| Date | Panel | Item | Activity | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Early-onset Dementia v0.148 | CJD | Bryony Thompson Marked STR: CJD as ready | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.148 | CJD | Bryony Thompson Str: cjd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.148 | CJD | Bryony Thompson Classified STR: CJD as Green List (high evidence) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.148 | CJD | Bryony Thompson Str: cjd has been classified as Green List (High Evidence). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.147 | CJD |
Bryony Thompson STR: CJD was added STR: CJD was added to Early-onset Dementia. Sources: Expert list Mode of inheritance for STR: CJD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: CJD were set to 2159587; 20301407 Phenotypes for STR: CJD were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440 Review for STR: CJD was set to GREEN STR: CJD was marked as clinically relevant Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X] Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat. Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Early-onset Dementia v0.71 | PRNP |
Bryony Thompson STR: PRNP was added STR: PRNP was added to Early-onset Dementia. Sources: Expert list STR tags were added to STR: PRNP. Mode of inheritance for STR: PRNP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: PRNP were set to 20301407 Phenotypes for STR: PRNP were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440 Review for STR: PRNP was set to GREEN STR: PRNP was marked as clinically relevant Added comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X] Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat. Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype. Sources: Expert list |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||