitza Stark Mode of inheritance for gene: CRADD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2870 CRADD Zornitza Stark reviewed gene: CRADD: Rating: GREEN; Mode of pathogenicity: None; Publications: 27773430; Phenotypes: Mental retardation, autosomal recessive 34, with variant lissencephaly, MIM# 614499; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3928 CRADD Zornitza Stark Marked gene: CRADD as ready
Mendeliome v0.3928 CRADD Zornitza Stark Gene: cradd has been classified as Green List (High Evidence).
Mendeliome v0.3928 CRADD Zornitza Stark Phenotypes for gene: CRADD were changed from to Mental retardation, autosomal recessive 34, with variant lissencephaly, MIM# 614499
Mendeliome v0.3927 CRADD Zornitza Stark Publications for gene: CRADD were set to
Mendeliome v0.3926 CRADD Zornitza Stark Mode of inheritance for gene: CRADD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3925 CRADD Zornitza Stark reviewed gene: CRADD: Rating: GREEN; Mode of pathogenicity: None; Publications: 27773430; Phenotypes: Mental retardation, autosomal recessive 34, with variant lissencephaly, MIM# 614499; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.60 CRADD Zornitza Stark Marked gene: CRADD as ready
Lissencephaly and Band Heterotopia v0.60 CRADD Zornitza Stark Gene: cradd has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.60 CRADD Zornitza Stark Phenotypes for gene: CRADD were changed from to Mental retardation, autosomal recessive 34, with variant lissencephaly, MIM# 614499
Lissencephaly and Band Heterotopia v0.59 CRADD Zornitza Stark Publications for gene: CRADD were set to
Lissencephaly and Band Heterotopia v0.58 CRADD Zornitza Stark Mode of inheritance for gene: CRADD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Lissencephaly and Band Heterotopia v0.57 CRADD Zornitza Stark reviewed gene: CRADD: Rating: GREEN; Mode of pathogenicity: None; Publications: 27773430; Phenotypes: Mental retardation, autosomal recessive 34, with variant lissencephaly, MIM# 614499; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3925 TDGF1 Zornitza Stark Marked gene: TDGF1 as ready
Mendeliome v0.3925 TDGF1 Zornitza Stark Gene: tdgf1 has been classified as Red List (Low Evidence).
Mendeliome v0.3925 TDGF1 Zornitza Stark Phenotypes for gene: TDGF1 were changed from to Forebrain abnormalities
Mendeliome v0.3924 TDGF1 Zornitza Stark Publications for gene: TDGF1 were set to
Mendeliome v0.3923 TDGF1 Zornitza Stark Mode of inheritance for gene: TDGF1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Mendeliome v0.3922 TDGF1 Zornitza Stark Classified gene: TDGF1 as Red List (low evidence)
Mendeliome v0.3922 TDGF1 Zornitza Stark Gene: tdgf1 has been classified as Red List (Low Evidence).
Mendeliome v0.3921 TDGF1 Zornitza Stark reviewed gene: TDGF1: Rating: RED; Mode of pathogenicity: None; Publications: 12073012; Phenotypes: Forebrain abnormalities; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Holoprosencephaly and septo-optic dysplasia v0.43 TDGF1 Zornitza Stark Marked gene: TDGF1 as ready
Holoprosencephaly and septo-optic dysplasia v0.43 TDGF1 Zornitza Stark Gene: tdgf1 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v0.2870 TDGF1 Zornitza Stark Marked gene: TDGF1 as ready
Intellectual disability syndromic and non-syndromic v0.2870 TDGF1 Zornitza Stark Added comment: Comment when marking as ready: Variant reported is present in 46 hets in gnomad.
Intellectual disability syndromic and non-syndromic v0.2870 TDGF1 Zornitza Stark Gene: tdgf1 has been classified as Red List (Low Evidence).
Intellectual disability syndromic and non-syndromic v0.2870 TDGF1 Zornitza Stark Tag disputed tag was added to gene: TDGF1.
Holoprosencephaly and septo-optic dysplasia v0.43 TDGF1 Zornitza Stark Phenotypes for gene: TDGF1 were changed from to Forebrain abnormalities
Holoprosencephaly and septo-optic dysplasia v0.42 TDGF1 Zornitza Stark Publications for gene: TDGF1 were set to
Holoprosencephaly and septo-optic dysplasia v0.41 TDGF1 Zornitza Stark Mode of inheritance for gene: TDGF1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Holoprosencephaly and septo-optic dysplasia v0.40 TDGF1 Zornitza Stark Classified gene: TDGF1 as Red List (low evidence)
Holoprosencephaly and septo-optic dysplasia v0.40 TDGF1 Zornitza Stark Gene: tdgf1 has been classified as Red List (Low Evidence).
Holoprosencephaly and septo-optic dysplasia v0.39 TDGF1 Zornitza Stark Tag disputed tag was added to gene: TDGF1.
Holoprosencephaly and septo-optic dysplasia v0.39 TDGF1 Zornitza Stark reviewed gene: TDGF1: Rating: RED; Mode of pathogenicity: None; Publications: 12073012; Phenotypes: Forebrain abnormalities; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Ataxia - adult onset v0.67 FXTAS Bryony Thompson edited their review of STR: FXTAS: Changed publications: 23765048, 25227148, 11445641
Ataxia - adult onset v0.67 FMR1 Bryony Thompson Deleted their comment
Ataxia - adult onset v0.67 FMR1 Bryony Thompson Classified gene: FMR1 as Green List (high evidence)
Ataxia - adult onset v0.67 FMR1 Bryony Thompson Added comment: Comment on list classification: Ataxia is caused by the premutation repeat expansion.
Ataxia - adult onset v0.67 FMR1 Bryony Thompson Gene: fmr1 has been classified as Green List (High Evidence).
Ataxia - adult onset v0.66 FXTAS Bryony Thompson Classified STR: FXTAS as Green List (high evidence)
Ataxia - adult onset v0.66 FXTAS Bryony Thompson Str: fxtas has been classified as Green List (High Evidence).
Ataxia - adult onset v0.65 FXTAS Bryony Thompson STR: FXTAS was added
STR: FXTAS was added to Ataxia - adult onset. Sources: Expert list
Mode of inheritance for STR: FXTAS was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)
Publications for STR: FXTAS were set to 23765048; 25227148
Phenotypes for STR: FXTAS were set to Fragile X tremor/ataxia syndrome MIM#300623
Review for STR: FXTAS was set to GREEN
STR: FXTAS was marked as clinically relevant
Added comment: HGVS nomenclature - NM_002024.5:c.-129CGG[X]
RNA-mediated toxicity may result in the FXTAS phenotype, whereas loss of function through methylation silencing of FMR1 is associated with the FXS phenotype.
Intermediate (gray zone, inconclusive, borderline): ~45 to ~54 repeats
Premutation - risk of FXTAS: ~55 to ~200 repeats
Full mutation - fragile X syndrome (FXS): >200 repeats
Sources: Expert list
Holoprosencephaly and septo-optic dysplasia v0.39 STIL Zornitza Stark Marked gene: STIL as ready
Holoprosencephaly and septo-optic dysplasia v0.39 STIL Zornitza Stark Gene: stil has been classified as Red List (Low Evidence).
Holoprosencephaly and septo-optic dysplasia v0.39 STIL Zornitza Stark Phenotypes for gene: STIL were changed from to Microcephaly 7, primary, autosomal recessive, MIM# 612703
Holoprosencephaly and septo-optic dysplasia v0.38 STIL Zornitza Stark Publications for gene: STIL were set to
Holoprosencephaly and septo-optic dysplasia v0.37 STIL Zornitza Stark Mode of inheritance for gene: STIL was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Holoprosencephaly and septo-optic dysplasia v0.36 STIL Zornitza Stark Classified gene: STIL as Red List (low evidence)
Holoprosencephaly and septo-optic dysplasia v0.36 STIL Zornitza Stark Gene: stil has been classified as Red List (Low Evidence).
Holoprosencephaly and septo-optic dysplasia v0.35 STIL Zornitza Stark reviewed gene: STIL: Rating: RED; Mode of pathogenicity: None; Publications: 25218063; Phenotypes: Microcephaly 7, primary, autosomal recessive, MIM# 612703; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Holoprosencephaly and septo-optic dysplasia v0.35 HESX1 Zornitza Stark Marked gene: HESX1 as ready
Holoprosencephaly and septo-optic dysplasia v0.35 HESX1 Zornitza Stark Gene: hesx1 has been classified as Green List (High Evidence).
Holoprosencephaly and septo-optic dysplasia v0.35 HESX1 Zornitza Stark Phenotypes for gene: HESX1 were changed from to Septooptic dysplasia, MIM# 182230
Holoprosencephaly and septo-optic dysplasia v0.34 HESX1 Zornitza Stark Mode of inheritance for gene: HESX1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Holoprosencephaly and septo-optic dysplasia v0.33 HESX1 Zornitza Stark reviewed gene: HESX1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Septooptic dysplasia, MIM# 182230; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Holoprosencephaly and septo-optic dysplasia v0.33 GLI3 Zornitza Stark Marked gene: GLI3 as ready
Holoprosencephaly and septo-optic dysplasia v0.33 GLI3 Zornitza Stark Gene: gli3 has been classified as Red List (Low Evidence).
Holoprosencephaly and septo-optic dysplasia v0.33 GLI3 Zornitza Stark Phenotypes for gene: GLI3 were changed from to Pallister-Hall syndrome, MIM# 146510
Holoprosencephaly and septo-optic dysplasia v0.32 GLI3 Zornitza Stark Publications for gene: GLI3 were set to
Holoprosencephaly and septo-optic dysplasia v0.31 GLI3 Zornitza Stark Mode of inheritance for gene: GLI3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Holoprosencephaly and septo-optic dysplasia v0.30 GLI3 Zornitza Stark Classified gene: GLI3 as Red List (low evidence)
Holoprosencephaly and septo-optic dysplasia v0.30 GLI3 Zornitza Stark Gene: gli3 has been classified as Red List (Low Evidence).
Holoprosencephaly and septo-optic dysplasia v0.29 GLI3 Zornitza Stark reviewed gene: GLI3: Rating: RED; Mode of pathogenicity: None; Publications: 24736735; Phenotypes: Pallister-Hall syndrome, MIM# 146510; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Hydrocephalus_Ventriculomegaly v0.51 DLL1 Zornitza Stark Marked gene: DLL1 as ready
Hydrocephalus_Ventriculomegaly v0.51 DLL1 Zornitza Stark Gene: dll1 has been classified as Green List (High Evidence).
Hydrocephalus_Ventriculomegaly v0.51 DLL1 Zornitza Stark Classified gene: DLL1 as Green List (high evidence)
Hydrocephalus_Ventriculomegaly v0.51 DLL1 Zornitza Stark Gene: dll1 has been classified as Green List (High Evidence).
Hydrocephalus_Ventriculomegaly v0.50 DLL1 Zornitza Stark gene: DLL1 was added
gene: DLL1 was added to Hydrocephalus_Ventriculomegaly. Sources: Expert list
Mode of inheritance for gene: DLL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: DLL1 were set to 31353024
Phenotypes for gene: DLL1 were set to Neurodevelopmental disorder with nonspecific brain abnormalities and with or without seizures, MIM# 618709
Review for gene: DLL1 was set to GREEN
Added comment: 14 individuals from 11 families reported. All 11 patients who underwent brain imaging showed nonspecific and variable abnormalities, including hydrocephalus, ventriculomegaly, thin, short, or dysplastic corpus callosum, subtle cortical dysplasia, and small cerebellum or pons. One patient had periventricular nodular heterotopia.
Sources: Expert list
Callosome v0.194 DLL1 Zornitza Stark Marked gene: DLL1 as ready
Callosome v0.194 DLL1 Zornitza Stark Gene: dll1 has been classified as Green List (High Evidence).
Callosome v0.194 DLL1 Zornitza Stark Classified gene: DLL1 as Green List (high evidence)
Callosome v0.194 DLL1 Zornitza Stark Gene: dll1 has been classified as Green List (High Evidence).
Callosome v0.193 DLL1 Zornitza Stark gene: DLL1 was added
gene: DLL1 was added to Callosome. Sources: Expert list
Mode of inheritance for gene: DLL1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: DLL1 were set to 31353024
Phenotypes for gene: DLL1 were set to Neurodevelopmental disorder with nonspecific brain abnormalities and with or without seizures, MIM# 618709
Review for gene: DLL1 was set to GREEN
Added comment: 14 individuals from 11 families reported. All 11 patients who underwent brain imaging showed nonspecific and variable abnormalities, including hydrocephalus, ventriculomegaly, thin, short, or dysplastic corpus callosum, subtle cortical dysplasia, and small cerebellum or pons. One patient had periventricular nodular heterotopia.
Sources: Expert list
Holoprosencephaly and septo-optic dysplasia v0.29 DLL1 Zornitza Stark Marked gene: DLL1 as ready
Holoprosencephaly and septo-optic dysplasia v0.29 DLL1 Zornitza Stark Gene: dll1 has been classified as Red List (Low Evidence).
Holoprosencephaly and septo-optic dysplasia v0.29 DLL1 Zornitza Stark Phenotypes for gene: DLL1 were changed from to Neurodevelopmental disorder with nonspecific brain abnormalities and with or without seizures, MIM# 618709
Holoprosencephaly and septo-optic dysplasia v0.28 DLL1 Zornitza Stark Publications for gene: DLL1 were set to
Holoprosencephaly and septo-optic dysplasia v0.27 DLL1 Zornitza Stark Mode of inheritance for gene: DLL1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Holoprosencephaly and septo-optic dysplasia v0.26 DLL1 Zornitza Stark Classified gene: DLL1 as Red List (low evidence)
Holoprosencephaly and septo-optic dysplasia v0.26 DLL1 Zornitza Stark Gene: dll1 has been classified as Red List (Low Evidence).
Holoprosencephaly and septo-optic dysplasia v0.25 DLL1 Zornitza Stark reviewed gene: DLL1: Rating: RED; Mode of pathogenicity: None; Publications: 31353024; Phenotypes: Neurodevelopmental disorder with nonspecific brain abnormalities and with or without seizures, MIM# 618709; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Holoprosencephaly and septo-optic dysplasia v0.25 CHD7 Zornitza Stark Marked gene: CHD7 as ready
Holoprosencephaly and septo-optic dysplasia v0.25 CHD7 Zornitza Stark Gene: chd7 has been classified as Green List (High Evidence).
Holoprosencephaly and septo-optic dysplasia v0.25 CHD7 Zornitza Stark Classified gene: CHD7 as Green List (high evidence)
Holoprosencephaly and septo-optic dysplasia v0.25 CHD7 Zornitza Stark Gene: chd7 has been classified as Green List (High Evidence).
Holoprosencephaly and septo-optic dysplasia v0.24 CHD7 Zornitza Stark gene: CHD7 was added
gene: CHD7 was added to Holoprosencephaly and septo-optic dysplasia. Sources: Expert list
Mode of inheritance for gene: CHD7 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: CHD7 were set to 11562938; 28805615; 20104611; 17001700
Phenotypes for gene: CHD7 were set to Smith-Lemli-Opitz syndrome, 270400; alobar holoprosencephaly (HPE)
Review for gene: CHD7 was set to GREEN
Added comment: Reports of HPE phenotype.
Sources: Expert list
Mendeliome v0.3921 GABRA6 Zornitza Stark Marked gene: GABRA6 as ready
Mendeliome v0.3921 GABRA6 Zornitza Stark Gene: gabra6 has been classified as Red List (Low Evidence).
Mendeliome v0.3921 GABRA6 Zornitza Stark gene: GABRA6 was added
gene: GABRA6 was added to Mendeliome. Sources: Literature
Mode of inheritance for gene: GABRA6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GABRA6 were set to 21930603; 29215089; 19429026
Phenotypes for gene: GABRA6 were set to Benign familial inherited epilepsy; Childhood absence epilepsy
Review for gene: GABRA6 was set to RED
Added comment: One report in a cohort of patients with BFIE. Potential susceptibility allele in CAE.
Sources: Literature
Genetic Epilepsy v0.798 GABRA6 Zornitza Stark Classified gene: GABRA6 as Red List (low evidence)
Genetic Epilepsy v0.798 GABRA6 Zornitza Stark Gene: gabra6 has been classified as Red List (Low Evidence).
Genetic Epilepsy v0.797 GABRA6 Zornitza Stark Classified gene: GABRA6 as Red List (low evidence)
Genetic Epilepsy v0.797 GABRA6 Zornitza Stark Gene: gabra6 has been classified as Red List (Low Evidence).
Lissencephaly and Band Heterotopia v0.57 ASPM Zornitza Stark Marked gene: ASPM as ready
Lissencephaly and Band Heterotopia v0.57 ASPM Zornitza Stark Gene: aspm has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.57 ASPM Zornitza Stark Classified gene: ASPM as Green List (high evidence)
Lissencephaly and Band Heterotopia v0.57 ASPM Zornitza Stark Gene: aspm has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2870 TMTC3 Zornitza Stark Marked gene: TMTC3 as ready
Intellectual disability syndromic and non-syndromic v0.2870 TMTC3 Zornitza Stark Gene: tmtc3 has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2870 TMTC3 Zornitza Stark Phenotypes for gene: TMTC3 were changed from to Lissencephaly 8 (MIM#617255)
Intellectual disability syndromic and non-syndromic v0.2869 TMTC3 Zornitza Stark Publications for gene: TMTC3 were set to
Intellectual disability syndromic and non-syndromic v0.2868 TMTC3 Zornitza Stark Mode of inheritance for gene: TMTC3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2867 TMTC3 Zornitza Stark reviewed gene: TMTC3: Rating: GREEN; Mode of pathogenicity: None; Publications: 27773428, 28973161; Phenotypes: Lissencephaly 8 (MIM#617255); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3920 TMTC3 Zornitza Stark Marked gene: TMTC3 as ready
Mendeliome v0.3920 TMTC3 Zornitza Stark Gene: tmtc3 has been classified as Green List (High Evidence).
Mendeliome v0.3920 TMTC3 Zornitza Stark Phenotypes for gene: TMTC3 were changed from to Lissencephaly 8 (MIM#617255)
Mendeliome v0.3919 TMTC3 Zornitza Stark Publications for gene: TMTC3 were set to
Mendeliome v0.3918 TMTC3 Zornitza Stark Mode of inheritance for gene: TMTC3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3917 TMTC3 Zornitza Stark reviewed gene: TMTC3: Rating: GREEN; Mode of pathogenicity: None; Publications: 27773428, 28973161; Phenotypes: Lissencephaly 8 (MIM#617255); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Periventricular Grey Matter Heterotopia v0.14 TMTC3 Zornitza Stark Marked gene: TMTC3 as ready
Periventricular Grey Matter Heterotopia v0.14 TMTC3 Zornitza Stark Gene: tmtc3 has been classified as Red List (Low Evidence).
Periventricular Grey Matter Heterotopia v0.14 TMTC3 Zornitza Stark Classified gene: TMTC3 as Red List (low evidence)
Periventricular Grey Matter Heterotopia v0.14 TMTC3 Zornitza Stark Gene: tmtc3 has been classified as Red List (Low Evidence).
Cobblestone Malformations v0.8 TMTC3 Zornitza Stark Marked gene: TMTC3 as ready
Cobblestone Malformations v0.8 TMTC3 Zornitza Stark Gene: tmtc3 has been classified as Green List (High Evidence).
Cobblestone Malformations v0.8 TMTC3 Zornitza Stark Phenotypes for gene: TMTC3 were changed from to Lissencephaly 8 (MIM#617255)
Cobblestone Malformations v0.7 TMTC3 Zornitza Stark Publications for gene: TMTC3 were set to
Cobblestone Malformations v0.6 TMTC3 Zornitza Stark Mode of inheritance for gene: TMTC3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Tubulinopathies v0.13 TUBGCP4 Zornitza Stark Marked gene: TUBGCP4 as ready
Tubulinopathies v0.13 TUBGCP4 Zornitza Stark Gene: tubgcp4 has been classified as Red List (Low Evidence).
Genetic Epilepsy v0.796 GABRA6 Anna Le Fevre gene: GABRA6 was added
gene: GABRA6 was added to Genetic Epilepsy. Sources: Literature
Mode of inheritance for gene: GABRA6 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Publications for gene: GABRA6 were set to PMID: 21930603; 29215089; 19429026
Phenotypes for gene: GABRA6 were set to BFIE; CAE
Penetrance for gene: GABRA6 were set to unknown
Review for gene: GABRA6 was set to RED
Added comment: One report in a cohort of patients with BFIE
Potential susceptibility allele in CAE
Sources: Literature
Tubulinopathies v0.13 TUBGCP4 Zornitza Stark Phenotypes for gene: TUBGCP4 were changed from to Microcephaly and chorioretinopathy, autosomal recessive, 3 (MIM#616335)
Tubulinopathies v0.12 TUBGCP4 Zornitza Stark Publications for gene: TUBGCP4 were set to
Tubulinopathies v0.11 TUBGCP4 Zornitza Stark Mode of inheritance for gene: TUBGCP4 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Tubulinopathies v0.10 TUBGCP4 Zornitza Stark Classified gene: TUBGCP4 as Red List (low evidence)
Tubulinopathies v0.10 TUBGCP4 Zornitza Stark Gene: tubgcp4 has been classified as Red List (Low Evidence).
Microcephaly v0.151 ARFGEF2 Zornitza Stark Marked gene: ARFGEF2 as ready
Microcephaly v0.151 ARFGEF2 Zornitza Stark Gene: arfgef2 has been classified as Green List (High Evidence).
Microcephaly v0.151 ARFGEF2 Zornitza Stark Phenotypes for gene: ARFGEF2 were changed from to Periventricular heterotopia with microcephaly (MIM#608097)
Microcephaly v0.150 ARFGEF2 Zornitza Stark Publications for gene: ARFGEF2 were set to
Microcephaly v0.149 ARFGEF2 Zornitza Stark Mode of inheritance for gene: ARFGEF2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Microcephaly v0.148 ARFGEF2 Zornitza Stark reviewed gene: ARFGEF2: Rating: GREEN; Mode of pathogenicity: None; Publications: 25160555, 26126837, 23812912; Phenotypes: Periventricular heterotopia with microcephaly (MIM#608097); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3917 ARFGEF2 Zornitza Stark Marked gene: ARFGEF2 as ready
Mendeliome v0.3917 ARFGEF2 Zornitza Stark Gene: arfgef2 has been classified as Green List (High Evidence).
Mendeliome v0.3917 ARFGEF2 Zornitza Stark Phenotypes for gene: ARFGEF2 were changed from to Periventricular heterotopia with microcephaly (MIM#608097)
Mendeliome v0.3916 ARFGEF2 Zornitza Stark Publications for gene: ARFGEF2 were set to
Mendeliome v0.3915 ARFGEF2 Zornitza Stark Mode of inheritance for gene: ARFGEF2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Mendeliome v0.3914 ARFGEF2 Zornitza Stark reviewed gene: ARFGEF2: Rating: GREEN; Mode of pathogenicity: None; Publications: 25160555, 26126837, 23812912; Phenotypes: Periventricular heterotopia with microcephaly (MIM#608097); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Periventricular Grey Matter Heterotopia v0.13 ARFGEF2 Zornitza Stark Marked gene: ARFGEF2 as ready
Periventricular Grey Matter Heterotopia v0.13 ARFGEF2 Zornitza Stark Gene: arfgef2 has been classified as Green List (High Evidence).
Periventricular Grey Matter Heterotopia v0.13 ARFGEF2 Zornitza Stark Phenotypes for gene: ARFGEF2 were changed from to Periventricular heterotopia with microcephaly (MIM#608097)
Periventricular Grey Matter Heterotopia v0.12 ARFGEF2 Zornitza Stark Publications for gene: ARFGEF2 were set to
Periventricular Grey Matter Heterotopia v0.11 ARFGEF2 Zornitza Stark Mode of inheritance for gene: ARFGEF2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Polymicrogyria and Schizencephaly v0.97 AKT3 Zornitza Stark Marked gene: AKT3 as ready
Polymicrogyria and Schizencephaly v0.97 AKT3 Zornitza Stark Gene: akt3 has been classified as Green List (High Evidence).
Polymicrogyria and Schizencephaly v0.97 AKT3 Zornitza Stark Phenotypes for gene: AKT3 were changed from to Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 2 (MIM#615937)
Polymicrogyria and Schizencephaly v0.96 AKT3 Zornitza Stark Publications for gene: AKT3 were set to
Polymicrogyria and Schizencephaly v0.95 AKT3 Zornitza Stark Mode of inheritance for gene: AKT3 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Congenital Heart Defect v0.61 TBX1 Zornitza Stark Marked gene: TBX1 as ready
Congenital Heart Defect v0.61 TBX1 Zornitza Stark Gene: tbx1 has been classified as Green List (High Evidence).
Congenital Heart Defect v0.61 TBX1 Zornitza Stark Phenotypes for gene: TBX1 were changed from to DiGeorge syndrome (MIM#188400)
Congenital Heart Defect v0.60 TBX1 Zornitza Stark Mode of pathogenicity for gene: TBX1 was changed from None to None
Congenital Heart Defect v0.59 TBX1 Zornitza Stark Publications for gene: TBX1 were set to
Congenital Heart Defect v0.58 TBX1 Zornitza Stark Mode of pathogenicity for gene: TBX1 was changed from to None
Congenital Heart Defect v0.57 TBX1 Zornitza Stark Mode of inheritance for gene: TBX1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Polymicrogyria and Schizencephaly v0.94 SMO Zornitza Stark Marked gene: SMO as ready
Polymicrogyria and Schizencephaly v0.94 SMO Zornitza Stark Gene: smo has been classified as Amber List (Moderate Evidence).
Polymicrogyria and Schizencephaly v0.94 SMO Zornitza Stark Classified gene: SMO as Amber List (moderate evidence)
Polymicrogyria and Schizencephaly v0.94 SMO Zornitza Stark Gene: smo has been classified as Amber List (Moderate Evidence).
Polymicrogyria and Schizencephaly v0.93 SMO Zornitza Stark Tag somatic tag was added to gene: SMO.
Lissencephaly and Band Heterotopia v0.56 ACTG1 Zornitza Stark Marked gene: ACTG1 as ready
Lissencephaly and Band Heterotopia v0.56 ACTG1 Zornitza Stark Gene: actg1 has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.56 ACTG1 Zornitza Stark Phenotypes for gene: ACTG1 were changed from to Baraitser-Winter syndrome 2 (MIM#614583)
Lissencephaly and Band Heterotopia v0.55 ACTG1 Zornitza Stark Publications for gene: ACTG1 were set to
Lissencephaly and Band Heterotopia v0.54 ACTG1 Zornitza Stark Mode of inheritance for gene: ACTG1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.53 TMX2 Zornitza Stark Marked gene: TMX2 as ready
Lissencephaly and Band Heterotopia v0.53 TMX2 Zornitza Stark Gene: tmx2 has been classified as Amber List (Moderate Evidence).
Lissencephaly and Band Heterotopia v0.53 TMX2 Zornitza Stark Classified gene: TMX2 as Amber List (moderate evidence)
Lissencephaly and Band Heterotopia v0.53 TMX2 Zornitza Stark Gene: tmx2 has been classified as Amber List (Moderate Evidence).
Lissencephaly and Band Heterotopia v0.52 ASPM Ain Roesley gene: ASPM was added
gene: ASPM was added to Lissencephaly and Band Heterotopia. Sources: Literature
Mode of inheritance for gene: ASPM was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: ASPM were set to 18452193; 19332161; 19770472; 27250695
Phenotypes for gene: ASPM were set to Microcephaly 5, primary, autosomal recessive (MIM#608716)
Penetrance for gene: ASPM were set to unknown
Review for gene: ASPM was set to GREEN
Added comment: PMID: 18452193;
Consanguineous family with 2 affecteds with simplified pattern of gyration
- homozygous for a PTV

PMID: 19332161;
- consanguineous Algerian family in which 3/5 affecteds presented with simplified cortical gyration
- cHet for 2 PTVs

PMID: 19770472;
- 11 families with 16 affecteds
- 9/12 affecteds have simplified frontal and/or occipital gyral pattern
- All PTVs reported

PMID: 27250695;
- 15 families with 21 affecteds
- 4 had coarse gyri and 8 had simplified gyral pattern
- all PTVs
Sources: Literature
Polymicrogyria and Schizencephaly v0.93 TMX2 Zornitza Stark reviewed gene: TMX2: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Neurodevelopmental disorder with microcephaly, cortical malformations, and spasticity MIM#618730; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Polymicrogyria and Schizencephaly v0.93 TMX2 Zornitza Stark Marked gene: TMX2 as ready
Polymicrogyria and Schizencephaly v0.93 TMX2 Zornitza Stark Gene: tmx2 has been classified as Green List (High Evidence).
Polymicrogyria and Schizencephaly v0.93 TMX2 Zornitza Stark Classified gene: TMX2 as Green List (high evidence)
Polymicrogyria and Schizencephaly v0.93 TMX2 Zornitza Stark Gene: tmx2 has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.52 ACTB Zornitza Stark Marked gene: ACTB as ready
Lissencephaly and Band Heterotopia v0.52 ACTB Zornitza Stark Gene: actb has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.52 ACTB Zornitza Stark Phenotypes for gene: ACTB were changed from to Baraitser-Winter syndrome 1 (MIM#243310)
Lissencephaly and Band Heterotopia v0.51 ACTB Zornitza Stark Publications for gene: ACTB were set to
Lissencephaly and Band Heterotopia v0.50 ACTB Zornitza Stark Mode of inheritance for gene: ACTB was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Lissencephaly and Band Heterotopia v0.49 VLDLR Zornitza Stark Marked gene: VLDLR as ready
Lissencephaly and Band Heterotopia v0.49 VLDLR Zornitza Stark Gene: vldlr has been classified as Green List (High Evidence).
Lissencephaly and Band Heterotopia v0.49 VLDLR Zornitza Stark Phenotypes for gene: VLDLR were changed from to Cerebellar hypoplasia and mental retardation with or without quadrupedal locomotion 1 (MIM#224050)
Lissencephaly and Band Heterotopia v0.48 VLDLR Zornitza Stark Publications for gene: VLDLR were set to
Lissencephaly and Band Heterotopia v0.47 VLDLR Zornitza Stark Mode of inheritance for gene: VLDLR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Periventricular Grey Matter Heterotopia v0.10 TMTC3 Paul De Fazio changed review comment from: Mostly associated with cobblestone lissencephaly in (6 unrelated families with biallelic variants, PMID: 27773428).

However in 3/4 siblings of another family (PMID: 28973161) biallelic variants were not associated with cobblestone lissencephaly, but periventricular hetertopia instead. The 4th sibling had a normal brain. Animal model studies (Drosophila and rat) support a role for this gene in neurodevelopment.

Although I thought it worth having this gene on this panel I have rated it Red as it is a single family reported with this phenotype, with not all members affected, and it is a different phenotype to that reported previously (i.e. very much 'low evidence').
Sources: Literature; to: Mostly associated with cobblestone lissencephaly in (6 unrelated families with biallelic variants, PMID: 27773428).

However in 3/4 siblings of another family (PMID: 28973161) biallelic variants were not associated with cobblestone lissencephaly, but periventricular heterotopia instead. The 4th sibling had a normal brain. Animal model studies (Drosophila and rat) support a role for this gene in neurodevelopment.

Although I thought it worth having this gene on this panel I have rated it Red as it is a single family reported with this phenotype, with not all members affected, and it is a different phenotype to that reported previously (i.e. very much 'low evidence').
Sources: Literature
Periventricular Grey Matter Heterotopia v0.10 TMTC3 Paul De Fazio gene: TMTC3 was added
gene: TMTC3 was added to Periventricular Grey Matter Heterotopia. Sources: Literature
Mode of inheritance for gene: TMTC3 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMTC3 were set to 27773428; 28973161
Phenotypes for gene: TMTC3 were set to Lissencephaly 8 (MIM#617255)
Review for gene: TMTC3 was set to RED
gene: TMTC3 was marked as current diagnostic
Added comment: Mostly associated with cobblestone lissencephaly in (6 unrelated families with biallelic variants, PMID: 27773428).

However in 3/4 siblings of another family (PMID: 28973161) biallelic variants were not associated with cobblestone lissencephaly, but periventricular hetertopia instead. The 4th sibling had a normal brain. Animal model studies (Drosophila and rat) support a role for this gene in neurodevelopment.

Although I thought it worth having this gene on this panel I have rated it Red as it is a single family reported with this phenotype, with not all members affected, and it is a different phenotype to that reported previously (i.e. very much 'low evidence').
Sources: Literature
Cobblestone Malformations v0.5 TMTC3 Paul De Fazio changed review comment from: Associated with cobblestone lissencephaly in 6 unrelated families with biallelic variants (PMID: 27773428). Most affected individuals also showed brainstem and cerebellum hypoplasia, as well as ventriculomegaly.

In 3/4 siblings of another family (PMID: 28973161) biallelic variants were not associated with cobblestone lissencephaly, but periventricular hetertopia instead. The 4th sibling had a normal brain. Animal model studies (Drosophila and rat) support a role for this gene in neurodevelopment.; to: Associated with cobblestone lissencephaly in 6 unrelated families with biallelic variants (PMID: 27773428). Most affected individuals also showed brainstem and cerebellum hypoplasia, as well as ventriculomegaly. One individual had polymicrogyria.

In 3/4 siblings of another family (PMID: 28973161) biallelic variants were not associated with cobblestone lissencephaly, but periventricular hetertopia instead. The 4th sibling had a normal brain. Animal model studies (Drosophila and rat) support a role for this gene in neurodevelopment.
Cobblestone Malformations v0.5 TMTC3 Paul De Fazio reviewed gene: TMTC3: Rating: GREEN; Mode of pathogenicity: None; Publications: 27773428, 28973161; Phenotypes: Lissencephaly 8 (MIM#617255); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Skeletal dysplasia v0.41 ABL1 Bryony Thompson Marked gene: ABL1 as ready
Skeletal dysplasia v0.41 ABL1 Bryony Thompson Gene: abl1 has been classified as Green List (High Evidence).
Skeletal dysplasia v0.41 ABL1 Bryony Thompson Publications for gene: ABL1 were set to 28288113
Skeletal dysplasia v0.40 ABL1 Bryony Thompson Classified gene: ABL1 as Green List (high evidence)
Skeletal dysplasia v0.40 ABL1 Bryony Thompson Gene: abl1 has been classified as Green List (High Evidence).
Skeletal dysplasia v0.39 ABL1 Bryony Thompson reviewed gene: ABL1: Rating: GREEN; Mode of pathogenicity: Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments; Publications: 28288113, 30855488, 32643838; Phenotypes: Congenital heart defects and skeletal malformations syndrome MIM#617602; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Tubulinopathies v0.9 TUBGCP4 Paul De Fazio reviewed gene: TUBGCP4: Rating: RED; Mode of pathogenicity: None; Publications: 25817018, 32270730; Phenotypes: Microcephaly and chorioretinopathy, autosomal recessive, 3 (MIM#616335); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Periventricular Grey Matter Heterotopia v0.10 ARFGEF2 Ain Roesley reviewed gene: ARFGEF2: Rating: GREEN; Mode of pathogenicity: None; Publications: 25160555, 26126837, 23812912; Phenotypes: Periventricular heterotopia with microcephaly (MIM#608097); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Polymicrogyria and Schizencephaly v0.92 AKT3 Ain Roesley changed review comment from: PMID: 28969385;
- 15/20 patients with constitutional mutation in AKT3 presented with polymicrogyria; to: PMID: 28969385;
- 15/20 patients with constitutional mutation in AKT3 presented with polymicrogyria
- de novo and missense
Polymicrogyria and Schizencephaly v0.92 AKT3 Ain Roesley reviewed gene: AKT3: Rating: GREEN; Mode of pathogenicity: None; Publications: 28969385; Phenotypes: Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 2 (MIM#615937); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Congenital Heart Defect v0.56 TBX1 Crystle Lee edited their review of gene: TBX1: Changed rating: GREEN
Congenital Heart Defect v0.56 TBX1 Crystle Lee reviewed gene: TBX1: Rating: AMBER; Mode of pathogenicity: Other; Publications: 31428446, 32110744, 29250159, 30137364, 24998776, 28272434; Phenotypes: DiGeorge syndrome (MIM#188400); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Polymicrogyria and Schizencephaly v0.92 SMO Paul De Fazio gene: SMO was added
gene: SMO was added to Polymicrogyria and Schizencephaly. Sources: Literature
Mode of inheritance for gene: SMO was set to Unknown
Publications for gene: SMO were set to 27236920; 24859340
Phenotypes for gene: SMO were set to Curry-Jones syndrome, somatic mosaic MIM#601707
Mode of pathogenicity for gene: SMO was set to Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments
Review for gene: SMO was set to AMBER
gene: SMO was marked as current diagnostic
Added comment: PMID 27236920 summarises the clinical and molecular findings in 8 unrelated individuals (including individuals reported previously). All 8 had the same somatic mosaic missense variant c.1234C>T p.(Leu412Phe) (absent from gnomAD). 2 had polymicrogyria. Other brain abnormalities reported include agenesis of the corpus callosum, hemimegalencephaly, ventriculomegaly. 1 individual was reported to have a normal brain.

In mouse embryonic fibroblasts, this variant results in constitutive activation (PMID: 24859340).

Other, biallelic germline variants in this gene are associated with Pallister-Hall-like syndrome (MIM#241800) but the MRI findings in individuals with this syndrome don't appear to be applicable to this panel.
Sources: Literature
Lissencephaly and Band Heterotopia v0.46 ACTG1 Ain Roesley reviewed gene: ACTG1: Rating: GREEN; Mode of pathogenicity: None; Publications: 29671837, 27240540, 25052316; Phenotypes: Baraitser-Winter syndrome 2 (MIM#614583); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Lissencephaly and Band Heterotopia v0.46 TMX2 Paul De Fazio gene: TMX2 was added
gene: TMX2 was added to Lissencephaly and Band Heterotopia. Sources: Literature
Mode of inheritance for gene: TMX2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMX2 were set to 31735293; 31586943
Phenotypes for gene: TMX2 were set to Neurodevelopmental disorder with microcephaly, cortical malformations, and spasticity MIM#618730
Review for gene: TMX2 was set to AMBER
gene: TMX2 was marked as current diagnostic
Added comment: Summary: 14 families reported with biallelic variants and neurodevelopmental disorder, but individuals from 5 families had pachygyria/lissencephaly, and 4 of those families shared the same variant.

PMID 31735293: 2 unrelated individuals (out of 14 total from 10 families) with biallelic variants had pachygyria on MRI. Other individuals had brain atrophy or polymicrogyria. One individual had a normal MRI.

PMID 31586943: 8 individuals from 4 families had the same homozygous missense variant (10 heterozygotes in gnomAD.). All of the individuals had lissencephaly. This variant was also identified in one individual from PMID 31735293, who had polymicrogyria.
Sources: Literature
Polymicrogyria and Schizencephaly v0.92 TMX2 Paul De Fazio changed review comment from: PMID 31735293: 5 unrelated individuals (out of 14 total from 10 families) with biallelic variants had polymicrogyria on MRI. Other individuals had brain atrophy or pachygyria. One individual had a normal MRI.

PMID 31586943: 8 individuals from 4 families had the same homozygous missense variant (10 heterozygotes in gnomAD.). All of the individuals had lissencephaly, NOT polymycrogyria. This variant was also identified in one individual from PMID 31735293, who did have polymicrogyria.
Sources: Literature; to: Summary: 14 families reported with biallelic variants and neurodevelopmental disorder, but individuals from 5 families had polymicrogyria.

PMID 31735293: 5 unrelated individuals (out of 14 total from 10 families) with biallelic variants had polymicrogyria on MRI. Other individuals had brain atrophy or pachygyria. One individual had a normal MRI.

PMID 31586943: 8 individuals from 4 families had the same homozygous missense variant (10 heterozygotes in gnomAD.). All of the individuals had lissencephaly, NOT polymycrogyria. This variant was also identified in one individual from PMID 31735293, who did have polymicrogyria.
Sources: Literature
Polymicrogyria and Schizencephaly v0.92 TMX2 Paul De Fazio gene: TMX2 was added
gene: TMX2 was added to Polymicrogyria and Schizencephaly. Sources: Literature
Mode of inheritance for gene: TMX2 was set to BIALLELIC, autosomal or pseudoautosomal
Publications for gene: TMX2 were set to 31735293; 31586943
Phenotypes for gene: TMX2 were set to Neurodevelopmental disorder with microcephaly, cortical malformations, and spasticity MIM#618730
Review for gene: TMX2 was set to AMBER
gene: TMX2 was marked as current diagnostic
Added comment: PMID 31735293: 5 unrelated individuals (out of 14 total from 10 families) with biallelic variants had polymicrogyria on MRI. Other individuals had brain atrophy or pachygyria. One individual had a normal MRI.

PMID 31586943: 8 individuals from 4 families had the same homozygous missense variant (10 heterozygotes in gnomAD.). All of the individuals had lissencephaly, NOT polymycrogyria. This variant was also identified in one individual from PMID 31735293, who did have polymicrogyria.
Sources: Literature
Lissencephaly and Band Heterotopia v0.46 ACTB Ain Roesley reviewed gene: ACTB: Rating: GREEN; Mode of pathogenicity: None; Publications: 29671837, 22366783; Phenotypes: Baraitser-Winter syndrome 1 (MIM#243310); Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown
Lissencephaly and Band Heterotopia v0.46 VLDLR Paul De Fazio reviewed gene: VLDLR: Rating: GREEN; Mode of pathogenicity: None; Publications: 16080122, 18364738, 18326629, 22700954, 22973972; Phenotypes: Cerebellar hypoplasia and mental retardation with or without quadrupedal locomotion 1 (MIM#224050); Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal; Current diagnostic: yes
Malformations of cortical development_Superpanel v0.110 Zornitza Stark Panel types changed to Victorian Clinical Genetics Services; Royal Melbourne Hospital; Rare Disease
Neurotransmitter Defects v0.83 QDPR Zornitza Stark Marked gene: QDPR as ready
Neurotransmitter Defects v0.83 QDPR Zornitza Stark Gene: qdpr has been classified as Green List (High Evidence).
Neurotransmitter Defects v0.83 QDPR Zornitza Stark Phenotypes for gene: QDPR were changed from to Hyperphenylalaninemia, BH4-deficient, C, MIM# 261630
Neurotransmitter Defects v0.82 QDPR Zornitza Stark Publications for gene: QDPR were set to
Neurotransmitter Defects v0.81 QDPR Zornitza Stark Mode of inheritance for gene: QDPR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Neurotransmitter Defects v0.80 QDPR Zornitza Stark reviewed gene: QDPR: Rating: GREEN; Mode of pathogenicity: None; Publications: 11153907; Phenotypes: Hyperphenylalaninemia, BH4-deficient, C, MIM# 261630; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Neurotransmitter Defects v0.80 GLRA1 Zornitza Stark Marked gene: GLRA1 as ready
Neurotransmitter Defects v0.80 GLRA1 Zornitza Stark Gene: glra1 has been classified as Green List (High Evidence).
Neurotransmitter Defects v0.80 TH Zornitza Stark Marked gene: TH as ready
Neurotransmitter Defects v0.80 TH Zornitza Stark Gene: th has been classified as Green List (High Evidence).
Neurotransmitter Defects v0.80 TH Zornitza Stark Phenotypes for gene: TH were changed from to Segawa syndrome, recessive , MIM#605407
Neurotransmitter Defects v0.79 TH Zornitza Stark Publications for gene: TH were set to
Neurotransmitter Defects v0.78 TH Zornitza Stark Mode of inheritance for gene: TH was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Neurotransmitter Defects v0.77 TH Zornitza Stark reviewed gene: TH: Rating: GREEN; Mode of pathogenicity: None; Publications: 17696123, 11246459, 10585338; Phenotypes: Segawa syndrome, recessive , MIM#605407; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Neurotransmitter Defects v0.77 SPR Zornitza Stark Marked gene: SPR as ready
Neurotransmitter Defects v0.77 SPR Zornitza Stark Gene: spr has been classified as Green List (High Evidence).
Neurotransmitter Defects v0.77 SPR Zornitza Stark Phenotypes for gene: SPR were changed from to Dystonia, dopa-responsive, due to sepiapterin reductase deficiency 612716
Neurotransmitter Defects v0.76 SPR Zornitza Stark Publications for gene: SPR were set to
Neurotransmitter Defects v0.75 SPR Zornitza Stark Mode of inheritance for gene: SPR was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Neurotransmitter Defects v0.74 SPR Zornitza Stark reviewed gene: SPR: Rating: GREEN; Mode of pathogenicity: None; Publications: 22522443; Phenotypes: Dystonia, dopa-responsive, due to sepiapterin reductase deficiency 612716; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Neurotransmitter Defects v0.74 SLC6A5 Zornitza Stark Marked gene: SLC6A5 as ready
Neurotransmitter Defects v0.74 SLC6A5 Zornitza Stark Gene: slc6a5 has been classified as Green List (High Evidence).
Neurotransmitter Defects v0.74 SLC6A5 Zornitza Stark Phenotypes for gene: SLC6A5 were changed from to Hyperekplexia 3, MIM# 614618
Neurotransmitter Defects v0.73 SLC6A5 Zornitza Stark Publications for gene: SLC6A5 were set to
Neurotransmitter Defects v0.72 SLC6A5 Zornitza Stark Mode of inheritance for gene: SLC6A5 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Neurotransmitter Defects v0.71 SLC6A5 Zornitza Stark reviewed gene: SLC6A5: Rating: GREEN; Mode of pathogenicity: None; Publications: 16751771; Phenotypes: Hyperekplexia 3, MIM# 614618; Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal
Mendeliome v0.3914 SLC6A3 Zornitza Stark Marked gene: SLC6A3 as ready
Mendeliome v0.3914 SLC6A3 Zornitza Stark Gene: slc6a3 has been classified as Green List (High Evidence).
Mendeliome v0.3914 SLC6A3 Zornitza Stark Phenotypes for gene: SLC6A3 were changed from to Parkinsonism-dystonia, infantile, 1, MIM# 613135
Mendeliome v0.3913 SLC6A3 Zornitza Stark Publications for gene: SLC6A3 were set to
Mendeliome v0.3912 SLC6A3 Zornitza Stark Mode of inheritance for gene: SLC6A3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.36 SLC6A3 Zornitza Stark Marked gene: SLC6A3 as ready
Early-onset Parkinson disease v0.36 SLC6A3 Zornitza Stark Gene: slc6a3 has been classified as Green List (High Evidence).
Mendeliome v0.3911 SLC6A3 Zornitza Stark reviewed gene: SLC6A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 21112253; Phenotypes: Parkinsonism-dystonia, infantile, 1, MIM# 613135; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.36 SLC6A3 Zornitza Stark Phenotypes for gene: SLC6A3 were changed from Parkinsonism-dystonia, infantile, 1, MIM# 613135 to Parkinsonism-dystonia, infantile, 1, MIM# 613135
Early-onset Parkinson disease v0.36 SLC6A3 Zornitza Stark Phenotypes for gene: SLC6A3 were changed from to Parkinsonism-dystonia, infantile, 1, MIM# 613135
Early-onset Parkinson disease v0.35 SLC6A3 Zornitza Stark Publications for gene: SLC6A3 were set to
Early-onset Parkinson disease v0.34 SLC6A3 Zornitza Stark Mode of inheritance for gene: SLC6A3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Early-onset Parkinson disease v0.33 SLC6A3 Zornitza Stark reviewed gene: SLC6A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 21112253; Phenotypes: Parkinsonism-dystonia, infantile, 1, MIM# 613135; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Neurotransmitter Defects v0.71 SLC6A3 Zornitza Stark Marked gene: SLC6A3 as ready
Neurotransmitter Defects v0.71 SLC6A3 Zornitza Stark Gene: slc6a3 has been classified as Green List (High Evidence).
Neurotransmitter Defects v0.71 SLC6A3 Zornitza Stark Phenotypes for gene: SLC6A3 were changed from to Parkinsonism-dystonia, infantile, 1, MIM# 613135
Neurotransmitter Defects v0.70 SLC6A3 Zornitza Stark Publications for gene: SLC6A3 were set to
Neurotransmitter Defects v0.69 SLC6A3 Zornitza Stark Mode of inheritance for gene: SLC6A3 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Neurotransmitter Defects v0.68 SLC6A3 Zornitza Stark reviewed gene: SLC6A3: Rating: GREEN; Mode of pathogenicity: None; Publications: 21112253; Phenotypes: Parkinsonism-dystonia, infantile, 1, MIM# 613135; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Neurotransmitter Defects v0.68 SLC25A22 Zornitza Stark Marked gene: SLC25A22 as ready
Neurotransmitter Defects v0.68 SLC25A22 Zornitza Stark Gene: slc25a22 has been classified as Red List (Low Evidence).
Neurotransmitter Defects v0.68 SLC25A22 Zornitza Stark Phenotypes for gene: SLC25A22 were changed from to Epileptic encephalopathy, early infantile, 3, MIM# 609304
Neurotransmitter Defects v0.67 SLC25A22 Zornitza Stark Mode of inheritance for gene: SLC25A22 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Neurotransmitter Defects v0.66 SLC25A22 Zornitza Stark Classified gene: SLC25A22 as Red List (low evidence)
Neurotransmitter Defects v0.66 SLC25A22 Zornitza Stark Gene: slc25a22 has been classified as Red List (Low Evidence).
Neurotransmitter Defects v0.65 SLC25A22 Zornitza Stark reviewed gene: SLC25A22: Rating: RED; Mode of pathogenicity: None; Publications: ; Phenotypes: Epileptic encephalopathy, early infantile, 3, MIM# 609304; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Neurotransmitter Defects v0.65 PTS Zornitza Stark Marked gene: PTS as ready
Neurotransmitter Defects v0.65 PTS Zornitza Stark Gene: pts has been classified as Green List (High Evidence).
Neurotransmitter Defects v0.65 PTS Zornitza Stark Phenotypes for gene: PTS were changed from to Hyperphenylalaninemia, BH4-deficient, A, MIM# 261640
Neurotransmitter Defects v0.64 PTS Zornitza Stark Publications for gene: PTS were set to
Neurotransmitter Defects v0.63 PTS Zornitza Stark Mode of inheritance for gene: PTS was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Neurotransmitter Defects v0.62 PTS Zornitza Stark reviewed gene: PTS: Rating: GREEN; Mode of pathogenicity: None; Publications: 9222755; Phenotypes: Hyperphenylalaninemia, BH4-deficient, A, MIM# 261640; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Neurotransmitter Defects v0.62 PNPO Zornitza Stark Marked gene: PNPO as ready
Neurotransmitter Defects v0.62 PNPO Zornitza Stark Gene: pnpo has been classified as Green List (High Evidence).
Neurotransmitter Defects v0.62 PNPO Zornitza Stark Phenotypes for gene: PNPO were changed from to Pyridoxamine 5'-phosphate oxidase deficiency, MIM# 610090
Neurotransmitter Defects v0.61 PNPO Zornitza Stark Mode of inheritance for gene: PNPO was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Neurotransmitter Defects v0.60 PNPO Zornitza Stark reviewed gene: PNPO: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Pyridoxamine 5'-phosphate oxidase deficiency, MIM# 610090; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Neurotransmitter Defects v0.60 PCBD1 Zornitza Stark Marked gene: PCBD1 as ready
Neurotransmitter Defects v0.60 PCBD1 Zornitza Stark Gene: pcbd1 has been classified as Amber List (Moderate Evidence).
Neurotransmitter Defects v0.60 PCBD1 Zornitza Stark Phenotypes for gene: PCBD1 were changed from to Hyperphenylalaninemia, BH4-deficient, D, MIM# 264070
Neurotransmitter Defects v0.59 PCBD1 Zornitza Stark Publications for gene: PCBD1 were set to
Neurotransmitter Defects v0.58 PCBD1 Zornitza Stark Mode of inheritance for gene: PCBD1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal
Neurotransmitter Defects v0.57 PCBD1 Zornitza Stark Classified gene: PCBD1 as Amber List (moderate evidence)
Neurotransmitter Defects v0.57 PCBD1 Zornitza Stark Gene: pcbd1 has been classified as Amber List (Moderate Evidence).
Neurotransmitter Defects v0.56 PCBD1 Zornitza Stark reviewed gene: PCBD1: Rating: AMBER; Mode of pathogenicity: None; Publications: 9585615; Phenotypes: Hyperphenylalaninemia, BH4-deficient, D, MIM# 264070; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal
Intellectual disability syndromic and non-syndromic v0.2867 MAOA Zornitza Stark Marked gene: MAOA as ready
Intellectual disability syndromic and non-syndromic v0.2867 MAOA Zornitza Stark Gene: maoa has been classified as Green List (High Evidence).
Intellectual disability syndromic and non-syndromic v0.2867 MAOA Zornitza Stark Phenotypes for gene: MAOA were changed from to Brunner syndrome, MIM# 300615
Intellectual disability syndromic and non-syndromic v0.2866 MAOA Zornitza Stark Publications for gene: MAOA were set to
Intellectual disability syndromic and non-syndromic v0.2865 MAOA Zornitza Stark Mode of inheritance for gene: MAOA was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Intellectual disability syndromic and non-syndromic v0.2864 MAOA Zornitza Stark reviewed gene: MAOA: Rating: GREEN; Mode of pathogenicity: None; Publications: 25807999, 24169519; Phenotypes: Brunner syndrome, MIM# 300615; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.3911 MAOA Zornitza Stark Marked gene: MAOA as ready
Mendeliome v0.3911 MAOA Zornitza Stark Gene: maoa has been classified as Green List (High Evidence).
Mendeliome v0.3911 MAOA Zornitza Stark Phenotypes for gene: MAOA were changed from to Brunner syndrome, MIM# 300615
Mendeliome v0.3910 MAOA Zornitza Stark Publications for gene: MAOA were set to
Mendeliome v0.3909 MAOA Zornitza Stark Mode of inheritance for gene: MAOA was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Mendeliome v0.3908 MAOA Zornitza Stark reviewed gene: MAOA: Rating: GREEN; Mode of pathogenicity: None; Publications: 25807999, 24169519; Phenotypes: Brunner syndrome, MIM# 300615; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Neurotransmitter Defects v0.56 MAOA Zornitza Stark Marked gene: MAOA as ready
Neurotransmitter Defects v0.56 MAOA Zornitza Stark Gene: maoa has been classified as Green List (High Evidence).
Neurotransmitter Defects v0.56 MAOA Zornitza Stark Phenotypes for gene: MAOA were changed from to Brunner syndrome, MIM# 300615
Neurotransmitter Defects v0.55 MAOA Zornitza Stark Publications for gene: MAOA were set to
Neurotransmitter Defects v0.54 MAOA Zornitza Stark Mode of inheritance for gene: MAOA was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females
Neurotransmitter Defects v0.53 MAOA Zornitza Stark reviewed gene: MAOA: Rating: GREEN; Mode of pathogenicity: None; Publications: 25807999, 24169519; Phenotypes: Brunner syndrome, MIM# 300615; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females
Neurotransmitter Defects v0.53 GPHN Zornitza Stark changed review comment from: Well established gene-disease association, but indirect link to neurotransmitter defects: gephryn interacts with glycine and GABA receptors.; to: Indirect link to neurotransmitter defects: gephryn interacts with glycine and GABA receptors.
Neurotransmitter Defects v0.53 GPHN Zornitza Stark Marked gene: GPHN as ready
Neurotransmitter Defects v0.53 GPHN Zornitza Stark Gene: gphn has been classified as Red List (Low Evidence).