Entity Name Entity type Gene Symbol Sources(; separated) Level4 Level3 Level2 Model_Of_Inheritance Phenotypes Omim Orphanet HPO Publications Description Flagged GEL_Status UserRatings_Green_amber_red version ready Mode of pathogenicity EnsemblId(GRch37) EnsemblId(GRch38) HGNC Position Chromosome Position GRCh37 Start Position GRCh37 End Position GRCh38 Start Position GRCh38 End STR Repeated Sequence STR Normal Repeats STR Pathogenic Repeats Region Haploinsufficiency Score Region Triplosensitivity Score Region Required Overlap Percentage Region Variant Type Region Verbose Name AAAS gene AAAS Expert Review Green;Expert list;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Achalasia-addisonianism-alacrimia syndrome MIM#231550 False 3 100;0;0 3.352 True ENSG00000094914 ENSG00000094914 HGNC:13666 AAAS gene AAAS Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMSN;Glucocorticoid deficiency with achalasia;Achalasia-addisonianism-alacrimia syndrome, MIM# 231550 False 3 100;0;0 3.352 True ENSG00000094914 ENSG00000094914 HGNC:13666 AAAS gene AAAS Expert list;Expert Review Green;Royal Melbourne Hospital;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Triple A syndrome, 231550;Achalasia-addisonianism-alacrimia syndrome, 231550 False 3 100;0;0 3.352 True ENSG00000094914 ENSG00000094914 HGNC:13666 AARS gene AARS Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Charcot Marie Tooth disease, axonal, type 2N, 613287;HMSN, dHMN/dSMA 20045102;22009580;22206013;30373780;26032230 False 3 100;0;0 3.352 True ENSG00000090861 ENSG00000090861 HGNC:20 AARS2 gene AARS2 Expert Review Green;Other;Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 8 MIM#614096 21549344;25058219 False 3 100;0;0 3.352 True ENSG00000124608 ENSG00000124608 HGNC:21022 ABCA1 gene ABCA1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Tangier Disease (MONDO:0008783;MIM#205400) 29582519;4165386;31751110 False 3 50;50;0 3.352 True ENSG00000165029 ENSG00000165029 HGNC:29 ABCB7 gene ABCB7 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Anemia, sideroblastic, with ataxia;Sideroblastic Anemia and Ataxia;Anemia, sideroblast with ataxia, 300135 False 3 100;0;0 3.352 False ENSG00000131269 ENSG00000131269 HGNC:48 ABCD1 gene ABCD1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Adrenomyeloneuropathy, adult (MIM#300100);Adrenomyeloneuropathy, spastic paraparesis, adrenal insufficiency, axonal sensory-motor neuropathy, sphincter disturbance 20301491 False 3 100;0;0 3.352 True ENSG00000101986 ENSG00000101986 HGNC:61 ABCD1 gene ABCD1 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) spastic paraparesis;Hereditary spastic paraplegia;Adrenoleukodystrophy, 300100;VLCFA accumulation;adrenal failure False 3 100;0;0 3.352 True ENSG00000101986 ENSG00000101986 HGNC:61 ABCD1 gene ABCD1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females "Adrenoleukodystrophy, MIM# 300100" False 3 100;0;0 3.352 True ENSG00000101986 ENSG00000101986 HGNC:61 ABCD1 gene ABCD1 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Adrenoleukodystrophy False 3 100;0;0 3.352 True ENSG00000101986 ENSG00000101986 HGNC:61 ABHD12 gene ABHD12 Expert Review Green;NHS GMS;Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Onset 2nd decade, neuropathy with SNCV, sensory neuronal hearing loss, retinitis pigmentosa, spastic paraplegia, ataxia;Neurodegeneration, childhood-onset, with cerebellar atrophy,612674;HMSN False 3 100;0;0 3.352 False ENSG00000100997 ENSG00000100997 HGNC:15868 ABHD12 gene ABHD12 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polyneuropathy, Hearing Loss, Ataxia, Retinitis Pigmentosa and Cataract (PHARC);Polyneuropathy, hearing loss, ataxia, retinitis pigmentosa and cataract, 612674;Polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and cataract False 3 100;0;0 3.352 False ENSG00000100997 ENSG00000100997 HGNC:15868 ABHD12 gene ABHD12 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and cataract MIM#612674 False 3 100;0;0 3.352 True ENSG00000100997 ENSG00000100997 HGNC:15868 ABHD16A gene ABHD16A Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 86, autosomal recessive, MIM# 619735;Intellectual Disability;Corpus callosum abnormalities PMID: 34587489 False 3 100;0;0 3.352 True ENSG00000204427 ENSG00000204427 HGNC:13921 ABHD5 gene ABHD5 Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dorfman-Chanarin disease MONDO:0010155 31883530 False 3 100;0;0 3.352 True ENSG00000011198 ENSG00000011198 HGNC:21396 ACAD9 gene ACAD9 Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency due to ACAD9 deficiency 611126 30025539 False 3 100;0;0 3.352 True ENSG00000177646 ENSG00000177646 HGNC:21497 ACADM gene ACADM Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Acyl-CoA dehydrogenase, medium chain, deficiency of 201450;Rhabdomyolysis False 3 100;0;0 3.352 True ENSG00000117054 ENSG00000117054 HGNC:89 ACADVL gene ACADVL Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal VLCAD deficiency 201475 9546340;24263034 False 3 100;0;0 3.352 True ENSG00000072778 ENSG00000072778 HGNC:92 ACBD6 gene ACBD6 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with progressive movement abnormalities, MIM# 620785 37951597 False 3 100;0;0 3.352 True ENSG00000230124 ENSG00000230124 HGNC:23339 ACO2 gene ACO2 Expert Review Green;Expert list;Royal Melbourne Hospital;GeneReviews Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Infantile cerebellar-retinal degeneration, MIM#614559 False 3 100;0;0 3.352 True ENSG00000100412 ENSG00000100412 HGNC:118 ACOX1 gene ACOX1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mitchell syndrome, MIM# 618960 32169171 False 3 100;0;0 3.352 True ENSG00000161533 ENSG00000161533 HGNC:119 ACTA1 gene ACTA1 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Nemaline myopathy 3, autosomal dominant or recessive, MIM# 161800 19562689;15236405 False 3 100;0;0 3.352 True ENSG00000143632 ENSG00000143632 HGNC:129 ACTA1 gene ACTA1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Myopathy, scapulohumeroperoneal 616852" 28606400;25938801 False 3 100;0;0 3.352 True ENSG00000143632 ENSG00000143632 HGNC:129 ACTA2 gene ACTA2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Multisystemic smooth muscle dysfunction syndrome, MIM# 613834;Vascular aneurysms & dissections, patent ductus arteriosus, mydriasis 20734336;29300374 False 3 100;0;0 3.352 True ENSG00000107796 ENSG00000107796 HGNC:130 ACTG2 gene ACTG2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Visceral myopathy, 155310;Megacystis-microcolon-intestinal hypoperistalsis syndrome 5, MIM# 619431 24676022;26647307 False 3 100;0;0 3.352 True ENSG00000163017 ENSG00000163017 HGNC:145 ACTN2 gene ACTN2 Expert Review Green;Literature;Expert Review Amber;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myopathy, distal, 6, adult onset MIM#618655 30900782;34170073;36116040;34471957;34386585 False 3 67;33;0 3.352 True Other ENSG00000077522 ENSG00000077522 HGNC:164 ACTN2 gene ACTN2 Expert Review Green;Other;Expert Review Amber;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Congenital Myopathy 8 (MIM#618654;MONDO: 0032852) 30701273 False 3 50;50;0 3.352 True ENSG00000077522 ENSG00000077522 HGNC:164 ADAR gene ADAR Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 6, 615010 autosomal recessive False 3 100;0;0 3.352 True ENSG00000160710 ENSG00000160710 HGNC:225 ADGRG1 gene ADGRG1 Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polymicrogyria, Frontoparietal, 606854;Polymicrogyria, perisylvian type, 615752 False 3 100;0;0 3.352 True ENSG00000205336 ENSG00000205336 HGNC:4512 ADPRHL2 gene ADPRHL2 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration, childhood-onset, stress-induced with variable ataxia and seizures, 618170 30100084;30401461 False 3 100;0;0 3.352 True ENSG00000116863 ENSG00000116863 HGNC:21304 ADPRHL2 gene ADPRHL2 Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration, childhood-onset, stress-induced, with variable ataxia and seizures (MIM#618170) 30100084;30401461 False 3 100;0;0 3.352 True ENSG00000116863 ENSG00000116863 HGNC:21304 ADSSL1 gene ADSSL1 Expert Review Green;Other;Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Nemaline myopathy MONDO:0018958 32646962 False 3 100;0;0 3.352 True ENSG00000185100 ENSG00000185100 HGNC:20093 ADSSL1 gene ADSSL1 Expert Review Green;Literature;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal adenylosuccinate synthetase-like 1-related distal myopathy MONDO:0018834 26506222;28268051;34635388;32646962 False 3 100;0;0 3.352 True ENSG00000185100 ENSG00000185100 HGNC:20093 AFG3L2 gene AFG3L2 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic ataxia 5, autosomal recessive MIM#614487;Spinocerebellar ataxia 28 MIM#610246 20725928 False 3 100;0;0 3.352 True ENSG00000141385 ENSG00000141385 HGNC:315 AFG3L2 gene AFG3L2 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Ataxia, spastic, 5, autosomal recessive;spastic ataxia 5, 614487;Spinocerebellar ataxia 28;Spinocerebellar ataxia 28, 610246;Spinocerebellar Ataxia, Dominant False 3 100;0;0 3.352 False ENSG00000141385 ENSG00000141385 HGNC:315 AFG3L2 gene AFG3L2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 5, autosomal recessive, MIM# 614487;Spinocerebellar ataxia 28, MIM# 610246 22022284;25401298;20208537;20725928;33075064;32248051;30910913 False 3 100;0;0 3.352 True Other ENSG00000141385 ENSG00000141385 HGNC:315 AFG3L2 gene AFG3L2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 5, autosomal recessive, MIM# 614487, MONDO:0013776;Early-onset spastic paraplegia, later myoclonic epilepsy, sensory-motor axonal neuropathy, ataxia, dystonia 22022284;25401298 False 3 100;0;0 3.352 True ENSG00000141385 ENSG00000141385 HGNC:315 AGK gene AGK Expert Review Green;Other;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sengers Syndrome (MIM#212350;MONDO:0008922) 22284826 False 3 100;0;0 3.352 True ENSG00000006530 ENSG00000006530 HGNC:21869 AGL gene AGL Expert Review Green;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease IIIa 232400;Glycogen storage disease IIIb 232400 20301788 False 3 100;0;0 3.352 True ENSG00000162688 ENSG00000162688 HGNC:321 AGRN gene AGRN Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 8, with pre- and postsynaptic defects, 615120 19631309;22205389;32221959 False 3 100;0;0 3.352 True ENSG00000188157 ENSG00000188157 HGNC:329 AGTPBP1 gene AGTPBP1 Expert Review Green;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Early onset cerebellar atrophy, developmental delay, and feeding and respiratory difficulties, severe motor neuronopathy;Neurodegeneration, childhood-onset, with cerebellar atrophy, 618276 30420557 False 3 100;0;0 3.352 True ENSG00000135049 ENSG00000135049 HGNC:17258 AGTPBP1 gene AGTPBP1 Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Early onset cerebellar atrophy, developmental delay, and feeding and respiratory difficulties, severe motor neuronopathy;Neurodegeneration, childhood-onset, with cerebellar atrophy, 618276 30420557 False 3 100;0;0 3.352 True ENSG00000135049 ENSG00000135049 HGNC:17258 AGXT gene AGXT Expert Review Green;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperoxaluria, primary, type 1, MIM#259900 False 3 100;0;0 3.352 True ENSG00000172482 ENSG00000172482 HGNC:341 AHCY gene AHCY Expert Review Green;Expert Review Green;Expert list;Expert list;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypermethioninemia with deficiency of S-adenosylhomocysteine hydrolase MIM#613752 28779239;15024124;30121674 False 3 100;0;0 3.352 True ENSG00000101444 ENSG00000101444 HGNC:343 AHI1 gene AHI1 Expert Review Green;Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 3 25616960 False 3 100;0;0 3.352 True ENSG00000135541 ENSG00000135541 HGNC:21575 AIFM1 gene AIFM1 Expert Review Green;Other;Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Combined oxidative phosphorylation deficiency 6 (COXPD6) (MIM#300816);Encephalamyopathy, Mitochondrial, X-Linked 20362274;22019070;26173962 False 3 100;0;0 3.352 True ENSG00000156709 ENSG00000156709 HGNC:8768 AIFM1 gene AIFM1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Combined oxidative phosphorylation deficiency 6;Cowchock syndrome;HMSN 3856385;22019070;26173962;25583628 False 3 100;0;0 3.352 True ENSG00000156709 ENSG00000156709 HGNC:8768 AIMP1 gene AIMP1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 3, MIM#260600 21092922;24958424;33402283;32531460;30486714;30477741 False 3 100;0;0 3.352 True ENSG00000164022 ENSG00000164022 HGNC:10648 ALDH18A1 gene ALDH18A1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Spastic paraplegia 9B, autosomal recessive, MIM# 616586;Spastic paraplegia 9A, autosomal dominant, MIM# 601162" 26026163;29915212 False 3 100;0;0 3.352 True ENSG00000059573 ENSG00000059573 HGNC:9722 ALDH18A1 gene ALDH18A1 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 9B, autosomal recessive, MIM# 616586;Spastic paraplegia 9A, autosomal dominant, MIM# 601162 26026163;29915212 False 3 100;0;0 3.352 True ENSG00000059573 ENSG00000059573 HGNC:9722 ALDH18A1 gene ALDH18A1 Expert Review Green;NHS GMS;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Adolescent-onset and adult-onset spastic paraplegia, dysarthria and motor neuronopathy, cataracts, skeletal abnormalities False 3 100;0;0 3.352 False ENSG00000059573 ENSG00000059573 HGNC:9722 ALDH3A2 gene ALDH3A2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sj gren-Larsson syndrome False 3 100;0;0 3.352 True ENSG00000072210 ENSG00000072210 HGNC:403 ALDH5A1 gene ALDH5A1 Expert Review Green;NHS GMS;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Succinic semialdehyde dehydrogenase deficiency, MIM# 271980 14635103 False 3 100;0;0 3.352 True ENSG00000112294 ENSG00000112294 HGNC:408 ALDOA gene ALDOA Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease XII 611881 8598869;25392908;14615364 False 3 100;0;0 3.352 True ENSG00000149925 ENSG00000149925 HGNC:414 ALS2 gene ALS2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paralysis, infantile onset ascending, MIM# 607225 12145748;12509863;24315819 False 3 100;0;0 3.352 True ENSG00000003393 ENSG00000003393 HGNC:443 ALS2 gene ALS2 Expert Review Green;Literature;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Amyotrophic lateral sclerosis 2, juvenile (MIM# 205100;MONDO: MONDO:0008780) 24562058;11586298 False 3 100;0;0 3.352 True ENSG00000003393 ENSG00000003393 HGNC:443 AMACR gene AMACR Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Alpha-methylacyl-CoA racemase deficiency (MIM#614307);Retinopathy, myelopathy, axonal or SNCV neuropathy, elevated phytanic and pristanic acids 36108118;10655068;20821052;18032455 False 3 100;0;0 3.352 True ENSG00000242110 ENSG00000242110 HGNC:451 AMFR gene AMFR Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 89, autosomal recessive, MIM# 620379 37119330 False 3 100;0;0 3.352 True ENSG00000159461 ENSG00000159461 HGNC:463 ANO10 gene ANO10 Expert list;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia autosomal recessive type 10, 613728;Spinocerebellar ataxia, autosomal recessive 10 False 3 100;0;0 3.352 False ENSG00000160746 ENSG00000160746 HGNC:25519 ANO10 gene ANO10 Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 10 MIM#613728 False 3 100;0;0 3.352 True ENSG00000160746 ENSG00000160746 HGNC:25519 ANO5 gene ANO5 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Miyoshi muscular dystrophy 3 613319;Muscular dystrophy, limb-girdle, type 2L 611307 23193613 False 3 100;0;0 3.352 True ENSG00000171714 ENSG00000171714 HGNC:27337 ANO5 gene ANO5 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, type 2L, 611307;Miyoshi muscular dystrophy 3, 613319 20096397;32399949 False 3 100;0;0 3.352 True ENSG00000171714 ENSG00000171714 HGNC:27337 ANXA11 gene ANXA11 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amytrophic lateral sclerosis 23 MIM#617839 28469040;29845112;30109997 False 3 100;0;0 3.352 False ENSG00000122359 ENSG00000122359 HGNC:535 AP1S1 gene AP1S1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal MEDNIK Syndrome (MONDO:0012251, MIM#609313);Congenital-onset, Mental retardation, Enteropathy (severe congenital diarrhoea), Deafness, sensory-motor Neuropathy with intermediate conduction velocities, Ichthyosis, Keratoderma 30244301;23423674 False 3 50;50;0 3.352 True ENSG00000106367 ENSG00000106367 HGNC:559 AP1S2 gene AP1S2 Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Pettigrew syndrome, MIM# 304340 False 3 100;0;0 3.352 True ENSG00000182287 ENSG00000182287 HGNC:560 AP4B1 gene AP4B1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 47, autosomal recessive, 614066 21620353;22290197;24700674;24781758;32979048;32171285;32166732;31525725;31525725 False 3 100;0;0 3.352 True ENSG00000134262 ENSG00000134262 HGNC:572 AP4E1 gene AP4E1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 51, autosomal recessive, 613744 20972249;21620353;21937992;32979048;23472171 False 3 100;0;0 3.352 True ENSG00000081014 ENSG00000081014 HGNC:573 AP4M1 gene AP4M1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 50, autosomal recessive, 612936 19559397;21937992;21937992;32979048;31915823;29096665;28464862;25496299 False 3 100;0;0 3.352 True ENSG00000221838 ENSG00000221838 HGNC:574 AP4S1 gene AP4S1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal developmental delay;Spastic paraplegia 52, autosomal recessive, 614067;seizures 21620353;25552650;32979048;32216065;31915823;30283821;27444738 False 3 100;0;0 3.352 True ENSG00000100478 ENSG00000100478 HGNC:575 AP5Z1 gene AP5Z1 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 48, autosomal recessive, MIM# 613647;MONDO:0013342 26085577;33543803;27606357 False 3 100;0;0 3.352 True ENSG00000242802 ENSG00000242802 HGNC:22197 APOA1 gene APOA1 Expert Review Green;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Amyloidosis, 3 or more types 105200;Renal failure, Axonal sensory-motor neuropathy, amyloid nephropathy" False 3 100;0;0 3.352 True ENSG00000118137 ENSG00000118137 HGNC:600 APTX gene APTX Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia, early-onset, with oculomotor apraxia and hypoalbuminemia (MIM#208920) 11586299 False 3 100;0;0 3.352 True ENSG00000137074 ENSG00000137074 HGNC:15984 APTX gene APTX Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia, early-onset, with oculomotor apraxia and hypoalbuminaemia MIM#208920 30986824;26256098;11586299 False 3 100;0;0 3.352 True ENSG00000137074 ENSG00000137074 HGNC:15984 ARG1 gene ARG1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Progressive spastic tetraplegia;Argininaemia, 207800 29726057 False 3 100;0;0 3.352 True ENSG00000118520 ENSG00000118520 HGNC:663 ARL13B gene ARL13B Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 8, MIM# 612291" False 3 100;0;0 3.352 True ENSG00000169379 ENSG00000169379 HGNC:25419 ARL6IP1 gene ARL6IP1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HSAN/SFN;Childhood-onset spastic paraplegia with mutilating, sensory>motor axonal neuropathy False 3 100;0;0 3.352 True ENSG00000170540 ENSG00000170540 HGNC:697 ARL6IP1 gene ARL6IP1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 61, autosomal recessive, MIM#615685 24482476;31272422;30980493;28471035 False 3 100;0;0 3.352 True ENSG00000170540 ENSG00000170540 HGNC:697 ARSA gene ARSA Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Metachromatic leukodystrophy, MIM# 250100;Severe late infantile form with mental retardation and severe course. Regression before 30 months;adult-onset, psychiatric symptoms, leukodystrophy on MRI, progressive neuropathy with SNCV, optic atrophy False 3 100;0;0 3.352 True ENSG00000100299 ENSG00000100299 HGNC:713 ARSA gene ARSA Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Metachromatic Leukodystrophy, 250100;Metachromatic leukodystrophy (#250100) False 3 100;0;0 3.352 True ENSG00000100299 ENSG00000100299 HGNC:713 ASAH1 gene ASAH1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinal muscular atrophy with progressive myoclonic epilepsy;dHMN/dSMA False 3 100;0;0 3.352 False ENSG00000104763 ENSG00000104763 HGNC:735 ASCC1 gene ASCC1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinal muscular atrophy with congenital bone fractures 2 26924529 False 3 100;0;0 3.352 True ENSG00000138303 ENSG00000138303 HGNC:24268 ASCC1 gene ASCC1 Expert Review Green;Other;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital Myopathy - MONDO:0019952 (PMID: 30327447;35838082;26924529) False 3 100;0;0 3.352 True ENSG00000138303 ENSG00000138303 HGNC:24268 ASCC1 gene ASCC1 Expert Review Green;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal spinal muscular atrophy with congenital bone fractures 2 (MONDO:0014807;MIM#616867) 26924529;28218388 False 3 100;0;0 3.352 True ENSG00000138303 ENSG00000138303 HGNC:24268 ASCC3 gene ASCC3 Expert Review Green;Other;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Intellectual developmental disorder, autosomal recessive 81, MIM# 620700 35047834;21937992 False 3 100;0;0 3.352 True ENSG00000112249 ENSG00000112249 HGNC:18697 ATAD3A gene ATAD3A Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Global developmental delay, optic atrophy, axonal neuropathy, hypertrophic cardiomyopathy False 3 100;0;0 3.352 False ENSG00000197785 ENSG00000197785 HGNC:25567 ATAD3A gene ATAD3A Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Harel-Yoon syndrome, MIM# 617183 28158749;27640307 False 3 100;0;0 3.352 True ENSG00000197785 ENSG00000197785 HGNC:25567 ATCAY gene ATCAY Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia, cerebellar, Cayman type, MIM# 601238;MONDO:0011025 14556008;29449188;23226316;26343454 False 3 50;50;0 3.352 True ENSG00000167654 ENSG00000167654 HGNC:779 ATG7 gene ATG7 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, SCAR31, MIM#619422 34161705 False 3 100;0;0 3.352 True ENSG00000197548 ENSG00000197548 HGNC:16935 ATL1 gene ATL1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted HSAN/SFN;Neuropathy, hereditary sensory, type ID , MIM#613708;MONDO:0013381 21194679;24604904;22340599 False 3 100;0;0 3.352 True ENSG00000198513 ENSG00000198513 HGNC:11231 ATL1 gene ATL1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 3A, autosomal dominant MIM#182600 16765570 False 3 100;0;0 3.352 False ENSG00000198513 ENSG00000198513 HGNC:11231 ATL1 gene ATL1 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 3A, MIM 182600;Hereditary spastic paraplegia, AR 16401858;16537571;17657515;28396731;24473461;26888483 False 3 100;0;0 3.352 True ENSG00000198513 ENSG00000198513 HGNC:11231 ATL1 gene ATL1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hereditary sensory neuropathy type ID, MIM 613708;Spastic paraplegia 3A, MIM 182600;Hereditary spastic paraplegia, AR 16401858;16537571;17657515;28396731;24473461;26888483 False 3 100;0;0 3.352 True ENSG00000198513 ENSG00000198513 HGNC:11231 ATL3 gene ATL3 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary sensory neuropathy type IF;HSAN/SFN 24459106;30666337;30339187;24736309 False 3 100;0;0 3.352 True ENSG00000184743 ENSG00000184743 HGNC:24526 ATM gene ATM Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia-telangiectasia MIM#208900 False 3 100;0;0 3.352 True ENSG00000149311 ENSG00000149311 HGNC:795 ATM gene ATM Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia-telangiectasia, 607585;Ataxia-Telangiectasia False 3 100;0;0 3.352 False ENSG00000149311 ENSG00000149311 HGNC:795 ATP13A2 gene ATP13A2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 78, autosomal recessive, 617225;Kufor-Rakeb syndrome, 606693 AR;complicated hereditary spastic paraplegia;Adult-onset lower-limb predominant spastic paraparesis 27217339;28137957 False 3 100;0;0 3.352 True ENSG00000159363 ENSG00000159363 HGNC:30213 ATP13A2 gene ATP13A2 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Kufor-Rakeb syndrome MIM#606693 21362476;21696388;31588715;32559632;33033738;33091395;34405108 False 3 100;0;0 3.352 True ENSG00000159363 ENSG00000159363 HGNC:30213 ATP1A1 gene ATP1A1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, axonal, type 2DD,MIM# 618036;MONDO:0054833 29499166 False 3 100;0;0 3.352 True ENSG00000163399 ENSG00000163399 HGNC:799 ATP1A3 gene ATP1A3 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alternating hemiplegia of childhood 2 MIM#614820;CAPOS syndrome MIM#601338 False 3 100;0;0 3.352 True ENSG00000105409 ENSG00000105409 HGNC:801 ATP1A3 gene ATP1A3 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted CAPOS syndrome, 601338;Cerebellar ataxia, areflexia, pes cavus, optic atrophy and sensorineural hearing loss (CAPOS, #601338);Dystonia-12, 128235;Alternating hemiplegia of childhood 2, 614820;DYSTONIA 12, 128235;ALTERNATING HEMIPLEGIA OF CHILDHOOD 2, 614820;Alternating hemiplegia of childhood 2 (#614820) and Dystonia 12 (#128235) False 3 100;0;0 3.352 False ENSG00000105409 ENSG00000105409 HGNC:801 ATP2A1 gene ATP2A1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Brody myopathy 601003 32040565 False 3 100;0;0 3.352 True ENSG00000196296 ENSG00000196296 HGNC:811 ATP2A1 gene ATP2A1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Brody myopathy, MIM# 601003 32040565 False 3 50;50;0 3.352 True ENSG00000196296 ENSG00000196296 HGNC:811 ATP2B2 gene ATP2B2 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental Disorder, MONDO:0700092, ATP2B2-related PMID: 37675773 False 3 100;0;0 3.352 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000157087 ENSG00000157087 HGNC:815 ATP6V0A1 gene ATP6V0A1 Expert Review Green;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 104 MIM#619970;Neurodevelopmental disorder with epilepsy and brain atrophy MIM#619971 PMID:34909687 False 3 50;50;0 3.352 True ENSG00000033627 ENSG00000033627 HGNC:865 ATP6V1A gene ATP6V1A Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cutis laxa, autosomal recessive, type IID MIM#617403 PMID: 28065471;33320377 False 3 100;0;0 3.352 True ENSG00000114573 ENSG00000114573 HGNC:851 ATP7A gene ATP7A Expert Review Green;Expert Review Green;NHS GMS;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Spinal muscular atrophy, distal, X-linked 3, MIM# 300489;dHMN/dSMA 20170900;33137485;31969342;31558336 False 3 100;0;0 3.352 True ENSG00000165240 ENSG00000165240 HGNC:869 ATP8A2 gene ATP8A2 Expert Review Green;Royal Melbourne Hospital;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, mental retardation, and dysequilibrium syndrome 4, MIM#615268 22892528;31612321 False 3 100;0;0 3.352 True ENSG00000132932 ENSG00000132932 HGNC:13533 ATRX gene ATRX Expert Review Green;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) ATR-X-related syndrome MONDO:0016980 16688741 False 3 100;0;0 3.352 True ENSG00000085224 ENSG00000085224 HGNC:886 B3GALNT2 gene B3GALNT2 Expert Review Green;Expert Review;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 11, MIM# 615181;MONDO:0014071 23453667;33290285;29791932;29273094;28688748;28303321 False 3 100;0;0 3.352 True ENSG00000162885 ENSG00000162885 HGNC:28596 B4GALNT1 gene B4GALNT1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 26, autosomal recessive MIM#609195 False 3 100;0;0 3.352 True ENSG00000135454 ENSG00000135454 HGNC:4117 B4GALNT1 gene B4GALNT1 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 26, autosomal recessive, 609195 False 3 100;0;0 3.352 True ENSG00000135454 ENSG00000135454 HGNC:4117 B4GAT1 gene B4GAT1 Expert Review Green;Expert Review;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 13 MIM# 615287 23359570;23877401 False 3 100;0;0 3.352 True ENSG00000174684 ENSG00000174684 HGNC:15685 BAG3 gene BAG3 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Myopathy, myofibrillar, 6 612954 PMID: 25208129;22734908;30061062 False 3 100;0;0 3.352 True ENSG00000151929 ENSG00000151929 HGNC:939 BBS1 gene BBS1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 1, 209900 15637713 False 3 100;0;0 3.352 True ENSG00000174483 ENSG00000174483 HGNC:966 BCAS3 gene BCAS3 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hengel-Maroofian-Schols syndrome, MIM# 619641 34022130 False 3 100;0;0 3.352 True ENSG00000141376 ENSG00000141376 HGNC:14347 BCKDHB gene BCKDHB Expert Review Green;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Maple Syrup Urine Disease, Metabolic encephalopathy, elevated branched chain amino acids in urine, acute axonal neuropathy False 3 100;0;0 3.352 True ENSG00000083123 ENSG00000083123 HGNC:987 BICD2 gene BICD2 Expert Review Green;Expert list;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted distal myopathy MONDO:0018949 27784775;28635954;31561939;29306765 False 3 100;0;0 3.352 True ENSG00000185963 ENSG00000185963 HGNC:17208 BICD2 gene BICD2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinal muscular atrophy, lower extremity-predominant, 2A, autosomal dominant, MIM# 615290;MONDO:0014121;Spinal muscular atrophy, lower extremity-predominant, 2B, autosomal dominant, MIM# 618291;dHMN/dSMA 23664116;23664119;23664120;27751653;28635954;30054298;29528393 False 3 100;0;0 3.352 True ENSG00000185963 ENSG00000185963 HGNC:17208 BIN1 gene BIN1 Expert Review Green;Other;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Centronuclear myopathy 2 (MONDO: 0009709;MIM#255200) 17676042;29950440;20476667;20142620;21129173;23754947;25260562;27854204 False 3 100;0;0 3.352 True ENSG00000136717 ENSG00000136717 HGNC:1052 BRAT1 gene BRAT1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with cerebellar atrophy and with or without seizures, MIM#618056 26483087;26494257;27282546 False 3 100;0;0 3.352 True ENSG00000106009 ENSG00000106009 HGNC:21701 BSCL2 gene BSCL2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neuropathy, distal hereditary motor, type VC, MIM# 619112 14981520;15732094 False 3 100;0;0 3.352 True ENSG00000168000 ENSG00000168000 HGNC:15832 BSCL2 gene BSCL2 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Silver spastic paraplegia syndrome MIM#270685;Encephalopathy, progressive, with or without lipodystrophy MIM#615924" False 3 100;0;0 3.352 True ENSG00000168000 ENSG00000168000 HGNC:15832 BSCL2 gene BSCL2 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Silver spastic paraplegia syndrome MIM#270685;Neuropathy, distal hereditary motor, type VA MIM#600794 16765570 False 3 100;0;0 3.352 False ENSG00000168000 ENSG00000168000 HGNC:15832 BSCL2 gene BSCL2 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Silver spastic paraplegia syndrome, 270685;HSP 17, MONDO:0010043 False 3 100;0;0 3.352 True ENSG00000168000 ENSG00000168000 HGNC:15832 BVES gene BVES Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 25 616812 26642364 32528171 31119192 False 3 100;0;0 3.352 True ENSG00000112276 ENSG00000112276 HGNC:1152 C12orf65 gene C12orf65 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 55, autosomal recessive, MIM#615035;HMSN 20301682;23188110;3479531;24198383 False 3 100;0;0 3.352 True ENSG00000130921 ENSG00000130921 HGNC:26784 C12orf65 gene C12orf65 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 55, autosomal recessive, 615035;optic atrophy and spasticity, tibial muscle weakness and atrophy, peripheral neuropathy;Combined oxidative phosphorylation deficiency 7, 613559 23188110;24080142;24198383 False 3 100;0;0 3.352 True ENSG00000130921 ENSG00000130921 HGNC:26784 C19orf12 gene C19orf12 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Neurodegeneration with brain iron accumulation 4, MIM# 614298;Spastic paraplegia 43, autosomal recessive, MIM# 615043" 20039086;21981780;23269600;31087512 False 3 100;0;0 3.352 True ENSG00000131943 ENSG00000131943 HGNC:25443 C19orf12 gene C19orf12 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodegeneration with brain iron accumulation 4, 614298;Spastic paraplegia 43, autosomal recessive, 615043 33688131;21981780;22508347;23269600;31804703;30088953;20039086 False 3 100;0;0 3.352 True ENSG00000131943 ENSG00000131943 HGNC:25443 C19orf12 gene C19orf12 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Childhood-onset spastic paraplegia and sensory-motor axonal neuropathy, NBIA with optic atrophy, extrapyramidal signs False 3 100;0;0 3.352 False ENSG00000131943 ENSG00000131943 HGNC:25443 C1QBP gene C1QBP Expert Review Green;Literature;Literature;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Progressive external opthalmoplegia;mitochondrial myopathy 32652806;28942965 False 3 100;0;0 3.352 True ENSG00000108561 ENSG00000108561 HGNC:1243 C5orf42 gene C5orf42 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 17, MIM# 614615" False 3 100;0;0 3.352 True ENSG00000197603 ENSG00000197603 HGNC:25801 CA8 gene CA8 Expert Review Green;Royal Melbourne Hospital;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia and mental retardation with or without quadrupedal locomotion 3;Cerebellar ataxia and mental retardation with or without quadrupedal locomotion 3, 613227 21937992;19461874 False 3 100;0;0 3.352 True ENSG00000178538 ENSG00000178538 HGNC:1382 CACNA1A gene CACNA1A Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic ataxia, type 2 MIM#108500 False 3 50;50;0 3.352 True ENSG00000141837 ENSG00000141837 HGNC:1388 CACNA1A gene CACNA1A Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 6;familial hemiplegic migraine type 1, 141500;Familial hemiplegic migraine 1, 141500;SCA6, 183086;episodic ataxia type 2 (EA2),108500;Episodic ataxia type 2, 108500;Migraine, familial hemiplegic, 1, with progressive cerebellar ataxia;Episodic ataxia, type 2 False 3 0;100;0 3.352 False ENSG00000141837 ENSG00000141837 HGNC:1388 CACNA1G gene CACNA1G Expert Review Green;Expert list;Expert Review Green;Royal Melbourne Hospital;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown early-onset SCA42 with neurodevelopmental deficits, 618087;Spinocerebellar ataxia 42, 616795 False 3 100;0;0 3.352 True ENSG00000006283 ENSG00000006283 HGNC:1394 CACNA1G gene CACNA1G Expert Review Green;Expert list;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 42, early-onset, severe, with neurodevelopmental deficits MIM#618087 False 3 100;0;0 3.352 True ENSG00000006283 ENSG00000006283 HGNC:1394 CACNA1S gene CACNA1S Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Malignant hyperthermia susceptibility type 5;Hypokalemic periodic paralysis, type 1, 170400 8004673;11591859 False 3 100;0;0 3.352 True ENSG00000081248 ENSG00000081248 HGNC:1397 CACNA1S gene CACNA1S Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown {Malignant hyperthermia susceptibility 5}, 601887 20301325;28011884 False 3 100;0;0 3.352 True Other ENSG00000081248 ENSG00000081248 HGNC:1397 CACNA1S gene CACNA1S Expert Review Green;Expert list;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Congenital myopathy MONDO:0019952 28012042;31227654;33060286 False 3 100;0;0 3.352 True ENSG00000081248 ENSG00000081248 HGNC:1397 CACNA2D2 gene CACNA2D2 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar atrophy with seizures and variable developmental delay MIM#618501 23339110;24358150;30410802;29997391;31402629 False 3 100;0;0 3.352 True ENSG00000007402 ENSG00000007402 HGNC:1400 CAD gene CAD Expert Review Green;Literature;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epileptic encephalopathy, early infantile, 50;OMIM # 616457 PMID: 32820246 False 3 100;0;0 3.352 True ENSG00000084774 ENSG00000084774 HGNC:1424 CADM3 gene CADM3 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Charcot-Marie-Tooth disease, axonal, type 2FF, MIM# 619519 33889941;38074074 False 3 33;67;0 3.352 True ENSG00000162706 ENSG00000162706 HGNC:17601 CAMTA1 gene CAMTA1 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Cerebellarataxia, nonprogressive, with mental retardation, 614756;Cerebellar ataxia with mental retardation, 614756 32157189;22693284 False 3 100;0;0 3.352 True ENSG00000171735 ENSG00000171735 HGNC:18806 CAPN1 gene CAPN1 Expert Review Green;Expert list;Expert Review Amber;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 76, autosomal recessive, 616907;MONDO:0014827 27320912;29678961;30572172;31023339;31104286 False 3 50;50;0 3.352 True ENSG00000014216 ENSG00000014216 HGNC:1476 CAPN1 gene CAPN1 Expert Review Green;Royal Melbourne Hospital;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 76 autosomal recessive, 616907;MONDO:0014827 27153400 False 3 100;0;0 3.352 True ENSG00000014216 ENSG00000014216 HGNC:1476 CAPN3 gene CAPN3 Expert Review Green;Literature;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal dominant 4, MIM# 618129;Muscular dystrophy, limb-girdle, autosomal recessive 1, MIM# 253600 31937337;28881388;32342993;32557990 False 3 100;0;0 3.352 True ENSG00000092529 ENSG00000092529 HGNC:1480 CASK gene CASK Expert Review Green;Royal Melbourne Hospital;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) FG syndrome 4, 300422;Mental retardation and microcephaly with pontine and cerebellar hypoplasia, 300749 False 3 100;0;0 3.352 False ENSG00000147044 ENSG00000147044 HGNC:1497 CASQ1 gene CASQ1 Expert Review Green;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Myopathy, vacuolar, with CASQ1 aggregates 616231 PMID: 26136523;30258016 False 3 100;0;0 3.352 True ENSG00000143318 ENSG00000143318 HGNC:1512 CASQ1 gene CASQ1 Expert Review Green;Expert list;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myopathy, vacuolar, with CASQ1 aggregates MIM#616231 30258016 False 3 67;33;0 3.352 True ENSG00000143318 ENSG00000143318 HGNC:1512 CAV3 gene CAV3 Expert Review Green;Literature;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Caveolinopathy MONDO:0016146 38982518;30174172 False 3 100;0;0 3.352 True Other ENSG00000182533 ENSG00000182533 HGNC:1529 CAV3 gene CAV3 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Myopathy, distal, Tateyama type 614321;Rippling muscle disease 2 606072 PMID: 27312022;26185955;32090499 False 3 50;50;0 3.352 True ENSG00000182533 ENSG00000182533 HGNC:1529 CAV3 gene CAV3 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, type IC 607801;Rippling muscle disease 606072;Myopathy, distal, Tateyama type 614321 False 3 100;0;0 3.352 True ENSG00000182533 ENSG00000182533 HGNC:1529 CAVIN1 gene CAVIN1 Expert Review Green;Expert list;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lipodystrophy, congenital generalized, type 4 (MIM#613327) 19726876;12116229 False 3 100;0;0 3.352 True ENSG00000177469 ENSG00000177469 HGNC:9688 CBY1 gene CBY1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal intellectual disability;cerebellar ataxia;molar tooth sign;polydactyly;Joubert syndrome 33131181;25103236;25220153 False 3 100;0;0 3.352 True ENSG00000100211 ENSG00000100211 HGNC:1307 CC2D2A gene CC2D2A Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 9 False 3 100;0;0 3.352 False ENSG00000048342 ENSG00000048342 HGNC:29253 CCDC82 gene CCDC82 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092, CCDC82-related 35373332;35118659;27457812 False 3 100;0;0 3.352 True ENSG00000149231 ENSG00000149231 HGNC:26282 CD59 gene CD59 Expert Review Green;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Hemolytic anemia, CD59-mediated, with or without immune-mediated polyneuropathy 612300" 24382084;23149847 False 3 100;0;0 3.352 True ENSG00000085063 ENSG00000085063 HGNC:1689 CEP290 gene CEP290 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 5 False 3 100;0;0 3.352 False ENSG00000198707 ENSG00000198707 HGNC:29021 CEP41 gene CEP41 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 15 False 3 100;0;0 3.352 False ENSG00000106477 ENSG00000106477 HGNC:12370 CFL2 gene CFL2 Expert Review Green;Other;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Nemaline myopathy 7 (MONDO:0012538;MIM#610687) 17160903;22560515;32160286 False 3 100;0;0 3.352 True ENSG00000165410 ENSG00000165410 HGNC:1875 CHAT gene CHAT Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital myasthenics syndrome associated with episodic apnea;Myasthenic syndrome, congenital, 6, presynaptic, 254210 11172068;12756141;31192527;29518833;29189923 False 3 100;0;0 3.352 True ENSG00000070748 ENSG00000070748 HGNC:1912 CHCHD10 gene CHCHD10 Expert Review Green;Literature;Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted autosomal dominant mitochondrial myopathy with exercise intolerance MONDO:0014532 30874923;29112723;25193783;24934289 False 3 100;0;0 3.352 True Other ENSG00000250479 ENSG00000250479 HGNC:15559 CHCHD10 gene CHCHD10 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 3.352 False ENSG00000250479 ENSG00000250479 HGNC:15559 CHCHD10 gene CHCHD10 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinal muscular atrophy, Jokela type: 615048;CMT2;dHMN/dSMA 22535186;27066538 False 3 100;0;0 3.352 True ENSG00000250479 ENSG00000250479 HGNC:15559 CHKB gene CHKB Expert Review Green;Expert Review;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, congenital, megaconial type, MIM# 602541 21665002;23692895;24997086 False 3 100;0;0 3.352 True ENSG00000100288 ENSG00000100288 HGNC:1938 CHMP2B gene CHMP2B Expert Review Green;Royal Melbourne Hospital;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 7 (MIM#600795, MONDO:0010936) 20301378;16041373 False 3 100;0;0 3.352 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000083937 ENSG00000083937 HGNC:24537 CHRM3 gene CHRM3 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Prune belly syndrome, MIM# 100100;Posterior urethral valves & prune belly syndrome 22077972;31441039 False 3 100;0;0 3.352 True ENSG00000133019 ENSG00000133019 HGNC:1952 CHRNA1 gene CHRNA1 Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal myasthenic syndrome, congenital, 1B, fast-channel MONDO:0012156 36634413 False 3 100;0;0 3.352 True ENSG00000138435 ENSG00000138435 HGNC:1955 CHRNA1 gene CHRNA1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 1B, fast-channel, 608930;Myasthenic syndrome, congenital, 1A, slow-channel, 601462 26910802;10195214;12588888;15079006;18806275;7619526;8872460;9158151 False 3 100;0;0 3.352 True ENSG00000138435 ENSG00000138435 HGNC:1955 CHRNB1 gene CHRNB1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Myasthenic syndrome, slow-channel congenital, 601462;Myasthenic syndrome, congenital, 2A, slow-channel, 616313;?Myasthenic syndrome, congenital, 2C, associated with acetylcholine receptor deficiency, 616314 8872460;8651643;27375219;32504635;10562302 False 3 100;0;0 3.352 True ENSG00000170175 ENSG00000170175 HGNC:1961 CHRND gene CHRND Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 3B, fast-channel, MIM#616322;Myasthenic syndrome, congenital, 3C, associated with acetylcholine receptor deficiency, MIM#616323;Myasthenic syndrome, congenital, 3A, slow-channel, MIM#616321 16916845;11435464;12499478;18398509;11782989 False 3 100;0;0 3.352 True ENSG00000135902 ENSG00000135902 HGNC:1965 CHRNE gene CHRNE Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 4B, fast-channel, 616324;Myasthenic syndrome, congenital, 4C, associated with acetylcholine receptor deficiency, 608931;Myasthenic syndrome, slow-channel congenital, 601462;Myasthenic syndrome, congenital, 4A, slow-channel, 605809 8755487;8957026;11030414;12417530;32727330;32070632;31773638 False 3 100;0;0 3.352 True ENSG00000108556 ENSG00000108556 HGNC:1966 CHRNG gene CHRNG Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple pterygium syndrome, lethal type, MIM# 253290;fetal akinesia deformation sequence syndrome/FADS;Neonatal congenital myasthenia;Escobar syndrome;Myasthenia gravis, neonatal transient 22167768 False 3 100;0;0 3.352 True ENSG00000196811 ENSG00000196811 HGNC:1967 CHST14 gene CHST14 Expert Review Green;Expert list;Expert Review Amber;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ehlers-Danlos syndrome, musculocontractural type 1 MIM# 601776 26373698;20842734;36833362 False 3 50;50;0 3.352 True ENSG00000169105 ENSG00000169105 HGNC:24464 CIAO1 gene CIAO1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple mitochondrial dysfunctions syndrome 10, MIM#620960 38411040;38196629 False 3 100;0;0 3.352 True ENSG00000144021 ENSG00000144021 HGNC:14280 CLCN1 gene CLCN1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Myotonia congenita, dominant, 160800;Hyperkalemic Periodic Paralysis;Myotonia Congenita;Myotonia;Myotonia congenita, recessive, 255700;Myotonia levior, recessive 1379744;7981750;8533761 False 3 100;0;0 3.352 True ENSG00000188037 ENSG00000188037 HGNC:2019 CLCN2 gene CLCN2 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal {Epilepsy, juvenile absence, susceptibility to, 2}, 607628;Leukoencephalopathy with ataxia, 615651;{Epilepsy, juvenile myoclonic, susceptibility to, 8}, 607628;{Epilepsy, idiopathic generalized, susceptibility to, 11}, 607628 False 3 100;0;0 3.352 False ENSG00000114859 ENSG00000114859 HGNC:2020 CLMP gene CLMP Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital short bowel syndrome , MIM#615237 22155368 False 3 100;0;0 3.352 True ENSG00000166250 ENSG00000166250 HGNC:24039 CLN5 gene CLN5 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis neuronal 5, MIM# 256731 False 3 100;0;0 3.352 True ENSG00000102805 ENSG00000102805 HGNC:2076 CLN6 gene CLN6 Expert Review Green;Royal Melbourne Hospital;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid neuronal lipofuscinosis 6, 601780;Ceroid lipofuscinosis, neuronal, Kufs type, adult onset, 204300;Ceroid neuronal lipofuscinosis kufs type, 204300;Ceroid lipofuscinosis, neuronal, 6, 601780 False 3 100;0;0 3.352 False ENSG00000128973 ENSG00000128973 HGNC:2077 CLP1 gene CLP1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 10;dHMN/dSMA False 3 100;0;0 3.352 False ENSG00000172409 ENSG00000172409 HGNC:16999 CLPP gene CLPP Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Perrault syndrome 3, MIM# 614129 25254289 False 3 100;0;0 3.352 True ENSG00000125656 ENSG00000125656 HGNC:2084 CNTNAP1 gene CNTNAP1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypomyelinating neuropathy, congenital, 3 (MONDO:0017049;MIM#618186) 29511323;27881385 False 3 100;0;0 3.352 True ENSG00000108797 ENSG00000108797 HGNC:8011 COA7 gene COA7 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia with axonal neuropathy False 3 100;0;0 3.352 False ENSG00000162377 ENSG00000162377 HGNC:25716 COA7 gene COA7 Expert Review Green;Expert list;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 3 MIM#618387 False 3 100;0;0 3.352 True ENSG00000162377 ENSG00000162377 HGNC:25716 COA7 gene COA7 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 3, 618387;Cerebellar atrophy, leukoencephalopathy and spinal cord atrophy in some patients. Axonal sensory and motor neuropathy False 3 100;0;0 3.352 False ENSG00000162377 ENSG00000162377 HGNC:25716 COL12A1 gene COL12A1 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ullrich congenital muscular dystrophy 2 , MIM# 616470 24334604;28973083 False 3 50;50;0 3.352 True ENSG00000111799 ENSG00000111799 HGNC:2188 COL13A1 gene COL13A1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 19, 616720 31081514;28369367;20844119 False 3 100;0;0 3.352 True ENSG00000197467 ENSG00000197467 HGNC:2190 COL6A1 gene COL6A1 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Bethlem myopathy MIM#158810;Ullrich congenital muscular dystrophy MIM#254090 20301676;25535305;15955946;23738969;29277723;24443028 False 3 100;0;0 3.352 True ENSG00000142156 ENSG00000142156 HGNC:2211 COL6A1 gene COL6A1 Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Bethlem myopathy MIM#158810;Ullrich congenital muscular dystrophy MIM#254090 20301676;25535305;15955946;23738969;29277723;24443028 False 3 100;0;0 3.352 True ENSG00000142156 ENSG00000142156 HGNC:2211 COL6A2 gene COL6A2 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 3.352 False ENSG00000142173 ENSG00000142173 HGNC:2212 COL6A2 gene COL6A2 Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Bethlem myopathy 1 MIM#158810;Ullrich congenital muscular dystrophy 1 MIM#254090 20301676 False 3 100;0;0 3.352 True ENSG00000142173 ENSG00000142173 HGNC:2212 COL6A3 gene COL6A3 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 3.352 False ENSG00000163359 ENSG00000163359 HGNC:2213 COL6A3 gene COL6A3 Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Bethlem myopathy 1 MIM#158810;Ullrich congenital muscular dystrophy 1 MIM#254090 20301676;26004199;32037012;26872670;32037012 False 3 100;0;0 3.352 True ENSG00000163359 ENSG00000163359 HGNC:2213 COLQ gene COLQ Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 5, MIM# 603034;Congenital myasthenic syndrome with endplate acetylcholinesterase deficiency 9689136;9758617;11865139;32978031;31831253 False 3 100;0;0 3.352 True ENSG00000206561 ENSG00000206561 HGNC:2226 COQ4 gene COQ4 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 7, MIM# 616276;Childhood-onset ataxia 30225196;33704555;30847826 False 3 100;0;0 3.352 True ENSG00000167113 ENSG00000167113 HGNC:19693 COQ4 gene COQ4 Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 10, autosomal recessive, MIM# 620666 36047608;38014483;38013626 False 3 100;0;0 3.352 True ENSG00000167113 ENSG00000167113 HGNC:19693 COQ7 gene COQ7 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuronopathy, distal hereditary motor, autosomal recessive 9, MIM# 620402 PMID: 36454683;36758993;36759155 False 3 67;33;0 3.352 True ENSG00000167186 ENSG00000167186 HGNC:2244 COQ8A gene COQ8A Expert Review Green;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 4 MIM#612016 32337771 False 3 100;0;0 3.352 True ENSG00000163050 ENSG00000163050 HGNC:16812 COQ8A gene COQ8A Expert Review Green;Royal Melbourne Hospital;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Primary coenzyme Q10 deficiency 4, 612016;Spinocerebellar Ataxia Type;Coenzyme Q10 deficiency, primary 4, 612016 False 3 100;0;0 3.352 False ENSG00000163050 ENSG00000163050 HGNC:16812 COX20 gene COX20 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal sensory neuronopathy;sensory neuron disease;ganglionopathy PMID: 33751098 False 3 100;0;0 3.352 True ENSG00000203667 ENSG00000203667 HGNC:26970 COX20 gene COX20 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, 220110;Mitochondrial complex IV deficiency False 3 100;0;0 3.352 False ENSG00000203667 ENSG00000203667 HGNC:26970 COX6A1 gene COX6A1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot Marie Tooth disease, recessive intermediate D, 616039;MONDO:0014467;HMSN 25152455;26302975;25152455 False 3 100;0;0 3.352 True ENSG00000111775 ENSG00000111775 HGNC:2277 CP gene CP Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aceruloplasminemia, 604290;Cerebellar ataxia, 604290;Hemosiderosis, systemic, due to aceruloplasminemia, 604290 False 3 100;0;0 3.352 False ENSG00000047457 ENSG00000047457 HGNC:2295 CPOX gene CPOX Expert Review Green;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Coproporphyria, MIM#121300;Harderoporphyria, MIM#121300 False 3 100;0;0 3.352 True ENSG00000080819 ENSG00000080819 HGNC:2321 CPT1C gene CPT1C Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 73, autosomal dominant, MIM#616282;MONDO:0014568 25751282;30911584;30564185;23973755 False 3 100;0;0 3.352 True ENSG00000169169 ENSG00000169169 HGNC:18540 CPT2 gene CPT2 Expert Review Green;Expert list;Literature;NHS GMS;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal CPT II deficiency, myopathic, stress-induced (exercise intolerance and rhabdomyolysis, late onset) 255110 False 3 100;0;0 3.352 True ENSG00000157184 ENSG00000157184 HGNC:2330 CSF1R gene CSF1R Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Leukoencephalopathy, diffuse hereditary, with spheroids MIM#221820;ataxia 24198292;25563800;25935893 False 3 100;0;0 3.352 True ENSG00000182578 ENSG00000182578 HGNC:2433 CSMD1 gene CSMD1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal complex neurodevelopmental disorder MONDO:0100038 PMID 38816421 False 3 0;0;0 3.352 True ENSG00000183117 ENSG00000183117 HGNC:14026 CSTB gene CSTB Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg), MIM#254800 9012407;9054946 False 3 50;50;0 3.352 True ENSG00000160213 ENSG00000160213 HGNC:2482 CTBP1 gene CTBP1 Expert Review Green;Expert list;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypotonia, ataxia, developmental delay, and tooth enamel defect syndrome, MIM#617915 27094857;28955726;31041561 False 3 100;0;0 3.352 True ENSG00000159692 ENSG00000159692 HGNC:2494 CTDP1 gene CTDP1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital cataracts, facial dysmorphism, and neuropathy (MIM#604168) 20301787 False 3 50;50;0 3.352 True ENSG00000060069 ENSG00000060069 HGNC:2498 CWF19L1 gene CWF19L1 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 17, 616127;Autosomal recessive spinocerebellar ataxia type 17, 616127 False 3 100;0;0 3.352 False ENSG00000095485 ENSG00000095485 HGNC:25613 CYP27A1 gene CYP27A1 Expert Review Green;NHS GMS;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMSN;Cholestanol storage disease False 3 100;0;0 3.352 False ENSG00000135929 ENSG00000135929 HGNC:2605 CYP27A1 gene CYP27A1 NHS GMS;Royal Melbourne Hospital;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebrotendinous xanthomatosis, 213700 False 3 100;0;0 3.352 False ENSG00000135929 ENSG00000135929 HGNC:2605 CYP27A1 gene CYP27A1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebrotendinous xanthomatosis, 213700;MONDO:0008948;progressive lower extremity spasticity,often disproportionate to any degree of weakness False 3 100;0;0 3.352 True ENSG00000135929 ENSG00000135929 HGNC:2605 CYP2U1 gene CYP2U1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 56, autosomal recessive, 615030 23176821;32006740;29034544 False 3 100;0;0 3.352 True ENSG00000155016 ENSG00000155016 HGNC:20582 CYP2U1 gene CYP2U1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 56, autosomal recessive, MIM#615030 23176821 False 3 100;0;0 3.352 True ENSG00000155016 ENSG00000155016 HGNC:20582 CYP7B1 gene CYP7B1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 5A, autosomal recessive, MIM# 270800" 19439420;18252231 False 3 100;0;0 3.352 True ENSG00000172817 ENSG00000172817 HGNC:2652 CYP7B1 gene CYP7B1 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 5A, autosomal recessive, 270800;MONDO:0010047 19439420;18252231 False 3 100;0;0 3.352 True ENSG00000172817 ENSG00000172817 HGNC:2652 CYP7B1 gene CYP7B1 Expert Review Green;NHS GMS;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Childhood to adult-onset spastic paraplegia and bladder dysfunction, periventricular white matter abnormalities on MRI, one patient described with SNCV False 3 100;0;0 3.352 False ENSG00000172817 ENSG00000172817 HGNC:2652 DAG1 gene DAG1 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 9, 613818 21388311;25934851;24052401;25503980 False 3 100;0;0 3.352 True ENSG00000173402 ENSG00000173402 HGNC:2666 DAG1 gene DAG1 Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 9;Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 9, 613818;Walker-Warburg syndrome and tectocerebellar dysgraphia 21388311;25934851;24052401;25503980;29337005 False 3 100;0;0 3.352 True ENSG00000173402 ENSG00000173402 HGNC:2666 DAGLA gene DAGLA Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuroocular syndrome 2, paroxysmal type, MIM# 168885 35737950 False 3 100;0;0 3.352 True ENSG00000134780 ENSG00000134780 HGNC:1165 DARS gene DARS Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypomyelination with brainstem and spinal cord involvement and leg spasticity, MIM# 615281 25527264;23643384 False 3 100;0;0 3.352 True ENSG00000115866 ENSG00000115866 HGNC:2678 DARS gene DARS Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Brain stem and spinal cord Hypomyelination;leg spasticity;Hypomyelination with brainstem and spinal cord involvement and leg spasticity, 615281 25527264;23643384 False 3 100;0;0 3.352 True ENSG00000115866 ENSG00000115866 HGNC:2678 DARS2 gene DARS2 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation;Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation, 611105 False 3 100;0;0 3.352 False ENSG00000117593 ENSG00000117593 HGNC:25538 DARS2 gene DARS2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Slowly progressive spasticity, ataxia and dorsal column dysfunction, sensory-motor axonal neuropathy, characteristic MRI findings False 3 0;100;0 3.352 True ENSG00000117593 ENSG00000117593 HGNC:25538 DCTN1 gene DCTN1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neuronopathy, distal hereditary motor, type VIIB, MIM# 607641;MONDO:0011879 12627231;15326253;33443672;32023010;27573046 False 3 100;0;0 3.352 True ENSG00000204843 ENSG00000204843 HGNC:2711 DCTN1 gene DCTN1 Expert Review Green;Expert Review Amber;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 3.352 False ENSG00000204843 ENSG00000204843 HGNC:2711 DDHD1 gene DDHD1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 28, autosomal recessive, MIM# 609340;MONDO:0012256" 23176821 False 3 100;0;0 3.352 True ENSG00000100523 ENSG00000100523 HGNC:19714 DDHD1 gene DDHD1 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 28, autosomal recessive, 609340;MONDO:0012256 23176821 False 3 100;0;0 3.352 True ENSG00000100523 ENSG00000100523 HGNC:19714 DDHD2 gene DDHD2 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 54, autosomal recessive, MIM# 615033;MONDO:0014018" 23486545;24482476;23176823 False 3 100;0;0 3.352 True ENSG00000085788 ENSG00000085788 HGNC:29106 DDHD2 gene DDHD2 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive paraplegia 54 (#615033). Complex form of disease ataxia reported amongst the phenotypic features in Citterio et al. (2014), Journal of Neurology, 261, pp.373-381 and Doi et al. (2014), Scientific Reports, 4, 7132.;Spastic paraplegia 54 False 3 100;0;0 3.352 False ENSG00000085788 ENSG00000085788 HGNC:29106 DDHD2 gene DDHD2 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 54, autosomal recessive, MIM# 615033;MONDO:0014018 23486545;24482476;23176823;31302745 False 3 100;0;0 3.352 True ENSG00000085788 ENSG00000085788 HGNC:29106 DEGS1 gene DEGS1 Expert Review Green;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal False 3 100;0;0 3.352 True ENSG00000143753 ENSG00000143753 HGNC:13709 DES gene DES Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Myopathy, myofibrillar, 1 601419 PMID: 20718792 False 3 50;50;0 3.352 True ENSG00000175084 ENSG00000175084 HGNC:2770 DES gene DES Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Myopathy, myofibrillar, 1 , MIM#601419" False 3 100;0;0 3.352 True ENSG00000175084 ENSG00000175084 HGNC:2770 DGUOK gene DGUOK Expert Review Green;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 3 (hepatocerebral type), 251880 Portal hypertension, noncirrhotic, 617068 Neonatal liver failure, myopathy, sensory-motor axonal neuropathy False 3 100;0;0 3.352 True ENSG00000114956 ENSG00000114956 HGNC:2858 DGUOK gene DGUOK Expert Review Green;Literature;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 3 (hepatocerebral type), MIM# 251880;Portal hypertension, noncirrhotic, 1, MIM# 617068;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 4, MIM# 617070 11687800;12874104;15887277;23043144;26874653 False 3 50;0;50 3.352 True ENSG00000114956 ENSG00000114956 HGNC:2858 DHDDS gene DHDDS Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental delay and seizures with or without movement abnormalities, OMIM:617836 29100083;33798445;34182312;34382076 False 3 100;0;0 3.352 True ENSG00000117682 ENSG00000117682 HGNC:20603 DHH gene DHH Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "46XY partial gonadal dysgenesis, with minifascicular neuropathy, MIM# 607080" 31018998;29471294;11017805 False 3 100;0;0 3.352 True ENSG00000139549 ENSG00000139549 HGNC:2865 DHX16 gene DHX16 Expert Review Green;Other;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neuromuscular disease and ocular or auditory anomalies with or without seizures (MIM#618733;MONDO:0032890) 36211162;37664979;37574199;36211162 False 3 33;33;33 3.352 True ENSG00000204560 ENSG00000204560 HGNC:2739 DHX9 gene DHX9 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, MONDO:0015626, DHX9-related 37467750 False 3 100;0;0 3.352 True ENSG00000135829 ENSG00000135829 HGNC:2750 DMD gene DMD Expert Review Green;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Duchenne muscular dystrophy (MIM#310200);Becker muscular dystrophy (MIM#300376) False 3 100;0;0 3.352 True ENSG00000198947 ENSG00000198947 HGNC:2928 DMD gene DMD Expert Review Green;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Becker muscular dystrophy 300376 20301298 False 3 100;0;0 3.352 True ENSG00000198947 ENSG00000198947 HGNC:2928 DMD gene DMD Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females "Duchenne muscular dystrophy, MIM# 310200" 3380114 False 3 100;0;0 3.352 True ENSG00000198947 ENSG00000198947 HGNC:2928 DMD gene DMD Expert Review Green;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Duchenne muscular dystrophy 310200;Becker muscular dystrophy 300376 20301298 False 3 100;0;0 3.352 True ENSG00000198947 ENSG00000198947 HGNC:2928 DNA2 gene DNA2 Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 6 MIM#615156 31636600;23352259;25635128;28554558 False 3 50;50;0 3.352 True ENSG00000138346 ENSG00000138346 HGNC:2939 DNAJB2 gene DNAJB2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuronopathy, distal hereditary motor, autosomal recessive 5 (MIM#614881) 22522442;25274842;33369814;22522442 False 3 100;0;0 3.352 True ENSG00000135924 ENSG00000135924 HGNC:5228 DNAJB2 gene DNAJB2 Expert Review Green;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuronopathy, distal hereditary motor, autosomal recessive 5 (MIM#614881) False 3 100;0;0 3.352 True ENSG00000135924 ENSG00000135924 HGNC:5228 DNAJB4 gene DNAJB4 Expert Review Green;Other;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital Myopathy 21 with early respiratory failure (MIM#620326;MONDO:005336) 36264506 False 3 100;0;0 3.352 True ENSG00000162616 ENSG00000162616 HGNC:14886 DNAJB4 gene DNAJB4 Expert Review Green;Literature;Literature;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal distal myopathy MONDO:0018949;Myopathy, MONDO:0005336, DNAJB4-related 36512060;36264506 False 3 100;0;0 3.352 True ENSG00000162616 ENSG00000162616 HGNC:14886 DNAJB6 gene DNAJB6 Expert Review Green;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Muscular dystrophy, limb-girdle, type 1E, 603511 26847086;26338452;24170373 False 3 100;0;0 3.352 True ENSG00000105993 ENSG00000105993 HGNC:14888 DNAJB6 gene DNAJB6 Expert Review Green;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 3.352 False ENSG00000105993 ENSG00000105993 HGNC:14888 DNAJC19 gene DNAJC19 Royal Melbourne Hospital;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria, type V 610198;dilated cardiomyopathy with ataxia (DCMA) syndrome;3-methylglutaconic aciduria type V, 610198 False 3 100;0;0 3.352 False ENSG00000205981 ENSG00000205981 HGNC:30528 DNAJC3 gene DNAJC3 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia, combined cerebellar and peripheral, with hearing loss and diabetes mellitus, MIM# 616192 25466870;32738013;34654017 False 3 100;0;0 3.352 True ENSG00000102580 ENSG00000102580 HGNC:9439 DNAJC5 gene DNAJC5 Royal Melbourne Hospital;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ceroid lipofuscinosis, neuronal, 4, Parry type 162350;Ceroid neuronal lipofuscinosis 4, Parry type, 162350 False 3 100;0;0 3.352 False ENSG00000101152 ENSG00000101152 HGNC:16235 DNM2 gene DNM2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Charcot-Marie-Tooth disease, axonal type 2M, MIM# 606482;Charcot-Marie-Tooth disease, dominant intermediate B, MIM# 606482;MONDO:0011674 15731758;17636067;33459893;31628461 False 3 100;0;0 3.352 True ENSG00000079805 ENSG00000079805 HGNC:2974 DNM2 gene DNM2 Expert Review Green;Other;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Centronuclear Myopathy 1 (MIM#160150;MONDO:0008048) 17932957;19122038 False 3 100;0;0 3.352 True ENSG00000079805 ENSG00000079805 HGNC:2974 DNM2 gene DNM2 Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted autosomal dominant centronuclear myopathy MONDO:0008048 16227997;33458580;30232666;24465259;23938035 False 3 100;0;0 3.352 True ENSG00000079805 ENSG00000079805 HGNC:2974 DNMT1 gene DNMT1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neuropathy, hereditary sensory, type IE, 614116;Dementia, Deafness, and Sensory Neuropathy;HSAN/SFN 21532572 False 3 100;0;0 3.352 True ENSG00000130816 ENSG00000130816 HGNC:2976 DNMT1 gene DNMT1 Royal Melbourne Hospital;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cerebellar ataxia, deafness and narcolepsy, 604121;Cerebellar ataxia, deafness, and narcolepsy, autosomal dominant,;Hereditary sensory neuropathy type IE, 614116 False 3 100;0;0 3.352 False ENSG00000130816 ENSG00000130816 HGNC:2976 DOCK3 gene DOCK3 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with impaired intellectual development, hypotonia, and ataxia, MIM#618292 False 3 100;0;0 3.352 True ENSG00000088538 ENSG00000088538 HGNC:2989 DOK7 gene DOK7 Expert Review Green;Expert list;Expert Review;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Myasthenic syndrome, congenital, 10 254300" 31453852;32360404;31561939;31449669 False 3 100;0;0 3.352 True ENSG00000175920 ENSG00000175920 HGNC:26594 DOK7 gene DOK7 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 10, 254300;Myasthenia, limb-girdle, familial 16917026;18626973;20147321;16794080;31453852;29395672;32360404 False 3 100;0;0 3.352 True ENSG00000175920 ENSG00000175920 HGNC:26594 DOLK gene DOLK Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal DK1-CDG, MONDO:0012556;Congenital disorder of glycosylation, type Im, MIM# 610768 17273964;22242004;23890587;30653653;28816422;24144945 False 3 100;0;0 3.352 True ENSG00000175283 ENSG00000175283 HGNC:23406 DPAGT1 gene DPAGT1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal tubular aggregate myopathy MONDO:0008051 38982518;38443029;38124360;29356258;24759841 False 3 100;0;0 3.352 True ENSG00000172269 ENSG00000172269 HGNC:2995 DPAGT1 gene DPAGT1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 13, with tubular aggregates, 614750;Limb girdle congenital myasthenic;Congenital disorder of glycosylation, type Ij, 608093 22742743;29356258;28712839;28662078 False 3 100;0;0 3.352 True ENSG00000172269 ENSG00000172269 HGNC:2995 DPM1 gene DPM1 Expert Review;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 50;50;0 3.352 False ENSG00000000419 ENSG00000000419 HGNC:3005 DPM3 gene DPM3 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 15 , MIM#612937;Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 15 618992 31266720;28803818;19576565;31266720;31469168 False 3 100;0;0 3.352 True ENSG00000179085 ENSG00000179085 HGNC:3007 DPM3 gene DPM3 Expert Review Green;Expert Review;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 15 MIM#612937" 19576565;28803818;31266720 False 3 100;0;0 3.352 True ENSG00000179085 ENSG00000179085 HGNC:3007 DRP2 gene DRP2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Charcot Marie Tooth, intermediate X-linked;HMSN 22764250;26227883;31217940 False 3 100;0;0 3.352 True ENSG00000102385 ENSG00000102385 HGNC:3032 DST gene DST Expert Review Green;Royal Melbourne Hospital;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Neuropathy, hereditary sensory and autonomic, type VI, MIM# 614653;MONDO:0013839;HSAN/SFN" 22522446;30371979;28468842 False 3 100;0;0 3.352 True ENSG00000151914 ENSG00000151914 HGNC:1090 DTNA gene DTNA Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Muscular dystrophy, MONDO:0020121, DTNA-related PMID: 36799992 False 3 50;50;0 3.352 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000134769 ENSG00000134769 HGNC:3057 DTNA gene DTNA Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Muscular dystrophy, MONDO:0020121, DTNA-related PMID: 36799992 False 3 100;0;0 3.352 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000134769 ENSG00000134769 HGNC:3057 DYNC1H1 gene DYNC1H1 Expert Review Green;Other;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinal muscular atrophy, lower extremity-predominant 1, (MIM#158600;MONDO:0008026) PMID: 2245967;25609763 False 3 100;0;0 3.352 True ENSG00000197102 ENSG00000197102 HGNC:2961 DYNC1H1 gene DYNC1H1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, axonal, type 20, MIM# 614228 21820100;32788638;27549087 False 3 100;0;0 3.352 True ENSG00000197102 ENSG00000197102 HGNC:2961 DYSF gene DYSF Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 3.352 False ENSG00000135636 ENSG00000135636 HGNC:3097 DYSF gene DYSF Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, type 2B 253601;Myopathy, distal, with anterior tibial onset 606768;Miyoshi muscular dystrophy 1 254130 32978841;27602406 False 3 100;0;0 3.352 True ENSG00000135636 ENSG00000135636 HGNC:3097 DYSF gene DYSF Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy, distal, with anterior tibial onset, 606768;Miyoshi muscular dystrophy 1, 254130;Muscular dystrophy, limb-girdle, type 2B, 253601 23243261 False 3 100;0;0 3.352 True ENSG00000135636 ENSG00000135636 HGNC:3097 EBF3 gene EBF3 Royal Melbourne Hospital;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypotonia, ataxia and delayed development syndrome, 617330 False 3 100;0;0 3.352 False ENSG00000108001 ENSG00000108001 HGNC:19087 EDN3 gene EDN3 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Waardenburg syndrome, type 4B, MIM# 613265 False 3 100;0;0 3.352 True ENSG00000124205 ENSG00000124205 HGNC:3178 EDNRB gene EDNRB Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Waardenburg syndrome, type 4A, MIM# 277580 False 3 100;0;0 3.352 True ENSG00000136160 ENSG00000136160 HGNC:3180 EEFSEC gene EEFSEC Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092, EEFSEC-related 39753114 False 3 100;0;0 3.352 True ENSG00000132394 ENSG00000132394 HGNC:24614 EGR2 gene EGR2 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, type 1D 607678 AD;Dejerine-Sottas disease 145900 AD, AR;Hypomyelinating neuropathy, congenital, 1 605253 AD, AR 11523566;31852952 False 3 100;0;0 3.352 True Other ENSG00000122877 ENSG00000122877 HGNC:3239 EIF2B1 gene EIF2B1 Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter MIM#603896 False 3 100;0;0 3.352 True ENSG00000111361 ENSG00000111361 HGNC:3257 EIF2B1 gene EIF2B1 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter, 603896;Childhood ataxia with central nervous system hypomyelination/vanishing white matter disease 31438897 False 3 100;0;0 3.352 False ENSG00000111361 ENSG00000111361 HGNC:3257 EIF2B2 gene EIF2B2 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter, 603896;Childhood ataxia with central nervous system hypomyelination/vanishing white matter disease 31438897 False 3 100;0;0 3.352 False ENSG00000119718 ENSG00000119718 HGNC:3258 EIF2B2 gene EIF2B2 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter MIM#603896 False 3 100;0;0 3.352 True ENSG00000119718 ENSG00000119718 HGNC:3258 EIF2B3 gene EIF2B3 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter MIM#603896 False 3 100;0;0 3.352 True ENSG00000070785 ENSG00000070785 HGNC:3259 EIF2B3 gene EIF2B3 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter, 603896;Childhood ataxia with central nervous system hypomyelination/vanishing white matter disease 31438897 False 3 100;0;0 3.352 False ENSG00000070785 ENSG00000070785 HGNC:3259 EIF2B4 gene EIF2B4 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter, 603896;Childhood ataxia with central nervous system hypomyelination/vanishing white matter disease 31438897 False 3 100;0;0 3.352 False ENSG00000115211 ENSG00000115211 HGNC:3260 EIF2B4 gene EIF2B4 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter MIM#603896 False 3 100;0;0 3.352 True ENSG00000115211 ENSG00000115211 HGNC:3260 EIF2B5 gene EIF2B5 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter MIM#603896 False 3 100;0;0 3.352 True ENSG00000145191 ENSG00000145191 HGNC:3261 EIF2B5 gene EIF2B5 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter, 603896;Childhood ataxia with central nervous system hypomyelination/vanishing white matter disease 31438897 False 3 100;0;0 3.352 False ENSG00000145191 ENSG00000145191 HGNC:3261 ELOVL1 gene ELOVL1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Ichthyotic keratoderma, spasticity, hypomyelination, and dysmorphic facies, MIM# 618527" 29496980;32123819;30487246 False 3 100;0;0 3.352 True ENSG00000066322 ENSG00000066322 HGNC:14418 ELOVL4 gene ELOVL4 Expert Review Green;Royal Melbourne Hospital;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 34 133190;Spinocerebellar ataxia 34, 133190 False 3 100;0;0 3.352 False ENSG00000118402 ENSG00000118402 HGNC:14415 ELOVL5 gene ELOVL5 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 38, MIM#615957 25065913 False 3 100;0;0 3.352 True ENSG00000012660 ENSG00000012660 HGNC:21308 ELP1 gene ELP1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dysautonomia, familial, 223900;Riley-Day syndrome MONDO:0009131;Hereditary sensory and autonomic neuropathy 3;HSAN/SFN 11179008;11179021;17644305 False 3 100;0;0 3.352 True ENSG00000070061 ENSG00000070061 HGNC:5959 EMD gene EMD Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females "Emery-Dreifuss muscular dystrophy 1, X-linked 310300" PMID: 21697856;31802929 False 3 100;0;0 3.352 True ENSG00000102119 ENSG00000102119 HGNC:3331 EMD gene EMD Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Emery-Dreifuss muscular dystrophy 1, X-linked 310300 21697856;31802929 False 3 100;0;0 3.352 True ENSG00000102119 ENSG00000102119 HGNC:3331 ENO3 gene ENO3 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease XIII 612932 11506403;31741825;25267339 False 3 100;0;0 3.352 True ENSG00000108515 ENSG00000108515 HGNC:3354 ENTPD1 gene ENTPD1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 64, autosomal recessive MIM#615683 24482476;30652007;35471564 False 3 100;0;0 3.352 True ENSG00000138185 ENSG00000138185 HGNC:3363 EPG5 gene EPG5 Expert Review Green;Other;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Vici Syndrome (MONDO: 0009452;MIM#242840) 23222957 False 3 100;0;0 3.352 True ENSG00000152223 ENSG00000152223 HGNC:29331 EPM2A gene EPM2A Expert Review Green;Royal Melbourne Hospital;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Progressive myoclonic epilepsy 2A, Lafora, 254780;Epilepsy, progressive myoclonic 2A (Lafora) 254780 False 3 100;0;0 3.352 False ENSG00000112425 ENSG00000112425 HGNC:3413 ERBB3 gene ERBB3 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Visceral neuropathy, familial, 1, autosomal recessive, MIM# 243180;Complex neurocristinopathy 33497358 False 3 100;0;0 3.352 True ENSG00000065361 ENSG00000065361 HGNC:3431 ERCC4 gene ERCC4 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Cerebellar ataxia;Xeroderma pigmentosum, group F, MIM# 278760" 29403087;28431612;29892709 False 3 100;0;0 3.352 True ENSG00000175595 ENSG00000175595 HGNC:3436 ERCC6 gene ERCC6 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cockayne syndrome, type B MIM#133540 25453614;20301516 False 3 100;0;0 3.352 True ENSG00000225830 ENSG00000225830 HGNC:3438 ERCC8 gene ERCC8 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cockayne syndrome, type A MIM#216400 False 3 100;0;0 3.352 True ENSG00000049167 ENSG00000049167 HGNC:3439 ERLIN1 gene ERLIN1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 62, 615681;Hereditary spastic paraplegia False 3 100;0;0 3.352 True ENSG00000107566 ENSG00000107566 HGNC:16947 ERLIN2 gene ERLIN2 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 18, autosomal recessive, MIM# 611225;Spastic paraplegia 18A, autosomal dominant, MIM# 620512 23109145;21330303;32094424;29528531 False 3 100;0;0 3.352 True ENSG00000147475 ENSG00000147475 HGNC:1356 ERLIN2 gene ERLIN2 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 18, autosomal recessive, MIM# 611225;Spastic paraplegia 18A, autosomal dominant, MIM# 620512 23109145;21330303;32094424;29528531 False 3 100;0;0 3.352 True ENSG00000147475 ENSG00000147475 HGNC:1356 ETFA gene ETFA Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glutaric acidemia IIA 231680 21347544;1430199 False 3 100;0;0 3.352 True ENSG00000140374 ENSG00000140374 HGNC:3481 ETFDH gene ETFDH Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple acyl-CoA dehydrogenase deficiency MONDO:0009282;sensory neuropathy 32608139;35309592;26821934 False 3 100;0;0 3.352 True ENSG00000171503 ENSG00000171503 HGNC:3483 ETFDH gene ETFDH Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glutaric acidemia IIC 231680 17412732;27038534 False 3 100;0;0 3.352 True ENSG00000171503 ENSG00000171503 HGNC:3483 EXOSC5 gene EXOSC5 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, brain abnormalities, and cardiac conduction defects, MIM# 619576;Short stature;Motor developmental delays;Cerebellar hypoplasia;Ataxia 32504085;29302074 False 3 100;0;0 3.352 True ENSG00000077348 ENSG00000077348 HGNC:24662 EXOSC8 gene EXOSC8 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal dHMN/dSMA;Pontocerebellar hypoplasia, type 1c, MIM# 616081 24989451 False 3 100;0;0 3.352 True ENSG00000120699 ENSG00000120699 HGNC:17035 EXOSC9 gene EXOSC9 Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 1D, MIM# 618065 30690203;29727687 False 3 100;0;0 3.352 True ENSG00000123737 ENSG00000123737 HGNC:9137 FA2H gene FA2H Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 35, autosomal recessive, MIM# 612319" 20104589;23745665;19068277;20853438;22146942 False 3 100;0;0 3.352 True ENSG00000103089 ENSG00000103089 HGNC:21197 FA2H gene FA2H Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 35, autosomal recessive, 611026;MONDO:0012866 20104589;23745665;19068277;20853438;22146942;30446360 False 3 100;0;0 3.352 True ENSG00000103089 ENSG00000103089 HGNC:21197 FA2H gene FA2H Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 35, autosomal recessive MIM#612319" 31135052 False 3 100;0;0 3.352 True ENSG00000103089 ENSG00000103089 HGNC:21197 FAH gene FAH Expert Review Green;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Tyrosinemia, type I, MIM# 276700" False 3 100;0;0 3.352 True ENSG00000103876 ENSG00000103876 HGNC:3579 FAM111B gene FAM111B Expert Review Green;Other;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary sclerosing poikiloderma with tendon and pulmonary involvement MONDO:0014310 27748098 False 3 100;0;0 3.352 True Other ENSG00000189057 ENSG00000189057 HGNC:24200 FAR1 gene FAR1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Cataracts, spastic paraparesis, and speech delay, MIM#619338;Peroxisomal fatty acyl-CoA reductase 1 disorder, MIM# 616154" PMID: 33239752 False 3 100;0;0 3.352 True ENSG00000197601 ENSG00000197601 HGNC:26222 FARS2 gene FARS2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 77, autosomal recessive, 617046 26553276;25851414;29126765 False 3 100;0;0 3.352 True ENSG00000145982 ENSG00000145982 HGNC:21062 FASTKD2 gene FASTKD2 Expert Review Green;Other;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 44 (MIM#618855) 31944455;18771761 False 3 50;50;0 3.352 True ENSG00000118246 ENSG00000118246 HGNC:29160 FAT2 gene FAT2 Expert Review Green;Expert Review Green;Expert list;Expert list;Royal Melbourne Hospital;GeneReviews Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 45, MIM#617769 29053796;33884300 False 3 50;50;0 3.352 True ENSG00000086570 ENSG00000086570 HGNC:3596 FBLN5 gene FBLN5 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted HMSN;Neuropathy, hereditary, with or without age-related macular degeneration, MIM#608895 32757322;31945625;23328402;28332470 False 3 100;0;0 3.352 True ENSG00000140092 ENSG00000140092 HGNC:3602 FBXL4 gene FBXL4 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 13 (encephalomyopathic type), MIM# 615471 28383868 False 3 100;0;0 3.352 True ENSG00000112234 ENSG00000112234 HGNC:13601 FBXO7 gene FBXO7 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease 15, autosomal recessive MIM#260300 18513678;19038853 False 3 100;0;0 3.352 True ENSG00000100225 ENSG00000100225 HGNC:13586 FDX2 gene FDX2 Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial myopathy, episodic, with optic atrophy and reversible leukoencephalopathy MIM#251900 24281368;30010796;28803783 False 3 100;0;0 3.352 True ENSG00000267673 ENSG00000267673 HGNC:30546 FDXR gene FDXR Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with mitochondrial abnormalities, optic atrophy, and developmental regression, MIM# 620887 30250212;28965846;29040572;33348459;37046037;37481223 False 3 100;0;0 3.352 True ENSG00000161513 ENSG00000161513 HGNC:3642 FGD4 gene FGD4 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot Marie Tooth disease, type 4H, 609311;MONDO:0012250;HMSN 17564959;31152969;28847448;28543957 False 3 100;0;0 3.352 True ENSG00000139132 ENSG00000139132 HGNC:19125 FGF14 gene FGF14 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 27 MIM#609307 False 3 100;0;0 3.352 True ENSG00000102466 ENSG00000102466 HGNC:3671 FGF14 gene FGF14 Expert Review Green;Literature;Royal Melbourne Hospital;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia type 27, 609307;Spinocerebellar ataxia 27 False 3 100;0;0 3.352 False ENSG00000102466 ENSG00000102466 HGNC:3671 FHL1 gene FHL1 Expert Review Green;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Reducing body myopathy, X-linked 1a, severe, infantile or early childhood onset, MIM# 300717 19716112;20186852;20301609;18179901;25274776;34366191;18274675;19181672 False 3 67;33;0 3.352 True ENSG00000022267 ENSG00000022267 HGNC:3702 FHL1 gene FHL1 Expert Review Green;Expert list;Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Reducing body myopathy MONDO:0019948;X-linked Emery-Dreifuss muscular dystrophy MONDO:0010680 19716112;20186852;20301609;18179901;25274776;34366191;18274675;19181672 False 3 67;33;0 3.352 True ENSG00000022267 ENSG00000022267 HGNC:3702 FICD gene FICD Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 92, autosomal recessive, MIM# 620911 36136088 False 3 100;0;0 3.352 True ENSG00000198855 ENSG00000198855 HGNC:18416 FICD gene FICD Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 92, autosomal recessive, MIM# 620911 36136088 False 3 100;0;0 3.352 True ENSG00000198855 ENSG00000198855 HGNC:18416 FIG4 gene FIG4 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, type 4J, MIM# 611228;MONDO:0012640;HMSN 17572665;21705420;24878229 False 3 100;0;0 3.352 True ENSG00000112367 ENSG00000112367 HGNC:16873 FILIP1 gene FILIP1 Expert Review Green;Expert Review;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuromuscular disorder, congenital, with dysmorphic facies, MIM# 620775 36943452;37163662 False 3 50;50;0 3.352 True ENSG00000118407 ENSG00000118407 HGNC:21015 FKBP14 gene FKBP14 Expert Review Green;Literature;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ehlers-Danlos syndrome, kyphoscoliotic and deafness type MONDO:0013800 31132235 False 3 100;0;0 3.352 True ENSG00000106080 ENSG00000106080 HGNC:18625 FKRP gene FKRP Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal myopathy caused by variation in FKRP MONDO:0700066 11592034;11741828;14647208;19299310;19155270 False 3 100;0;0 3.352 True ENSG00000181027 ENSG00000181027 HGNC:17997 FKRP gene FKRP Expert Review Green;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Limb-girdle muscular dystrophy;Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type 11592034;11741828;14647208;19299310;19155270 False 3 100;0;0 3.352 True ENSG00000181027 ENSG00000181027 HGNC:17997 FKRP gene FKRP Expert Review Green;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 5 607155 27602406;11592034;11741828;14647208;19299310;19155270 False 3 100;0;0 3.352 True ENSG00000181027 ENSG00000181027 HGNC:17997 FKTN gene FKTN Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (with brain and eye anomalies), 253800;Muscular dystrophy-dystroglycanopathy (without mental retardation), 613152;Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 4, 611588;Cardiomyopathy, dilated, 1X, 611615 9690476;19017726;20301385;28680109 False 3 100;0;0 3.352 True ENSG00000106692 ENSG00000106692 HGNC:3622 FKTN gene FKTN Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy MONDO:0018276 9690476;19017726;20301385;28680109 False 3 100;0;0 3.352 True ENSG00000106692 ENSG00000106692 HGNC:3622 FLAD1 gene FLAD1 Expert Review Green;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lipid storage myopathy due to flavin adenine dinucleotide synthetase deficiency MIM#255100 34454814;34718578;31392824;30982706;30311138;30427553;28433476;27259049;25058219 False 3 100;0;0 3.352 True ENSG00000160688 ENSG00000160688 HGNC:24671 FLNA gene FLNA Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Intestinal pseudoobstruction, neuronal, MIM# 300048;Congenital short bowel syndrome, MIM# 300048 17357080;23037936;33464596;20871226 False 3 100;0;0 3.352 True ENSG00000196924 ENSG00000196924 HGNC:3754 FLNC gene FLNC Expert Review Green;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Cardiomyopathy, familial restrictive 5 617047;Myopathy, distal, 4 614065;Myopathy, myofibrillar, 5 609524" PMID: 29858533 False 3 100;0;0 3.352 True Other ENSG00000128591 ENSG00000128591 HGNC:3756 FLVCR1 gene FLVCR1 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Posterior column ataxia with retinitis pigmentosa, 609033;Ataxia, posterior column, with retinitis pigmentosa,;Posterior Column Ataxia with Retinitis Pigmentosa False 3 100;0;0 3.352 False ENSG00000162769 ENSG00000162769 HGNC:24682 FLVCR1 gene FLVCR1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia, posterior column, with retinitis pigmentosa MIM#609033 False 3 100;0;0 3.352 True ENSG00000162769 ENSG00000162769 HGNC:24682 FLVCR1 gene FLVCR1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Ataxia, posterior column, with retinitis pigmentosa, MIM# 609033" 21267618;21070897 False 3 100;0;0 3.352 True ENSG00000162769 ENSG00000162769 HGNC:24682 FOLR1 gene FOLR1 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration due to cerebral folate transport deficiency, 613068;Neurodegeneration due to cerebral folate transport deficiency False 3 100;0;0 3.352 False ENSG00000110195 ENSG00000110195 HGNC:3791 FRMD5 gene FRMD5 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with eye movement abnormalities and ataxia, MIM# 620094 36206744 False 3 100;0;0 3.352 True ENSG00000171877 ENSG00000171877 HGNC:28214 FUS gene FUS Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 6, with or without frontotemporal dementia (MIM#608030) 19251628;19251627 False 3 100;0;0 3.352 True ENSG00000089280 ENSG00000089280 HGNC:4010 FXN gene FXN Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Friedreich ataxia MIM#229300 False 3 100;0;0 3.352 True ENSG00000165060 ENSG00000165060 HGNC:3951 FXN gene FXN Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Friedreich ataxia with retained reflexes,229300;Friedreich ataxia, 229300;Friedreichataxia, 229300 False 3 0;0;0 3.352 False ENSG00000165060 ENSG00000165060 HGNC:3951 FXN gene FXN Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Friedreich ataxia, 229300 False 3 100;0;0 3.352 True ENSG00000165060 ENSG00000165060 HGNC:3951 FXN gene FXN Expert Review Green;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Friedreich ataxia, MIM# 229300" False 3 100;0;0 3.352 True Other ENSG00000165060 ENSG00000165060 HGNC:3951 FXR1 gene FXR1 Expert Review Green;Other;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital myopathy 9B, proximal, with minicore lesions (MIM#618823;MONDO:0032937) 30770808;35393337 False 3 100;0;0 3.352 True ENSG00000114416 ENSG00000114416 HGNC:4023 GAA gene GAA Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Glycogen storage disease II 232300" PMID: 29880332 False 3 100;0;0 3.352 True ENSG00000171298 ENSG00000171298 HGNC:4065 GAA gene GAA Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease II (MIM#232300) 25103075;27365701 False 3 100;0;0 3.352 True ENSG00000171298 ENSG00000171298 HGNC:4065 GALC gene GALC Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Krabbe disease MIM#245200 9272171;11971051;22959700;26396125;26915362;28547031;31185936;32064984 False 3 100;0;0 3.352 True ENSG00000054983 ENSG00000054983 HGNC:4115 GAN gene GAN Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Giant axonal neuropathy-1, MIM# 256850" 26381321;11062483 False 3 100;0;0 3.352 True ENSG00000261609 ENSG00000261609 HGNC:4137 GAN gene GAN Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Giant axonal neuropathy-1, MIM# 256850 11062483 False 3 100;0;0 3.352 True ENSG00000261609 ENSG00000261609 HGNC:4137 GARS gene GARS Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown HMSN, dHMN/dSMA;Spinal muscular atrophy, infantile, James type, MIM# 619042;Neuropathy, distal hereditary motor, type V, 600794;Charcot Marie Tooth disease, type 2D, 601472 17101916;22462675;31985473;32181591;12690580;25168514;26503042;29648643;16982418 False 3 100;0;0 3.352 True ENSG00000106105 ENSG00000106105 HGNC:4162 GBA2 gene GBA2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 46, autosomal recessive, MIM# 614409;MONDO:0013737 23332916;23332917;29524657 False 3 100;0;0 3.352 True ENSG00000070610 ENSG00000070610 HGNC:18986 GBA2 gene GBA2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 46, autosomal recessive, 614409;SPG46, Spastic paraplegia, cognitive decline, thin corpus callosum, ataxia, cataracts, bulbar dysfunction, axonal sensory-motor neuropathy 20301682;23332917;29524657 False 3 100;0;0 3.352 True ENSG00000070610 ENSG00000070610 HGNC:18986 GBA2 gene GBA2 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 46, autosomal recessive, 614409;MONDO:0013737 23332916;23332917;29524657 False 3 100;0;0 3.352 True ENSG00000070610 ENSG00000070610 HGNC:18986 GBA2 gene GBA2 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 46, autosomal recessive, MIM# 614409" 23332916;23332917 False 3 100;0;0 3.352 True ENSG00000070610 ENSG00000070610 HGNC:18986 GBE1 gene GBE1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polyglucosan body disease, adult form MIM#263570;Late-onset, cognitive impairment, spasticity, sensory-motor axonal neuropathy, bladder dysfunction, cerebellar and extrapyramidal signs also seen, periventricular white matter abnormalities on MRI 23034915;1763891;8494336;20301758 False 3 100;0;0 3.352 True ENSG00000114480 ENSG00000114480 HGNC:4180 GBE1 gene GBE1 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease IV, MIM# 232500;Polyglucosan body disease, adult form MIM#263570 8613547;20301758 False 3 100;0;0 3.352 True ENSG00000114480 ENSG00000114480 HGNC:4180 GBE1 gene GBE1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polyglucosan body disease, adult form MIM#263570 23034915 False 3 100;0;0 3.352 True ENSG00000114480 ENSG00000114480 HGNC:4180 GBE1 gene GBE1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Polyglucosan body disease, adult form MIM#263570" 20301758;26194201 False 3 100;0;0 3.352 False ENSG00000114480 ENSG00000114480 HGNC:4180 GBF1 gene GBF1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Charcot-Marie-Tooth disease, dominant intermediate A, MIM# 606483;Axonal Neuropathy 32937143 False 3 100;0;0 3.352 True ENSG00000107862 ENSG00000107862 HGNC:4181 GCH1 gene GCH1 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary spastic paraplegia MONDO:0019064, GCH1-related 21935284;24509643;33713342 False 3 0;100;0 3.352 True ENSG00000131979 ENSG00000131979 HGNC:4193 GCH1 gene GCH1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Dystonia, DOPA-responsive, with or without hyperphenylalaninemia, MIM# 128230" 21935284;24509643 False 3 100;0;0 3.352 True ENSG00000131979 ENSG00000131979 HGNC:4193 GDAP1 gene GDAP1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, axonal, type 2K 607831, MIM# Charcot-Marie-Tooth disease, axonal, with vocal cord paresis, MIM# 607706;Charcot-Marie-Tooth disease, recessive intermediate, A, MIM# 608340;Charcot-Marie-Tooth disease, type 4A, MIM# 214400 16172208;21753178;21365284;20232219;11743580 False 3 100;0;0 3.352 True ENSG00000104381 ENSG00000104381 HGNC:15968 GDAP2 gene GDAP2 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spinocerebellar ataxia False 3 100;0;0 3.352 False ENSG00000196505 ENSG00000196505 HGNC:18010 GEMIN5 gene GEMIN5 Expert Review Green;Literature;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with cerebellar atrophy and motor dysfunction, OMIM # 619333 34569062;33963192 False 3 100;0;0 3.352 True ENSG00000082516 ENSG00000082516 HGNC:20043 GFAP gene GFAP Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alexander disease MONDO:0008752 34146839 False 3 100;0;0 3.352 True ENSG00000131095 ENSG00000131095 HGNC:4235 GFAP gene GFAP Royal Melbourne Hospital;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Alexander disease, 203450;Autosomal Dominant Ataxia;Alexander disease False 3 100;0;0 3.352 False ENSG00000131095 ENSG00000131095 HGNC:4235 GFAP gene GFAP Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alexander disease MONDO:0008752 11138011;18684770 False 3 100;0;0 3.352 True Other ENSG00000131095 ENSG00000131095 HGNC:4235 GFER gene GFER Expert Review Green;Other;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy, mitochondrial progressive, with congenital cataract and developmental delay (MIM#613076) 28155230;19409522;26018198 False 3 100;0;0 3.352 True ENSG00000127554 ENSG00000127554 HGNC:4236 GFPT1 gene GFPT1 Expert Review Green;Expert list;Expert Review;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenia, congenital, 12, with tubular aggregates MIM#610542;Limb-girdle congenital myasthenic syndrome 28712002;29905857;31449669 False 3 100;0;0 3.352 True ENSG00000198380 ENSG00000198380 HGNC:4241 GFPT1 gene GFPT1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenia, congenital, 12, with tubular aggregates, 610542;Limb-girdle congenital myasthenic syndrome 21310273;30635494 False 3 100;0;0 3.352 True ENSG00000198380 ENSG00000198380 HGNC:4241 GGPS1 gene GGPS1 Expert Review Green;Literature;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518;Muscular dystrophy;Deafness;Ovarian insufficiency 32403198 False 3 100;0;0 3.352 True ENSG00000152904 ENSG00000152904 HGNC:4249 GJA1 gene GJA1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary spastic paraplegia;Oculodentodigital dysplasia, 164200, Oculodentodigital dysplasia, autosomal recessive, 257850 31023660 False 3 100;0;0 3.352 True ENSG00000152661 ENSG00000152661 HGNC:4274 GJB1 gene GJB1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Charcot-Marie-Tooth neuropathy, X-linked dominant, 1, MIM# 302800;MONDO:0010549;HMSN 8266101;17100997;17353473 False 3 100;0;0 3.352 True ENSG00000169562 ENSG00000169562 HGNC:4283 GJC2 gene GJC2 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypomyelinating leukodystrophy 2, 608804;Leukodystrophy, hypomyelinating, 2;Autosomal Recessive Ataxia;Spastic paraplegia 44, 613206 False 3 100;0;0 3.352 False ENSG00000198835 ENSG00000198835 HGNC:17494 GJC2 gene GJC2 Expert Review Green;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Leukodystrophy, hypomyelinating, 2, MIM# 608804" False 3 100;0;0 3.352 True ENSG00000198835 ENSG00000198835 HGNC:17494 GLA gene GLA Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Cardiomyopathy;HSAN/SFN;Fabry disease 19318041;22497776 False 3 0;100;0 3.352 True ENSG00000102393 ENSG00000102393 HGNC:4296 GLRX5 gene GLRX5 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spasticity, childhood-onset, with hyperglycinemia 616859" PMID: 24334290;30770271 False 3 50;50;0 3.352 True ENSG00000182512 ENSG00000182512 HGNC:20134 GMPPB gene GMPPB Expert Review;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 3.352 False ENSG00000173540 ENSG00000173540 HGNC:22932 GMPPB gene GMPPB Expert Review Green;Expert Review;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 14 615352 False 3 100;0;0 3.352 False ENSG00000173540 ENSG00000173540 HGNC:22932 GMPPB gene GMPPB Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 14 with features of congenital myasthenic syndrome False 3 100;0;0 3.352 True ENSG00000173540 ENSG00000173540 HGNC:22932 GMPPB gene GMPPB Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 14 MIM#615352;Limb myalgia;exercise intolerance;myoglobinuria" 28456886;27874200;25681410 False 3 100;0;0 3.352 True ENSG00000173540 ENSG00000173540 HGNC:22932 GNB4 gene GNB4 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, dominant intermediate F, MIM# 615185;MONDO:0014074;HMSN 23434117;28642160;27908631 False 3 100;0;0 3.352 True ENSG00000114450 ENSG00000114450 HGNC:20731 GNE gene GNE Expert Review Green;Expert Review;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Nonaka myopathy (MIM#605820) 22883483;20301439 False 3 50;50;0 3.352 True ENSG00000159921 ENSG00000159921 HGNC:23657 GOLGA2 gene GOLGA2 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental delay with hypotonia, myopathy, and brain abnormalities, MIM 620240 PMID: 30237576;26742501;34424553 False 3 50;50;0 3.352 True ENSG00000167110 ENSG00000167110 HGNC:4425 GOSR2 gene GOSR2 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 6, 614018;Progressive myoclonic epilepsy 6, 614018 False 3 100;0;0 3.352 False ENSG00000108433 ENSG00000108433 HGNC:4431 GOSR2 gene GOSR2 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, congenital, with or without seizures, MIM# 620166 PMID: 30363482;29855340 False 3 67;0;33 3.352 True ENSG00000108433 ENSG00000108433 HGNC:4431 GPAA1 gene GPAA1 Expert Review Green;Expert list;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycosylphosphatidylinositol biosynthesis defect 15, 617810 False 3 100;0;0 3.352 True ENSG00000197858 ENSG00000197858 HGNC:4446 GPT2 gene GPT2 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly and spastic paraplegia, MIM# 616281 29882329;31471722;27601654 False 3 100;0;0 3.352 True ENSG00000166123 ENSG00000166123 HGNC:18062 GRID2 gene GRID2 Expert Review Green;Royal Melbourne Hospital;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 18, 616204 False 3 100;0;0 3.352 False ENSG00000152208 ENSG00000152208 HGNC:4576 GRM1 gene GRM1 Royal Melbourne Hospital;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 13;Spinocerebellar ataxia 44, 617691, autosomal recessive spinocerebellar ataxia type 13, 614831 False 3 100;0;0 3.352 False ENSG00000152822 ENSG00000152822 HGNC:4593 GRN gene GRN Expert Review Green;ClinGen Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted frontotemporal dementia and/or amyotrophic lateral sclerosis MONDO:0030923 18184915;23596077 False 3 100;0;0 3.352 True ENSG00000030582 ENSG00000030582 HGNC:4601 GSN gene GSN Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Amyloidosis, Finnish type MIM#105120 8684801;228009;3513049 False 3 0;100;0 3.352 True ENSG00000148180 ENSG00000148180 HGNC:4620 GSS gene GSS NHS GMS;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Gluthathione synthetase deficiency, MIM# 266130 15717202 False 3 100;0;0 3.352 True ENSG00000100983 ENSG00000100983 HGNC:4624 GUK1 gene GUK1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 21, MIM# 621071 39230499 False 3 100;0;0 3.352 True ENSG00000143774 ENSG00000143774 HGNC:4693 GYG1 gene GYG1 Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polyglucosan body myopathy 2, MIM# 616199;Glycogen storage disease XV , MIM# 613507 29422440;32477874;32528171 False 3 100;0;0 3.352 True ENSG00000163754 ENSG00000163754 HGNC:4699 GYG1 gene GYG1 Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ?Glycogen storage disease XV 613507;Polyglucosan body myopathy 2 616199 25272951;26652229 False 3 100;0;0 3.352 True ENSG00000163754 ENSG00000163754 HGNC:4699 GYS1 gene GYS1 Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease 0, muscle 611556 17928598;19699667;18358695;21958591 False 3 100;0;0 3.352 True ENSG00000104812 ENSG00000104812 HGNC:4706 HACD1 gene HACD1 Expert Review Green;Other;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital myopathy 11 (MIM#619967;MONDO:0019952) 32426512;27939133;33354762;23933735 False 3 50;50;0 3.352 True ENSG00000165996 ENSG00000165996 HGNC:9639 HACE1 gene HACE1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia and psychomotor retardation with or without seizures, 616756;MONDO:0014764;Spastic paraplegia;psychomotor retardation 26424145;26437029;31321300 False 3 100;0;0 3.352 True ENSG00000085382 ENSG00000085382 HGNC:21033 HADHA gene HADHA Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal LCHAD deficiency MIM#609016;Mitochondrial trifunctional protein deficiency MIM#609015 8871579;23868323;33744096;12838198;36063482 False 3 0;100;0 3.352 True ENSG00000084754 ENSG00000084754 HGNC:4801 HADHA gene HADHA Expert Review Green;Literature;NHS GMS;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal LCHAD deficiency MIM#609016;Trifunctional protein deficiency MIM#609015 25778941;7811722;29459657 False 3 100;0;0 3.352 True ENSG00000084754 ENSG00000084754 HGNC:4801 HADHB gene HADHB Expert Review Green;Literature;NHS GMS;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Trifunctional protein deficiency MIM#609015 25778941;30682426;9259266;29956646 False 3 100;0;0 3.352 True ENSG00000138029 ENSG00000138029 HGNC:4803 HARS gene HARS Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, axonal, type 2W, MIM# 616625;MONDO:0014711;HMSN 26072516 False 3 100;0;0 3.352 True ENSG00000170445 ENSG00000170445 HGNC:4816 HEXA gene HEXA Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GM2-gangliosidosis, several forms or Tay-Sachs disease MIM#272800 31995250;31076878 False 3 100;0;0 3.352 True ENSG00000213614 ENSG00000213614 HGNC:4878 HEXA gene HEXA Royal Melbourne Hospital;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GM2-gangliosidosis, several forms, 272800;Tay-Sachs disease, 272800 False 3 100;0;0 3.352 False ENSG00000213614 ENSG00000213614 HGNC:4878 HEXA gene HEXA Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Usually infantile-onset, developmental delay and cognitive decline, visual loss ( cherry red spot ), motor>sensory neuronopathy, hypometric saccades, adult-onset (second decade) cases described;Tay-Sachs disease 17015493;18642377;3159334;1838393 False 3 100;0;0 3.352 True ENSG00000213614 ENSG00000213614 HGNC:4878 HEXB gene HEXB Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sandhoff disease, infantile, juvenile, and adult forms MIM#268800 31995250;24263030 False 3 100;0;0 3.352 True ENSG00000049860 ENSG00000049860 HGNC:4879 HEXB gene HEXB Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sandhoff disease, infantile, juvenile, and adult forms, 268800;Sandhoff disease, 268800 False 3 100;0;0 3.352 False ENSG00000049860 ENSG00000049860 HGNC:4879 HEXB gene HEXB Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Usually infantile-onset, developmental delay and cognitive decline, visual loss ( cherry red spot ), motor>sensory neuronopathy, hypometric saccades, adult-onset (second decade) cases described;Tay-Sachs disease False 3 100;0;0 3.352 False ENSG00000049860 ENSG00000049860 HGNC:4879 HINT1 gene HINT1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuromyotonia and axonal neuropathy, autosomal recessive, MIM# 137200;Gamstorp-Wohlfart syndrome, MONDO:0007646;HMSN, dHMN/dSMA 22961002;33663550;33404983;31848916 False 3 100;0;0 3.352 True ENSG00000169567 ENSG00000169567 HGNC:4912 HK1 gene HK1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMSN;Neuropathy, hereditary motor and sensory, Russe type, 605285 19536174;26822750 False 3 100;0;0 3.352 True ENSG00000156515 ENSG00000156515 HGNC:4922 HMBS gene HMBS Expert Review Green;Literature;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Porphyria, acute intermittent MIM#176000 25389600;18647325 False 3 100;0;0 3.352 True ENSG00000256269 ENSG00000256269 HGNC:4982 HMBS gene HMBS Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Porphyria, acute intermittent MIM#176000;MONDO:0008294 31205461;20301372;8563760 False 3 50;50;0 3.352 True ENSG00000256269 ENSG00000256269 HGNC:4982 HMGCR gene HMGCR Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal autosomal recessive limb-girdle muscular dystrophy (MONDO:0015152), HMGCR-related PMID: 37167966;36745799 False 3 50;0;50 3.352 True ENSG00000113161 ENSG00000113161 HGNC:5006 HMGCS1 gene HMGCS1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Rigid spine syndrome, MONDO:0019951, HMGCS1-related 39531736 False 3 100;0;0 3.352 True ENSG00000112972 ENSG00000112972 HGNC:5007 HNRNPA1 gene HNRNPA1 Expert Review Green;Literature;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myopathy, distal, 3, MIM# 610099;inclusion body myopathy with early-onset Paget disease with or without frontotemporal dementia 3 MONDO:0014179 23455423;27066560;34291734;34722876 False 3 100;0;0 3.352 True Other ENSG00000135486 ENSG00000135486 HGNC:5031 HNRNPA1 gene HNRNPA1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 20 MIM#615426 23455423;34291734 False 3 100;0;0 3.352 True ENSG00000135486 ENSG00000135486 HGNC:5031 HNRNPA2B1 gene HNRNPA2B1 Expert Review Green;Literature;Literature;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted oculopharyngeal muscular dystrophy, MONDO:0008116, OMIM#620460 23455423;30279180;29358076;26744327;23635965;35484142 False 3 33;67;0 3.352 True ENSG00000122566 ENSG00000122566 HGNC:5033 HNRNPDL gene HNRNPDL Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Muscular dystrophy, limb-girdle, type 1G 609115 24647604;31267206;31995753;32407983;32904822;32367994 False 3 100;0;0 3.352 True ENSG00000152795 ENSG00000152795 HGNC:5037 HPDL gene HPDL Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with progressive spasticity and brain white matter abnormalities (NEDSWMA), MIM#619026;Progressive neurological disorder;Leigh-like syndrome 32707086 False 3 100;0;0 3.352 True ENSG00000186603 ENSG00000186603 HGNC:28242 HSPB1 gene HSPB1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot Marie Tooth disease, axonal, type 2F, 606595;MONDO:0011687;HMSN, dHMN/dSMA;Neuropathy, distal hereditary motor, type IIB, 608634;MONDO:0012080 21785432;15122254;18832141;32639100;32334137 False 3 100;0;0 3.352 True ENSG00000106211 ENSG00000106211 HGNC:5246 HSPB8 gene HSPB8 Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myopathy, myofibrillar, 13, with rimmed vacuoles, MIM# 621078;autosomal dominant distal axonal motor neuropathy-myofibrillar myopathy syndrome MONDO:0018773 32165108;26718575;31403083;28780615 False 3 100;0;0 3.352 True Other ENSG00000152137 ENSG00000152137 HGNC:30171 HSPB8 gene HSPB8 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted HMSN, dHMN/dSMA;Neuropathy, distal hereditary motor, type IIA, 158590;Charcot Marie Tooth disease, axonal, type 2L, 608673 15122253;15565283;29029362;28780615;28144995;26718575 False 3 100;0;0 3.352 True ENSG00000152137 ENSG00000152137 HGNC:30171 HSPD1 gene HSPD1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal "Leukodystrophy, hypomyelinating, 4, MIM# 612233;Spastic paraplegia 13, autosomal dominant, MIM# 605280" False 3 100;0;0 3.352 True ENSG00000144381 ENSG00000144381 HGNC:5261 IARS2 gene IARS2 Expert Review Green;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Cataracts, growth hormone deficiency, sensory neuropathy, sensorineural hearing loss, and skeletal dysplasia, MIM# 616007" 28328135;30419932;25130867;30041933 False 3 100;0;0 3.352 True ENSG00000067704 ENSG00000067704 HGNC:29685 IBA57 gene IBA57 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 74, autosomal recessive MIM#616451 25609768;30258207 False 3 100;0;0 3.352 True ENSG00000181873 ENSG00000181873 HGNC:27302 IDS gene IDS Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females "Mucopolysaccharidosis II, MIM# 309900" False 3 100;0;0 3.352 False ENSG00000010404 ENSG00000010404 HGNC:5389 IFIH1 gene IFIH1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Aicardi-Goutieres syndrome 7 MIM#615846 25243380;31427910;24686847;24995871 False 3 100;0;0 3.352 True ENSG00000115267 ENSG00000115267 HGNC:18873 IGHMBP2 gene IGHMBP2 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMSN, dHMN/dSMA;Charcot-Marie-Tooth disease, axonal, type 2S 616155;Neuronopathy, distal hereditary motor, type VI, 604320 25439726 False 3 100;0;0 3.352 True ENSG00000132740 ENSG00000132740 HGNC:5542 INF2 gene INF2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot Marie Tooth disease, dominant intermediate E, 614455;HMSN 22187985;30680856;25943269 False 3 100;0;0 3.352 True ENSG00000203485 ENSG00000203485 HGNC:23791 INPP4A gene INPP4A Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal INPP4A-related neurodevelopmental disorder PMID: 39315527 False 3 100;0;0 3.352 False ENSG00000040933 ENSG00000040933 HGNC:6074 INPP4A gene INPP4A Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal INPP4A-related neurodevelopmental disorder PMID: 39315527 False 3 100;0;0 3.352 False ENSG00000040933 ENSG00000040933 HGNC:6074 INPP5E gene INPP5E Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 1 False 3 100;0;0 3.352 False ENSG00000148384 ENSG00000148384 HGNC:21474 INPP5K gene INPP5K Expert Review Green;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 3.352 False ENSG00000132376 ENSG00000132376 HGNC:33882 IRF2BPL gene IRF2BPL Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with regression, abnormal movement, loss of speech and seizures, 618088 30057031 False 3 100;0;0 3.352 True ENSG00000119669 ENSG00000119669 HGNC:14282 ISCU gene ISCU Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy with lactic acidosis, hereditary, MIM# 255125 29079705;18304497;18296749;19567699 False 3 100;0;0 3.352 True ENSG00000136003 ENSG00000136003 HGNC:29882 ISPD gene ISPD Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643;Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052 22522421;23217329;23390185;30060766;28688748;26404900 False 3 100;0;0 3.352 True ENSG00000214960 ENSG00000214960 HGNC:37276 ISPD gene ISPD Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, 616052 23390185;30060766;28688748;26404900 False 3 100;0;0 3.352 True ENSG00000214960 ENSG00000214960 HGNC:37276 ITGA7 gene ITGA7 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, congenital, due to ITGA7 deficiency, MIM# 613204 34552617;9590299 False 3 100;0;0 3.352 True ENSG00000135424 ENSG00000135424 HGNC:6143 ITM2B gene ITM2B Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Cerebellar ataxia, cataract, deafness, and dementia or psychosis;Danish familial dementia 10391242;10781099;33814452 False 3 100;0;0 3.352 True ENSG00000136156 ENSG00000136156 HGNC:6174 ITPR1 gene ITPR1 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Gillespie syndrome, 206700;Spinocerebellar ataxia 29;Spinocerebellar ataxia 29, 117360;Spinocerebellar ataxia 15;Spinocerebellar ataxia 15, 606658 False 3 100;0;0 3.352 False ENSG00000150995 ENSG00000150995 HGNC:6180 ITPR1 gene ITPR1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 15 MIM#606658;Spinocerebellar ataxia 29, congenital nonprogressive MIM#117360 False 3 100;0;0 3.352 True ENSG00000150995 ENSG00000150995 HGNC:6180 ITPR3 gene ITPR3 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, demyelinating, type 1J, MIM# 620111 32949214;24627108 False 3 100;0;0 3.352 True Other ENSG00000096433 ENSG00000096433 HGNC:6182 JAG1 gene JAG1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Peripheral neuropathy 32065591;25707699 False 3 50;50;0 3.352 True ENSG00000101384 ENSG00000101384 HGNC:6188 JAG2 gene JAG2 Expert Review Green;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 27, MIM# 619566;muscular dystrophy 33861953 False 3 100;0;0 3.352 True ENSG00000184916 ENSG00000184916 HGNC:6189 JAG2 gene JAG2 Expert Review Green;Other;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal muscular dystrophy, limb-girdle, autosomal recessive 27 MONDO:0030456 33861953 False 3 100;0;0 3.352 True ENSG00000184916 ENSG00000184916 HGNC:6189 JPH1 gene JPH1 Expert Review Green;Other Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital myopathy 25, MIM# 620964 39209426 False 3 100;0;0 3.352 True ENSG00000104369 ENSG00000104369 HGNC:14201 KBTBD13 gene KBTBD13 Expert Review Green;Other;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Nemaline myopathy 6, autosomal dominant (MIM# 609273;MONDO:0012237) 21104864;11731279;21109227 False 3 100;0;0 3.352 True ENSG00000234438 ENSG00000234438 HGNC:37227 KCNA1 gene KCNA1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted EA1;Episodic ataxia/myokymia syndrome, 160120;Myokymia;Episodic Ataxia;Episodic Ataxia, Type 1 11026449 False 3 100;0;0 3.352 True Other ENSG00000111262 ENSG00000111262 HGNC:6218 KCNA1 gene KCNA1 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown EPISODIC ATAXIA, TYPE 1;myokymia with periodic ataxia;Episodic ataxia/myokymia syndrome, 160120;Episodic ataxia/myokymia syndrome 11026449 False 3 100;0;0 3.352 True Other ENSG00000111262 ENSG00000111262 HGNC:6218 KCNA2 gene KCNA2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary spastic paraplegia and ataxia False 3 100;0;0 3.352 True ENSG00000177301 ENSG00000177301 HGNC:6220 KCNA2 gene KCNA2 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Early infantile encephalopathy 32, 616366 29050392 False 3 100;0;0 3.352 True ENSG00000177301 ENSG00000177301 HGNC:6220 KCNC3 gene KCNC3 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 13 MIM#605259 False 3 100;0;0 3.352 True ENSG00000131398 ENSG00000131398 HGNC:6235 KCNC3 gene KCNC3 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 13;Spinocerebellar ataxia 13, 605259 False 3 100;0;0 3.352 False ENSG00000131398 ENSG00000131398 HGNC:6235 KCND3 gene KCND3 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 19, MIM# 607346 23280837;23280838;34361012;34067185;33575485;32823520 False 3 100;0;0 3.352 True ENSG00000171385 ENSG00000171385 HGNC:6239 KCND3 gene KCND3 Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spinocerebellar ataxia 19, MIM# 607346" 32823520 False 3 100;0;0 3.352 True ENSG00000171385 ENSG00000171385 HGNC:6239 KCNJ10 gene KCNJ10 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Seizures, Sensorineural Deafness, Ataxia, Mental Retardation, and Electrolyte Imbalance Syndrome;SESAME syndrome, 612780 False 3 100;0;0 3.352 False ENSG00000177807 ENSG00000177807 HGNC:6256 KCNJ2 gene KCNJ2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypokalemic Periodic Paralysis, Type 2;Periodic paralysis;Andersen syndrome, MIM# 170390;Episodic weakness;Andersen syndrome 11371347;12796536 False 3 100;0;0 3.352 True ENSG00000123700 ENSG00000123700 HGNC:6263 KCNN2 gene KCNN2 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder with or without variable movement or behavioural abnormalities, MIM#619725 33242881 False 3 100;0;0 3.352 True ENSG00000080709 ENSG00000080709 HGNC:6291 KDM5C gene KDM5C Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Intellectual developmental disorder, X-linked syndromic, Claes-Jensen type MIM# 300534;MONDO:0010355 15586325;32279304 False 3 100;0;0 3.352 True ENSG00000126012 ENSG00000126012 HGNC:11114 KIDINS220 gene KIDINS220 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spastic paraplegia, intellectual disability, nystagmus, and obesity, MIM# 617296;MONDO:0015007 27005418;29667355 False 3 100;0;0 3.352 True ENSG00000134313 ENSG00000134313 HGNC:29508 KIF1A gene KIF1A Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HSAN/SFN;Neuropathy, hereditary sensory, type IIC, 614213 21820098;28708278 False 3 100;0;0 3.352 True ENSG00000130294 ENSG00000130294 HGNC:888 KIF1A gene KIF1A Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 30, autosomal dominant MIM# 610357;Spastic paraplegia 30, autosomal recessive 620607 26410750;21487076;22258533;32096284;31488895;29159194;25585697 False 3 100;0;0 3.352 True ENSG00000130294 ENSG00000130294 HGNC:888 KIF1A gene KIF1A Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 30, autosomal dominant MIM# 610357;Spastic paraplegia 30, autosomal recessive 620607 26410750;21487076;22258533;32096284;31488895;29159194;25585697 False 3 100;0;0 3.352 True ENSG00000130294 ENSG00000130294 HGNC:888 KIF1C gene KIF1C Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 2,autosomal recessive;Autosomal recessive spastic ataxia 2, 611302 24482476;24319291;31413903;29544888 False 3 100;0;0 3.352 True ENSG00000129250 ENSG00000129250 HGNC:6317 KIF1C gene KIF1C Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 2, autosomal recessive, 611302;Spastic ataxia 2, autosomal recessive 24482476;24319291;31413903;29544888 False 3 100;0;0 3.352 True ENSG00000129250 ENSG00000129250 HGNC:6317 KIF1C gene KIF1C Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 2, autosomal recessive MIM#611302 24482476;24319291;31413903;29544888 False 3 100;0;0 3.352 True ENSG00000129250 ENSG00000129250 HGNC:6317 KIF5A gene KIF5A Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Amyotrophic lateral sclerosis, susceptibility to, 25} MIM#617921 29342275;30301576;29566793 False 3 100;0;0 3.352 False ENSG00000155980 ENSG00000155980 HGNC:6323 KIF5A gene KIF5A Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spastic paraplegia 10, autosomal dominant, MIM# 604187 16489470;21623771;15452312;18853458;16476820 False 3 100;0;0 3.352 True ENSG00000155980 ENSG00000155980 HGNC:6323 KIF5A gene KIF5A Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary Neuropathies;HMSN 30057544;29892902;28902413;26403765;25695920;25008398 False 3 100;0;0 3.352 True ENSG00000155980 ENSG00000155980 HGNC:6323 KIF5A gene KIF5A Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spastic paraplegia 10, autosomal dominant, MIM# 604187" 16489470;21623771;15452312;18853458;16476820 False 3 100;0;0 3.352 True ENSG00000155980 ENSG00000155980 HGNC:6323 KIF7 gene KIF7 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Koubert syndrome 12;Acrocallosal syndrome, Schinzel type False 3 100;0;0 3.352 False ENSG00000166813 ENSG00000166813 HGNC:30497 KLC2 gene KLC2 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia, optic atrophy, and neuropathy MIM#609541 26385635 False 3 100;0;0 3.352 True ENSG00000174996 ENSG00000174996 HGNC:20716 KLC2 gene KLC2 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia, optic atrophy, and neuropathy, MIM#609541 False 3 50;0;50 3.352 True ENSG00000174996 ENSG00000174996 HGNC:20716 KLHL40 gene KLHL40 Expert Review Green;Other;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Nemaline myopathy 8, autosomal recessive, MIM# 615348 23746549 False 3 100;0;0 3.352 True ENSG00000157119 ENSG00000157119 HGNC:30372 KLHL41 gene KLHL41 Expert Review Green;Other;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Nemaline Myopathy 9 (MIM#615731;MONDO:0014326) 24268659 False 3 100;0;0 3.352 True ENSG00000239474 ENSG00000239474 HGNC:16905 KPNA3 gene KPNA3 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia-88 (SPG88), MIM#620106 34564892 False 3 100;0;0 3.352 True ENSG00000102753 ENSG00000102753 HGNC:6396 KY gene KY Expert Review Green;Other;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy, myofibrillar, 7 (MIM#617114) 27484770;27485408;30591934;11136708 False 3 100;0;0 3.352 True ENSG00000174611 ENSG00000174611 HGNC:26576 L1CAM gene L1CAM Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Hydrocephalus with Hirschsprung disease or congenital idiopathic intestinal pseudoobstruction MIM#307000 9279760;11857550;15148591;15368500;22354677 False 3 100;0;0 3.352 True ENSG00000198910 ENSG00000198910 HGNC:6470 L1CAM gene L1CAM Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Hereditary spastic paraplegia, 308840;MASA syndrome, 303350;X-linked hydrocephalus, 307000 False 3 100;0;0 3.352 True ENSG00000198910 ENSG00000198910 HGNC:6470 LAMA1 gene LAMA1 Expert Review Green;Expert list;Royal Melbourne Hospital;GeneReviews Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Poretti-Boltshauser syndrome;Cerebellar ataxia, intellectual disability, oculomotor apraxia, cerebellar cysts syndrome 26932191;25105227 False 3 100;0;0 3.352 True ENSG00000101680 ENSG00000101680 HGNC:6481 LAMA2 gene LAMA2 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855;Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138 30055037 False 3 100;0;0 3.352 True ENSG00000196569 ENSG00000196569 HGNC:6482 LAMA2 gene LAMA2 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855;Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138 30055037 False 3 100;0;0 3.352 True ENSG00000196569 ENSG00000196569 HGNC:6482 LAMP2 gene LAMP2 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Danon disease, MIM# 300257;MONDO:0010281 False 3 100;0;0 3.352 True ENSG00000005893 ENSG00000005893 HGNC:6501 LARGE1 gene LARGE1 Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 3.352 False ENSG00000133424 ENSG00000133424 HGNC:6511 LARS2 gene LARS2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Perrault syndrome 4;Hydrops, lactic acidosis, and sideroblastic anemia, MIM# 617021;Leukodystrophy 29205794;32423379;30737337 False 3 100;0;0 3.352 True ENSG00000011376 ENSG00000011376 HGNC:17095 LDB3 gene LDB3 Expert Review Green;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted myofibrillar myopathy 4 MONDO:0012277 24668811;27546599;25911362 False 3 100;0;0 3.352 True Other ENSG00000122367 ENSG00000122367 HGNC:15710 LDHA gene LDHA Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease XI, MIM# 612933 2334430;1959923;8327147 False 3 100;0;0 3.352 True ENSG00000134333 ENSG00000134333 HGNC:6535 LETM1 gene LETM1 Expert Review Green;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Childhood-onset neurodegeneration with multisystem involvement due to mitochondrial dysfunction (CONDMIM), MIM#620089 36055214 False 3 100;0;0 3.352 True ENSG00000168924 ENSG00000168924 HGNC:6556 LIG3 gene LIG3 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 20 (MNGIE type), MIM# 619780 33855352 False 3 100;0;0 3.352 True ENSG00000005156 ENSG00000005156 HGNC:6600 LITAF gene LITAF Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, type 1C, MIM# 601098;MONDO:0010995 12525712;19541485;23359569;32665875;28211240 False 3 100;0;0 3.352 True ENSG00000189067 ENSG00000189067 HGNC:16841 LMNA gene LMNA Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Emery-Dreifuss muscular dystrophy 2, autosomal dominant (MIM#181350)" 27220833;23746545;17377071 False 3 0;100;0 3.352 True Other ENSG00000160789 ENSG00000160789 HGNC:6636 LMNA gene LMNA Expert Review Green;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 3.352 False ENSG00000160789 ENSG00000160789 HGNC:6636 LMNB1 gene LMNB1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Leukodystrophy, adult-onset, autosomal dominant MIM#169500 31695592 False 3 100;0;0 3.352 True ENSG00000113368 ENSG00000113368 HGNC:6637 LMOD3 gene LMOD3 Expert Review Green;Other;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Nemaline myopathy 10 (MIM# 616165;MONDO:0014513) 25250574;28815944;30291184 False 3 100;0;0 3.352 True ENSG00000163380 ENSG00000163380 HGNC:6649 LPIN1 gene LPIN1 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myoglobinuria, acute recurrent, autosomal recessive 268200 22481384;28649549;18817903;32410653 False 3 100;0;0 3.352 True ENSG00000134324 ENSG00000134324 HGNC:13345 LRP4 gene LRP4 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 17, 616304 24234652;26052878;24200689 False 3 100;0;0 3.352 True ENSG00000134569 ENSG00000134569 HGNC:6696 LRSAM1 gene LRSAM1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, axonal, type 2P, MIM# 614436;MONDO:0013753;HMSN 20865121;22012984;22781092;27686364;33568173;33414056;30996334 False 3 100;0;0 3.352 True ENSG00000148356 ENSG00000148356 HGNC:25135 LYST gene LYST Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Chediak-Higashi syndrome MIM#214500;MONDO:0008963 24521565;15790783;20301751 False 3 0;100;0 3.352 True ENSG00000143669 ENSG00000143669 HGNC:1968 MAG gene MAG Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 75, autosomal recessive, 616680;Cerebellar ataxia 31402626;24482476;26179919;32629324 False 3 100;0;0 3.352 True ENSG00000105695 ENSG00000105695 HGNC:6783 MAG gene MAG Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 75, autosomal recessive, MIM# 616680;Cerebellar ataxia;Oculomotor apraxia" 32629324;32340215;32629324 False 3 100;0;0 3.352 True ENSG00000105695 ENSG00000105695 HGNC:6783 MAN2B1 gene MAN2B1 Expert Review Green;Expert list;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Alpha-mannosidosis MONDO:0009561 20301570 False 3 100;0;0 3.352 True ENSG00000104774 ENSG00000104774 HGNC:6826 MAP3K20 gene MAP3K20 Expert Review Green;Other;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Centronuclear myopathy 6 with fiber-type disproportion (MIM#617760;MONDO:0054695) 27816943 False 3 100;0;0 3.352 True ENSG00000091436 ENSG00000091436 HGNC:17797 MAPK8IP3 gene MAPK8IP3 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Neurodevelopmental disorder with or without variable brain abnormalities 618443" PMID: 30612693;30945334 False 3 100;0;0 3.352 True ENSG00000138834 ENSG00000138834 HGNC:6884 MARS2 gene MARS2 Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 3, autosomal recessive MIM#611390 False 3 100;0;0 3.352 True ENSG00000247626 ENSG00000247626 HGNC:25133 MARS2 gene MARS2 Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 3, autosomal recessive, 611390 False 3 100;0;0 3.352 True ENSG00000247626 ENSG00000247626 HGNC:25133 MARS2 gene MARS2 Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 3, autosomal recessive MIM#611390 16672289;22448145 False 3 100;0;0 3.352 True ENSG00000247626 ENSG00000247626 HGNC:25133 MATR3 gene MATR3 Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted distal myopathy with vocal cord weakness MONDO:0018951 19344878;34659085;25154462;31056746 False 3 100;0;0 3.352 True Other ENSG00000015479 ENSG00000015479 HGNC:6912 MATR3 gene MATR3 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted 19344878;24686783;35205163;34659085;34173818;26493020 False 3 100;0;0 3.352 False ENSG00000015479 ENSG00000015479 HGNC:6912 MB gene MB Expert Review Green;Other;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myopathy, sarcoplasmic body MIM#620286 35527200;30918256 False 3 100;0;0 3.352 True ENSG00000198125 ENSG00000198125 HGNC:6915 MCM3AP gene MCM3AP Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peripheral neuropathy, autosomal recessive, with or without impaired intellectual development, 618124 24123876;28633435;28969388;29982295;32202298 False 3 100;0;0 3.352 True ENSG00000160294 ENSG00000160294 HGNC:6946 MED27 gene MED27 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with spasticity, cataracts, and cerebellar hypoplasia, MIM# 619286 33443317 False 3 100;0;0 3.352 True ENSG00000160563 ENSG00000160563 HGNC:2377 MEGF10 gene MEGF10 Expert Review Green;Expert list;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal MEGF10-Related Myopathy MONDO:0013731 22101682;22371254;23453856;27460346 False 3 100;0;0 3.352 True ENSG00000145794 ENSG00000145794 HGNC:29634 MFN2 gene MFN2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, axonal, type 2A2A 609260;Charcot-Marie-Tooth disease, axonal, type 2A2B, MIM# 617087;Hereditary motor and sensory neuropathy VIA, MIM# 601152 15064763;15549395;16437557;20008656 False 3 100;0;0 3.352 True ENSG00000116688 ENSG00000116688 HGNC:16877 MGME1 gene MGME1 Expert Review Green;Other;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal mitochondrial DNA depletion syndrome 11 MONDO:0014039 23313956;29572490;28711739 False 3 100;0;0 3.352 True ENSG00000125871 ENSG00000125871 HGNC:16205 MICU1 gene MICU1 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy with extrapyramidal signs, MIM# 615673 24336167;29721912;32395406 False 3 100;0;0 3.352 True ENSG00000107745 ENSG00000107745 HGNC:1530 MKS1 gene MKS1 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 28 False 3 100;0;0 3.352 False ENSG00000011143 ENSG00000011143 HGNC:7121 MLIP gene MLIP Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy with myalgia, increased serum creatine kinase, and with or without episodic rhabdomyolysis, MIM# 620138 34581780 False 3 100;0;0 3.352 True ENSG00000146147 ENSG00000146147 HGNC:21355 MMACHC gene MMACHC NHS GMS;Royal Melbourne Hospital;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Methylmalonic aciduria and homocystinuria cblC type, 277400;Methylmalonic aciduria and homocystinuria, cblC type, 277400;Ataxia and hypogonadism False 3 100;0;0 3.352 False ENSG00000132763 ENSG00000132763 HGNC:24525 MME gene MME Expert Review Green;Royal Melbourne Hospital;Royal Melbourne Hospital;GeneReviews Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Charcot-Marie-Tooth disease, axonal, type 2T, MIM# 617017;MONDO:0014866 26991897;27588448;33144514;31429185 False 3 100;0;0 3.352 True ENSG00000196549 ENSG00000196549 HGNC:7154 MORC2 gene MORC2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, axonal, type 2Z, MIM# 616688;MONDO:0014736 26497905;26659848;28771897;27105897 False 3 50;0;50 3.352 True ENSG00000133422 ENSG00000133422 HGNC:23573 MORC2 gene MORC2 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Axonal type CMT disease type 2Z, 616688;Cerebellar ataxia 28402445 False 3 50;0;50 3.352 True ENSG00000133422 ENSG00000133422 HGNC:23573 MORC2 gene MORC2 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental delay, impaired growth, dysmorphic facies, and axonal neuropathy, MIM# 619090 32693025;26497905;26659848 False 3 100;0;0 3.352 True ENSG00000133422 ENSG00000133422 HGNC:23573 MPDU1 gene MPDU1 Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type If, MIM# 609180;MPDU1-CDG, MONDO:0012211 11733564;11733556;31741824;29721919 False 3 100;0;0 3.352 True ENSG00000129255 ENSG00000129255 HGNC:7207 MPV17 gene MPV17 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 6 (hepatocerebral type) MIM#256810 22964873;28673863;22593919 False 3 100;0;0 3.352 True ENSG00000115204 ENSG00000115204 HGNC:7224 MPV17 gene MPV17 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMSN;Charcot-Marie-Tooth disease, axonal, type 2EE, MIM# 618400 22508010;26437932;30298599 False 3 100;0;0 3.352 True ENSG00000115204 ENSG00000115204 HGNC:7224 MPZ gene MPZ Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot Marie Tooth disease, dominant intermediate D, 60779;Neuropathy, congenital hypomyelinating, 605253;Charcot Marie Tooth disease, type 2J, 607736;Dejerine Sottas disease, 145900;Charcot Marie Tooth disease, type 1B, 118200;Charcot Marie Tooth disease, type 2I, 607677;HMSN 19293842 False 3 100;0;0 3.352 True ENSG00000158887 ENSG00000158887 HGNC:7225 MRE11 gene MRE11 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia-Telangiectasia-Like Disorder;Ataxia-telangiectasia-like disorder 1, 604391 False 3 100;0;0 3.352 False ENSG00000020922 ENSG00000020922 HGNC:7230 MSTO1 gene MSTO1 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial myopathy and ataxia, 617675 False 3 100;0;0 3.352 False ENSG00000125459 ENSG00000125459 HGNC:29678 MSTO1 gene MSTO1 Expert Review Green;Expert Review;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Myopathy, mitochondrial, and ataxia (MIM#617675) 28554942;28544275;31604776 False 3 100;0;0 3.352 True ENSG00000125459 ENSG00000125459 HGNC:29678 MSTO1 gene MSTO1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Myopathy, mitochondrial, and ataxia MIM#617675 False 3 100;0;0 3.352 True ENSG00000125459 ENSG00000125459 HGNC:29678 MTCL1 gene MTCL1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal slowly progressive cerebellar ataxia, mild intellectual disability, seizures in childhood and episodic pain in the lower limbs 30548255;28283581 False 3 100;0;0 3.352 True ENSG00000168502 ENSG00000168502 HGNC:29121 MTFMT gene MTFMT Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 15 MIM#614947;Mitochondrial complex I deficiency, nuclear type 27 MIM#618248 26060307;24461907 False 3 100;0;0 3.352 True ENSG00000103707 ENSG00000103707 HGNC:29666 MTM1 gene MTM1 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Myotubular myopathy, X-linked, 310400 False 3 100;0;0 3.352 False ENSG00000171100 ENSG00000171100 HGNC:7448 MTM1 gene MTM1 Expert Review Green;Literature;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) X-linked myotubular myopathy MONDO:0010683 30232666;38982518;10790201 False 3 100;0;0 3.352 True ENSG00000171100 ENSG00000171100 HGNC:7448 MTMR2 gene MTMR2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, type 4B1, 601382;HMSN;MONDO:0011066 10802647;16249189;33653949;32586600;32488727;31680794 False 3 100;0;0 3.352 True ENSG00000087053 ENSG00000087053 HGNC:7450 MTTP gene MTTP Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Abetalipoproteinemia (MIM#200100);Young onset;Abetalipoproteinaemia;hypocholesterloaemia leading to malabsorption of fat-soluble vitamins (vitamin E), acanthocytes, retinitis pigmentosa, progressive sensory axonal neuropathy 33994405 False 3 100;0;0 3.352 True ENSG00000138823 ENSG00000138823 HGNC:7467 MTTP gene MTTP Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Abetalipoproteinemia, 200100;Abetalipoproteinemia False 3 100;0;0 3.352 False ENSG00000138823 ENSG00000138823 HGNC:7467 MUSK gene MUSK Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 9, associated with acetylcholine receptor deficiency, 616325 15496425;19949040;20371544;32253145 False 3 100;0;0 3.352 True ENSG00000030304 ENSG00000030304 HGNC:7525 MVK gene MVK Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mevalonic aciduria 610377 12563048;10401001;28095071 False 3 100;0;0 3.352 True ENSG00000110921 ENSG00000110921 HGNC:7530 MYBPC1 gene MYBPC1 Expert Review Green;Other;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Congenital Myopathy 16 (MIM#618524) 31264822;31025394 False 3 100;0;0 3.352 True ENSG00000196091 ENSG00000196091 HGNC:7549 MYH11 gene MYH11 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Visceral myopathy 2, MIM# 619350;Megacystis-microcolon-intestinal hypoperistalsis syndrome 2, MIM# 619351;Dominant smooth muscle dysmotility syndrome" 31044419;31427716;25407000;31944481 False 3 100;0;0 3.352 True ENSG00000133392 ENSG00000133392 HGNC:7569 MYH14 gene MYH14 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Peripheral neuropathy, myopathy, hoarseness, and hearing loss MIM#614369 21480433;35274842;31231018;27875632 False 3 100;0;0 3.352 True ENSG00000105357 ENSG00000105357 HGNC:23212 MYH2 gene MYH2 Expert Review Green;Expert list;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Myopathy, proximal, and ophthalmoplegia MONDO:0011577 20418530;15548556;24193343;11114175;23489661;32578970;29934118;28729039;27490141;27177998 False 3 100;0;0 3.352 True ENSG00000125414 ENSG00000125414 HGNC:7572 MYH7 gene MYH7 Expert Review Green;Expert Review;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Laing distal myopathy (MIM#160500);Scapuloperoneal syndrome, myopathic type (MIM#181430) 27387980;20733148 False 3 50;50;0 3.352 True Other ENSG00000092054 ENSG00000092054 HGNC:7577 MYH7 gene MYH7 Expert Review Green;Literature;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted MYH7-related skeletal myopathy MONDO:0008050 38982518;15322983 False 3 100;0;0 3.352 True ENSG00000092054 ENSG00000092054 HGNC:7577 MYL2 gene MYL2 Expert Review Green;Other;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy, myofibrillar, 12, infantile-onset, with cardiomyopathy (MIM#619424) 23365102;9673982 False 3 100;0;0 3.352 True ENSG00000111245 ENSG00000111245 HGNC:7583 MYL9 gene MYL9 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Megacystis-microcolon-intestinal hypoperistalsis syndrome, MIM#619365 29453416;33031641;32621347 False 3 50;0;50 3.352 True ENSG00000101335 ENSG00000101335 HGNC:15754 MYMK gene MYMK Expert Review Green;Other;Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Carey-Fineman-Ziter syndrome MONDO:0009700 32333597;30065953 False 3 100;0;0 3.352 True ENSG00000187616 ENSG00000187616 HGNC:33778 MYMX gene MYMX Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Carey-Fineman-Ziter syndrome MONDO:0009700 35642635 False 3 50;50;0 3.352 True ENSG00000262179 ENSG00000262179 HGNC:52391 MYO18B gene MYO18B Expert Review Green;Expert list;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Klippel-Feil anomaly-myopathy-facial dysmorphism syndrome MONDO:0014689 25748484;27858739;32637634;32184166;27879346 False 3 100;0;0 3.352 True ENSG00000133454 ENSG00000133454 HGNC:18150 MYOD1 gene MYOD1 Expert Review Green;Other;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital Myopathy 17 (MIM#618975) 26733463;31260566;30403323 False 3 100;0;0 3.352 True ENSG00000129152 ENSG00000129152 HGNC:7611 MYOT gene MYOT Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Myopathy, myofibrillar, 3 (MIM#609200)" 30055862;21336781;15947064;10958653;15111675;16380616;33250842;32509353;29924655 False 3 0;100;0 3.352 True ENSG00000120729 ENSG00000120729 HGNC:12399 MYPN gene MYPN Expert Review Green;Other;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Nemaline Myopathy (MIM#617336;MONDO:0018958) 28017374 False 3 100;0;0 3.352 True ENSG00000138347 ENSG00000138347 HGNC:23246 NAGA gene NAGA Expert Review Green;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Kanzaki disease, MIM#609242 False 3 100;0;0 3.352 True ENSG00000198951 ENSG00000198951 HGNC:7631 NARS gene NARS Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly, impaired language, and gait abnormalities (NEDMILG), MIM#619091;Neurodevelopmental disorder with microcephaly, impaired language, epilepsy, and gait abnormalities (NEDMILEG), MIM#619092;Abnormal muscle tone;Microcephaly;Global developmental delay;Intellectual disability;Seizures;Ataxia;Abnormality of the face;Demyelinating peripheral neuropathy 32738225 False 3 100;0;0 3.352 True ENSG00000134440 ENSG00000134440 HGNC:7643 NDC1 gene NDC1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal triple-A syndrome MONDO:0009279 39003500;19782045 False 3 100;0;0 3.352 True ENSG00000058804 ENSG00000058804 HGNC:25525 NDRG1 gene NDRG1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMSN;Charcot Marie Tooth disease, type 4D, 601455;MONDO:0011085 10831399;24136616;33334662;29724652;29174527;28776325 False 3 100;0;0 3.352 True ENSG00000104419 ENSG00000104419 HGNC:7679 NEB gene NEB Expert Review Green;Other;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Nemaline Myopathy 2 (MIM#256030;MONDO: 0009725) 25205138 False 3 100;0;0 3.352 True ENSG00000183091 ENSG00000183091 HGNC:7720 NEB gene NEB Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal distal myopathy MONDO:0018949 21724397;17525139;33458580;25205138 False 3 75;25;0 3.352 True ENSG00000183091 ENSG00000183091 HGNC:7720 NEFH gene NEFH Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Charcot-Marie-Tooth disease, axonal, type 2CC, 616924;HMSN 30992180;27040688;28709447 False 3 100;0;0 3.352 True ENSG00000100285 ENSG00000100285 HGNC:7737 NEFL gene NEFL Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot Marie Tooth disease, type 2E, 607684;Charcot-Marie-Tooth disease, dominant intermediate G, 617882;HMSN;Charcot Marie Tooth disease, type 1F, 607734 10841809;12393795;14733962;24887401;25877835;20039262;12566280;29191368;28902413 False 3 100;0;0 3.352 True ENSG00000104725 ENSG00000277586 HGNC:7739 NEK1 gene NEK1 Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis, susceptibility to, 24 MIM#617892 31768050;26945885;27455347;29929116 False 3 100;0;0 3.352 True ENSG00000137601 ENSG00000137601 HGNC:7744 NEMF gene NEMF Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Intellectual developmental disorder with speech delay and axonal peripheral neuropathy, MIM# 619099;Intellectual disability;neuropathy 32934225 False 3 100;0;0 3.352 True ENSG00000165525 ENSG00000165525 HGNC:10663 NFU1 gene NFU1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple mitochondrial dysfunctions syndrome 1 (MIM#605711);Spastic paraplegia 93, autosomal recessive, MIM# 620938 36256512 False 3 100;0;0 3.352 True ENSG00000169599 ENSG00000169599 HGNC:16287 NGF gene NGF Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HSAN/SFN;Neuropathy, hereditary sensory and autonomic, type V, MIM# 608654;MONDO:0012092 14976160;20978020;33884296;32693191;31685654;30296891 False 3 100;0;0 3.352 True ENSG00000134259 ENSG00000134259 HGNC:7808 NGLY1 gene NGLY1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of deglycosylation 1 (CDDG1) (MIM#615273);Developmental delay, choreoathetosis, alacrimia, seizures, microcephaly, transaminitis, neuropathy 22581936;27388694;29419975 False 3 100;0;0 3.352 True ENSG00000151092 ENSG00000151092 HGNC:17646 NHLRC1 gene NHLRC1 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Progressive myoclonic epilepsy 2B, Lafora, 254780;Epilepsy, progressive myoclonic 2B (Lafora) 254780 False 3 100;0;0 3.352 False ENSG00000187566 ENSG00000187566 HGNC:21576 NIPA1 gene NIPA1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spastic paraplegia 6 21419568 False 3 100;0;0 3.352 True ENSG00000170113 ENSG00000170113 HGNC:17043 NIPA1 gene NIPA1 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 6, autosomal dominant, MIM# 600363;MONDO:0010878 14508710;15711826;32500351;25133278 False 3 100;0;0 3.352 True ENSG00000170113 ENSG00000170113 HGNC:17043 NIPA1 gene NIPA1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spastic paraplegia 6, autosomal dominant, MIM# 600363" 14508710;15711826 False 3 100;0;0 3.352 True ENSG00000170113 ENSG00000170113 HGNC:17043 NKX2-1 gene NKX2-1 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Choreoathetosis, hypothyroidism, and neonatal respiratory distress 610978;Choreoathetosis, hypothyroidism and neonatal respiratory distress, 610978;Chorea, hereditary benign 118700;Hereditary bening chorea, 118700 10931427;27066577;26839702;26103969 False 3 100;0;0 3.352 True ENSG00000136352 ENSG00000136352 HGNC:11825 NKX6-2 gene NKX6-2 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spastic ataxia 8 with hypomyelinating leukodystrophy, 617560;Spastic ataxia 8, autosomal recessive, with hypomyelinating leukodystrophy 617560 False 3 100;0;0 3.352 False ENSG00000148826 ENSG00000148826 HGNC:19321 NKX6-2 gene NKX6-2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 8, autosomal recessive, with hypomyelinating leukodystrophy, 617560;MONDO:0033043 28575651;15601927;32246862;32004679 False 3 100;0;0 3.352 True ENSG00000148826 ENSG00000148826 HGNC:19321 NOTCH1 gene NOTCH1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Genetic cerebral small vessel disease (MONDO:0018787), NOTCH1-related 35947102 False 3 100;0;0 3.352 True Other ENSG00000148400 ENSG00000148400 HGNC:7881 NOTCH1 gene NOTCH1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Genetic cerebral small vessel disease (MONDO:0018787), NOTCH1-related 35947102 False 3 100;0;0 3.352 True Other ENSG00000148400 ENSG00000148400 HGNC:7881 NOVA2 gene NOVA2 Expert Review Green;Literature;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with or without autistic features and/or structural brain abnormalities, OMIM #618859 PMID: 32197073 False 3 100;0;0 3.352 True ENSG00000104967 ENSG00000104967 HGNC:7887 NPC1 gene NPC1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-Pick disease, type C1 MONDO:0009757;ataxia 10480349;17003072;25497598;33228797 False 3 100;0;0 3.352 True ENSG00000141458 ENSG00000141458 HGNC:7897 NPC1 gene NPC1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-Pick disease type C1, 257220;Niemann-Pick disease types C1 and D (#257220) 10480349;17003072;25497598;33228797 False 3 100;0;0 3.352 True ENSG00000141458 ENSG00000141458 HGNC:7897 NPC2 gene NPC2 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-Pick disease type C2, 607625;Niemann-Pick disease type C2 (#607625) False 3 100;0;0 3.352 True ENSG00000119655 ENSG00000119655 HGNC:14537 NPHP1 gene NPHP1 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 4 False 3 100;0;0 3.352 False ENSG00000144061 ENSG00000144061 HGNC:7905 NPTX1 gene NPTX1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted cerebellar ataxia MONDO#0000437, NPTX1-related 34788392;35288776;35285082;35560436 False 3 100;0;0 3.352 True ENSG00000171246 ENSG00000171246 HGNC:7952 NT5C2 gene NT5C2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 45, autosomal recessive, MIM# 613162;MONDO:0013165 24482476;32153630;29123918;28884889;28327087 False 3 100;0;0 3.352 True ENSG00000076685 ENSG00000076685 HGNC:8022 NTRK1 gene NTRK1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal hereditary sensory and autonomic neuropathy type 4 MONDO:0009746 20301726;11310631 False 3 100;0;0 3.352 True ENSG00000198400 ENSG00000198400 HGNC:8031 NUBPL gene NUBPL Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 21, OMIM # 618242 23553477;32518176 False 3 100;0;0 3.352 True ENSG00000151413 ENSG00000151413 HGNC:20278 NUDT2 gene NUDT2 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular hypotonia;Global developmental delay;Intellectual disability;Polyneuropathy 33058507;27431290;30059600;33058507 False 3 100;0;0 3.352 True ENSG00000164978 ENSG00000164978 HGNC:8049 NUS1 gene NUS1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Epilepsy, myoclonus, ataxia and scoliosis;Mental retardation, autosomal dominant 55, with seizures, 617831 PMID: 31656175;29100083 False 3 100;0;0 3.352 True ENSG00000153989 ENSG00000153989 HGNC:21042 OBSCN gene OBSCN Expert Review Green;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Rhabdomyolysis, MONDO:0005290, OBSCN-related PMID: 34957489 False 3 33;0;67 3.352 True ENSG00000154358 ENSG00000154358 HGNC:15719 OFD1 gene OFD1 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 10 False 3 100;0;0 3.352 False ENSG00000046651 ENSG00000046651 HGNC:2567 OPA1 gene OPA1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Optic atrophy plus syndrome (MIM#125250) 16240368;18065439;20157015;21112924 False 3 100;0;0 3.352 True ENSG00000198836 ENSG00000198836 HGNC:8140 OPA1 gene OPA1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Behr syndrome, 210000;Optic atrophy plus syndrome, 125250;Optic atrophy 1, 165500 30165240;28494813 False 3 100;0;0 3.352 True ENSG00000198836 ENSG00000198836 HGNC:8140 OPA1 gene OPA1 Expert Review Green;Literature;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted optic atrophy with or without deafness, ophthalmoplegia, myopathy, ataxia, and neuropathy MONDO:0007429 30165240;20301426 False 3 50;50;0 3.352 True ENSG00000198836 ENSG00000198836 HGNC:8140 OPA3 gene OPA3 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Optic atrophy 3 MONDO:0008133 31119193 False 3 100;0;0 3.352 True Other ENSG00000125741 ENSG00000125741 HGNC:8142 OPA3 gene OPA3 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Optic atrophy 3 MONDO:0008133 31119193;28050599 False 3 100;0;0 3.352 True Other ENSG00000125741 ENSG00000125741 HGNC:8142 OPA3 gene OPA3 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "3-methylglutaconic aciduria, type III, MIM# 258501" False 3 100;0;0 3.352 True ENSG00000125741 ENSG00000125741 HGNC:8142 OPA3 gene OPA3 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria, type III, MIM# 258501 False 3 100;0;0 3.352 True ENSG00000125741 ENSG00000125741 HGNC:8142 OPA3 gene OPA3 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria, type III, 258501;Optic atrophy 3 with cataract, 165300;3-methylglutaconic aciduria type III, 258501;Costeff syndrome False 3 100;0;0 3.352 False ENSG00000125741 ENSG00000125741 HGNC:8142 OPHN1 gene OPHN1 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) X-linked mental retardation with cerebellar hypoplasia and distinctive facial appearance, 300486;Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance, 300486 False 3 100;0;0 3.352 True ENSG00000079482 ENSG00000079482 HGNC:8148 OPTN gene OPTN Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Amyotrophic lateral sclerosis 12 with or without frontotemporal dementia (MONDO: 0013264, MIM#613435) 20428114;31838784;27493188 False 3 100;0;0 3.352 True ENSG00000123240 ENSG00000123240 HGNC:17142 ORAI1 gene ORAI1 Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Myopathy, tubular aggregate, 2 (MIM#615883) 31448844 False 3 33;67;0 3.352 True ENSG00000182500 ENSG00000276045 HGNC:25896 ORAI1 gene ORAI1 Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted tubular aggregate myopathy MONDO:0008051 31448844;38982518 False 3 100;0;0 3.352 True Other ENSG00000182500 ENSG00000276045 HGNC:25896 PABPN1 gene PABPN1 Expert Review Green;Other Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal oculopharyngeal muscular dystrophy MONDO:0008116 19080757;33805441;16648376 False 3 100;0;0 3.352 True ENSG00000100836 ENSG00000100836 HGNC:8565 PAX7 gene PAX7 Expert Review Green;Other;Expert Review Green;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital myopathy 19 (MIM#618578) 31092906 False 3 100;0;0 3.352 True ENSG00000009709 ENSG00000009709 HGNC:8621 PCYT2 gene PCYT2 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal global developmental delay;regression;spastic parapesis or tetraparesis;epilepsy;progressive cerebral and cerebellar atrophy 31637422 False 3 100;0;0 3.352 True ENSG00000185813 ENSG00000185813 HGNC:8756 PCYT2 gene PCYT2 Expert Review Green;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 82, autosomal recessive, MIM# 618770;global developmental delay;regression;spastic parapesis or tetraparesis;epilepsy;progressive cerebral and cerebellar atrophy" 31637422 False 3 100;0;0 3.352 True ENSG00000185813 ENSG00000185813 HGNC:8756 PDHA1 gene PDHA1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Primary Pyruvate Dehydrogenase Complex Deficiency MIM 312170 36693417;33661577 False 3 100;0;0 3.352 True ENSG00000131828 ENSG00000131828 HGNC:8806 PDK3 gene PDK3 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Charcot-Marie-Tooth disease, X-linked dominant, 6 MIM#300905;HMSN 23297365;26801680;27388934;28902413 False 3 100;0;0 3.352 True ENSG00000067992 ENSG00000067992 HGNC:8811 PDXK gene PDXK Expert Review Green;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Axonal polyneuropathy;optic atrophy 32522499;31187503;27604308 False 3 50;50;0 3.352 True ENSG00000160209 ENSG00000160209 HGNC:8819 PDYN gene PDYN Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 23;Spinocerebellar ataxia 23, 610245 False 3 100;0;0 3.352 False ENSG00000101327 ENSG00000101327 HGNC:8820 PDYN gene PDYN Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 23 (MIM#610245);Cerebellar ataxia, sensory-motor axonal neuropathy;Spinocerebellar ataxia 23 21035104 False 3 50;50;0 3.352 True ENSG00000101327 ENSG00000101327 HGNC:8820 PEX10 gene PEX10 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Failure to thrive, facial dimorphism, agenesis of the corpus callosum, death in first year of life, axonal motor neuropathy, progressive ataxia and sensory-motor axonal neuropathy in adulthood described 27230853;20695019 False 3 100;0;0 3.352 True ENSG00000157911 ENSG00000157911 HGNC:8851 PEX12 gene PEX12 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 3A (Zellweger), 614859;HMSN 24627108;33123925 False 3 100;0;0 3.352 True ENSG00000108733 ENSG00000108733 HGNC:8854 PEX16 gene PEX16 Royal Melbourne Hospital;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Zellweger syndrome (614876);Peroxisome biogenesis disorder 8B (#614877) infantile progressive ataxia and spastic paresis;Peroxisome biogenesis disorder 8A, 614876;Peroxisome biogenesis disorder 8B, 614877 False 3 100;0;0 3.352 False ENSG00000121680 ENSG00000121680 HGNC:8857 PEX7 gene PEX7 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 9B, MIM# 614879 25851898 False 3 100;0;0 3.352 True ENSG00000112357 ENSG00000112357 HGNC:8860 PEX7 gene PEX7 Expert Review Green;Royal Melbourne Hospital;GeneReviews Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Refsum disease;Peroxisome biogenesis disorder 9B, MIM#614879 False 3 100;0;0 3.352 True ENSG00000112357 ENSG00000112357 HGNC:8860 PFKM gene PFKM Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease VII, MIM# 232800 2140573;8444874;7513946;7550225 False 3 100;0;0 3.352 True ENSG00000152556 ENSG00000152556 HGNC:8877 PFN1 gene PFN1 Expert Review Green;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 67;33;0 3.352 False ENSG00000108518 ENSG00000108518 HGNC:8881 PGAM2 gene PGAM2 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease X, MIM# 261670 8447317;34237446;30310767 False 3 100;0;0 3.352 True ENSG00000164708 ENSG00000164708 HGNC:8889 PGK1 gene PGK1 Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Phosphoglycerate kinase 1 deficiency 300653;MONDO:0010392 6933565;1547346;7577653;9512313 False 3 100;0;0 3.352 True ENSG00000102144 ENSG00000102144 HGNC:8896 PGM1 gene PGM1 Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type It, MIM# 614921 31563034;26303607;24878975;27206562;29858906;32681750;19625727;24499211 False 3 100;0;0 3.352 True ENSG00000079739 ENSG00000079739 HGNC:8905 PHKA1 gene PHKA1 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Muscle glycogenosis, MIM# 300559 7874115;12825073;9731190 False 3 100;0;0 3.352 True ENSG00000067177 ENSG00000067177 HGNC:8925 PHYH gene PHYH Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Refsum Disease MIM#266500 2433405;20301527 False 3 50;50;0 3.352 True ENSG00000107537 ENSG00000107537 HGNC:8940 PHYH gene PHYH Expert Review Green;Royal Melbourne Hospital;GeneReviews Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Refsum disease, MIM# 266500" False 3 100;0;0 3.352 True ENSG00000107537 ENSG00000107537 HGNC:8940 PI4KA gene PI4KA Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental syndrome with hypomyelinating leukodystrophy;Spastic paraplegia 84, autosomal recessive, MIM# 619621 PMID: 34415322 False 3 100;0;0 3.352 True ENSG00000241973 ENSG00000241973 HGNC:8983 PIGS gene PIGS Expert Review Green;Literature;Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 95, OMIM # 618143 30269814;33410539 False 3 100;0;0 3.352 True ENSG00000087111 ENSG00000087111 HGNC:14937 PITRM1 gene PITRM1 Expert Review Green;Literature;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia-30 (SCAR30), MIM#619405;intellectual disability;cognitive decline;psychosis 26697887;29764912 False 3 100;0;0 3.352 True ENSG00000107959 ENSG00000107959 HGNC:17663 PLA2G16 gene PLA2G16 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lipodystrophy, familial partial, type 9, MIM# 620683 PMID: 37919452 False 3 100;0;0 3.352 True ENSG00000176485 ENSG00000176485 HGNC:17825 PLA2G6 gene PLA2G6 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Infantile neuroaxonal dystrophy 1 (MIM#256600);Neurodegeneration with brain iron accumulation 2B (MIM#610217) 29859652 False 3 100;0;0 3.352 True ENSG00000184381 ENSG00000184381 HGNC:9039 PLA2G6 gene PLA2G6 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive Parkinson disease 14, 612953;Parkinson disease 14 (#612953);Infantile neuroaxonal dystrophy 1 (#256600);Infantile neuroaxonal dystrophy 1, 256600;Neurodegeneration with brain iron accumulation 2B (#610217);Neurodegeneration with brain iron accumulation 2B, 610217 False 3 100;0;0 3.352 True ENSG00000184381 ENSG00000184381 HGNC:9039 PLEC gene PLEC Expert Review Green;Expert Review;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 17 (MIM#613723) 20624679;21109228;28824526 False 3 100;0;0 3.352 True ENSG00000178209 ENSG00000178209 HGNC:9069 PLEC gene PLEC Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal epidermolysis bullosa;congenital myasthenic syndrome 31509265;21263134;20624679 False 3 100;0;0 3.352 True ENSG00000178209 ENSG00000178209 HGNC:9069 PLEC gene PLEC Expert Review Green;Expert Review;Expert Review Green;Expert Review;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy with epidermolysis bullosa simplex, 226670 22144912 False 3 100;0;0 3.352 True ENSG00000178209 ENSG00000178209 HGNC:9069 PLEKHG5 gene PLEKHG5 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMSN, dHMN/dSMA;Charcot-Marie-Tooth disease, recessive intermediate C, MIM# 615376;Spinal muscular atrophy, distal, autosomal recessive, 4, MIM# 611067 17564964;23777631;23844677;33492783;33275839;33220101;23777631 False 3 100;0;0 3.352 True ENSG00000171680 ENSG00000171680 HGNC:29105 PLP1 gene PLP1 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Spastic paraplegia 2, X-linked recessive, 312920 15627202;8012387 False 3 100;0;0 3.352 True ENSG00000123560 ENSG00000123560 HGNC:9086 PLP1 gene PLP1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females "Spastic paraplegia 2, X-linked, MIM# 312920" 15627202;8012387 False 3 100;0;0 3.352 True ENSG00000123560 ENSG00000123560 HGNC:9086 PMM2 gene PMM2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neonatal-onset, leukodystrophy, abnormal serum glycoproteins, mental retardation, hypotonia, ataxia, retinitis pigmentosa, seizures, slowly progressive neuropathy with SNCV, severe infections, hepatic insufficiency and cardiomyopathy 20301507;20301289 False 3 100;0;0 3.352 True ENSG00000140650 ENSG00000140650 HGNC:9115 PMP22 gene PMP22 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Charcot Marie Tooth disease, type 1A, 118220;Roussy Levy syndrome, 180800;Neuropathy, inflammatory demyelinating, 139393;Neuropathy, recurrent, with pressure palsies, 162500;Charcot Marie Tooth disease, type 1E, 118300;Dejerine Sottas disease, 145900;HMSN False 3 100;0;0 3.352 True ENSG00000109099 ENSG00000109099 HGNC:9118 PMPCA gene PMPCA Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 2, MIM# 213200 25808372;26657514;33272776;30617178 False 3 100;0;0 3.352 True ENSG00000165688 ENSG00000165688 HGNC:18667 PMPCB gene PMPCB Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple mitochondrial dysfunctions syndrome 6, 617954 29576218 False 3 100;0;0 3.352 True ENSG00000105819 ENSG00000105819 HGNC:9119 PNKD gene PNKD Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Paroxysmal nonkinesigenic dyskinesia 1, 118800 False 3 100;0;0 3.352 True ENSG00000127838 ENSG00000127838 HGNC:9153 PNKP gene PNKP Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Microcephaly, seizures and developmental delay, 613402;Ataxia-oculomotor apraxia 4, 616267;Ataxia with oculomotor apraxia 4 (#616267) 31436889;31707899 False 3 100;0;0 3.352 True ENSG00000039650 ENSG00000039650 HGNC:9154 PNKP gene PNKP Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, axonal, type 2B2 (MIM#605589);Ataxia-oculomotor apraxia 4 (MIM#616267) 30039206;27066567;25728773 False 3 100;0;0 3.352 True ENSG00000039650 ENSG00000039650 HGNC:9154 PNPLA2 gene PNPLA2 Expert list;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Neutral lipid storage disease with myopathy MIM#610717" 18952067;25287355;25956450 False 3 67;0;33 3.352 True ENSG00000177666 ENSG00000177666 HGNC:30802 PNPLA2 gene PNPLA2 Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Neutral lipid storage disease with myopathy 610717" PMID: 32269696;21544567 False 3 100;0;0 3.352 True ENSG00000177666 ENSG00000177666 HGNC:30802 PNPLA6 gene PNPLA6 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 39, autosomal recessive, 612020 18313024 False 3 100;0;0 3.352 True ENSG00000032444 ENSG00000032444 HGNC:16268 PNPLA6 gene PNPLA6 Expert Review Green;Expert list;Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spastic paraplegia 39 (#612020), ataxia seen in some patients;Boucher-Neuhauser syndrome, 215470;Sapstic paraplegia 39, 612020;Oliver-McFarlane syndrome (#603197);Spinocerebellar ataxia, hypogonadotropic hypogonadism and chorioretinal dystrophy (Boucher-Neuhauser syndrome, #215470);Oliver-McFarlane syndrome, 275400 False 3 100;0;0 3.352 False ENSG00000032444 ENSG00000032444 HGNC:16268 PNPLA6 gene PNPLA6 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Laurence-Moon Syndrome (LMS) MIM#245800;Spastic Paraplegia Type 39 MIM#612020 25299038;18313024 False 3 100;0;0 3.352 True ENSG00000032444 ENSG00000032444 HGNC:16268 PNPLA6 gene PNPLA6 Expert Review Green;Expert list;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Boucher-Neuhauser syndrome MIM#215470;Laurence-Moon syndrome MIM#245800;Oliver-McFarlane syndrome MIM#275400;Spastic paraplegia 39, autosomal recessive MIM#612020 False 3 100;0;0 3.352 True ENSG00000032444 ENSG00000032444 HGNC:16268 PNPLA8 gene PNPLA8 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Complex neurodevelopmental disorder, MONDO:0100038, PNPLA8-related PMID: 39082157 False 3 100;0;0 3.352 True ENSG00000135241 ENSG00000135241 HGNC:28900 POGLUT1 gene POGLUT1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 21 (MIM#617232) 27807076;29034878;31897643 False 3 67;33;0 3.352 True ENSG00000163389 ENSG00000163389 HGNC:22954 POLG gene POLG Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 4B (MNGIE type) 613662;Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) 607459;Progressive external ophthalmoplegia, autosomal dominant 1 157640;Mitochondrial DNA depletion syndrome 4A (Alpers type) 203700;Progressive external ophthalmoplegia, autosomal recessive 1 258450 30451971 False 3 100;0;0 3.352 True ENSG00000140521 ENSG00000140521 HGNC:9179 POLG gene POLG Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 4A (Alpers type) MIM#203700;Mitochondrial DNA depletion syndrome 4B (MNGIE type) MIM#613662;Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) MIM#607459;Progressive external ophthalmoplegia, autosomal recessive 1 MIM#258450 False 3 100;0;0 3.352 True ENSG00000140521 ENSG00000140521 HGNC:9179 POLG gene POLG Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 4A (Alpers type), MIM# 203700 22006280 False 3 100;0;0 3.352 True ENSG00000140521 ENSG00000140521 HGNC:9179 POLG gene POLG Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) 607459 20301791 False 3 100;0;0 3.352 True ENSG00000140521 ENSG00000140521 HGNC:9179 POLG gene POLG Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE);Mitochondrial recessive ataxia syndrome, 607459;Mitochondrial DNA depletion types 4A, 203700 and 4B, 613662;autosomal recessive progressive external opthalmoplegia, 258450;autosomal dominant progressive external ophthalmoplegia, 157640 False 3 100;0;0 3.352 False ENSG00000140521 ENSG00000140521 HGNC:9179 POLG2 gene POLG2 Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 4, MIM# 610131 16685652;21555342;27592148;31778857 False 3 50;50;0 3.352 True ENSG00000256525 ENSG00000256525 HGNC:9180 POLR3A gene POLR3A Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 31637490 False 3 100;0;0 3.352 True ENSG00000148606 ENSG00000148606 HGNC:30074 POLR3A gene POLR3A Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal Recessive Ataxia;Leukodystrophy, hypomyelinating, 7, with or without oligodontia and/or hypogonadotropic hypogonadism;Hypomyelinating leukodystrophy 7 with or without oligodontia and/or hypogonadotrophic hypogonadism, 607694 False 3 100;0;0 3.352 True ENSG00000148606 ENSG00000148606 HGNC:30074 POLR3B gene POLR3B Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, demyelinating, type 1I, MIM# 619742 PMID: 33417887 False 3 100;0;0 3.352 True ENSG00000013503 ENSG00000013503 HGNC:30348 POLR3B gene POLR3B Expert Review Green;Royal Melbourne Hospital;GeneReviews Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism, MIM#614381 22036171;22036172 False 3 100;0;0 3.352 True ENSG00000013503 ENSG00000013503 HGNC:30348 POMGNT1 gene POMGNT1 Expert Review Green;Expert Review;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (limb-girdle) type C, 8 MIM#618135 27391550;26908613;30961548;30937090 False 3 100;0;0 3.352 True ENSG00000085998 ENSG00000085998 HGNC:19139 POMGNT1 gene POMGNT1 Expert Review Green;Expert Review;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 3.352 False ENSG00000085998 ENSG00000085998 HGNC:19139 POMGNT2 gene POMGNT2 Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 3.352 False ENSG00000144647 ENSG00000144647 HGNC:25902 POMGNT2 gene POMGNT2 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 8, 614830 False 3 100;0;0 3.352 False ENSG00000144647 ENSG00000144647 HGNC:25902 POMK gene POMK Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 12, MIM# 615249;Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 12, MIM# 616094 32907597;31833209;29910097;28109637;24925318;24556084 False 3 100;0;0 3.352 True ENSG00000185900 ENSG00000185900 HGNC:26267 POMT1 gene POMT1 Expert Review Green;Expert Review;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 3.352 False ENSG00000130714 ENSG00000130714 HGNC:9202 POMT1 gene POMT1 Expert Review Green;Expert Review;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type False 3 100;0;0 3.352 False ENSG00000130714 ENSG00000130714 HGNC:9202 POMT2 gene POMT2 Expert Review Green;Expert Review;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 3.352 False ENSG00000009830 ENSG00000009830 HGNC:19743 POMT2 gene POMT2 Expert Review Green;Expert Review;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type False 3 100;0;0 3.352 False ENSG00000009830 ENSG00000009830 HGNC:19743 POPDC3 gene POPDC3 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Muscular dystrophy, limb-girdle, autosomal recessive 26, MIM# 618848" 31610034 False 3 100;0;0 3.352 True ENSG00000132429 ENSG00000132429 HGNC:17649 POU4F1 gene POU4F1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ataxia;intention tremor;hypotonia 33783914;8876243 False 3 100;0;0 3.352 True ENSG00000152192 ENSG00000152192 HGNC:9218 PPOX gene PPOX Expert Review Green;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Porphyria variegata, MIM# 176200;Variegate porphyria, childhood-onset, MIM# 620483" 9811936;11286631;33159949 False 3 100;0;0 3.352 True ENSG00000143224 ENSG00000143224 HGNC:9280 PRDM12 gene PRDM12 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuropathy, hereditary sensory and autonomic, type VIII, MIM# 616488;MONDO:0014662;HSAN/SFN 26005867;33789102;33010785;32828702 False 3 100;0;0 3.352 True ENSG00000130711 ENSG00000130711 HGNC:13997 PRDX3 gene PRDX3 Expert Review Green;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia (early onset, mild to moderate, progressive) 33889951 False 3 100;0;0 3.352 True ENSG00000165672 ENSG00000165672 HGNC:9354 PRDX3 gene PRDX3 Expert Review Green;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia (early onset, mild to moderate, progressive) 33889951 False 3 100;0;0 3.352 True ENSG00000165672 ENSG00000165672 HGNC:9354 PRKAG2 gene PRKAG2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Wolff-Parkinson-White syndrome 194200;Cardiomyopathy, hypertrophic 6 600858;Glycogen storage disease of heart, lethal congenital 261740 15766830;31049239 False 3 100;0;0 3.352 True ENSG00000106617 ENSG00000106617 HGNC:9386 PRKCG gene PRKCG Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 14 MIM#605361 25217572;18577575;31158466 False 3 100;0;0 3.352 True Other ENSG00000126583 ENSG00000126583 HGNC:9402 PRNP gene PRNP Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Multiple allelic disorders reported;Huntington disease-like 1;Autosomal Dominant Ataxia;Gerstmann-Straussler disease;Insomnia, fatal familial;Creutzfeldt-Jakob disease 2564168;34324063;20301407 False 3 100;0;0 3.352 True ENSG00000171867 ENSG00000171867 HGNC:9449 PRNP gene PRNP Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Prion diseases;peripheral neuropathy;chronic diarrhea;dementia 31953922;31907995;29928661;27716661;26926995;24224623;26768678 False 3 50;0;50 3.352 True ENSG00000171867 ENSG00000171867 HGNC:9449 PRPS1 gene PRPS1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Charcot Marie Tooth disease, X linked recessive, 5, 311070;HMSN 17701900;24285972;25491489;25182139 False 3 100;0;0 3.352 True ENSG00000147224 ENSG00000147224 HGNC:9462 PRRT2 gene PRRT2 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Familial infantile convulsions with paroxysmal dyskinesia 1, 602066;CONVULSIONS, FAMILIAL INFANTILE, WITH PAROXYSMAL CHOREOATHETOSIS;episodic kinesigenic dyskinesia;dystonia and occasionally hemiplegic migraine and epilepsy;episodic kinesigenic dyskinesia, 128200;EPISODIC KINESIGENIC DYSKINESIA 1;SEIZURES, BENIGN FAMILIAL INFANTILE, 2 26598494;31193310;30501978;30713971 False 3 100;0;0 3.352 False ENSG00000167371 ENSG00000167371 HGNC:30500 PRRT2 gene PRRT2 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Episodic kinesigenic dyskinesia 1 MIM#128200;Convulsions, familial infantile, with paroxysmal choreoathetosis MIM#602066;Seizures, benign familial infantile, 2 MIM#605751 26598494;31193310;30501978;30713971 False 3 100;0;0 3.352 True ENSG00000167371 ENSG00000167371 HGNC:30500 PRX gene PRX Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dejerine Sottas disease, autosomal recessive, 145900;Charcot Marie Tooth disease, type 4F, 614895;HMSN 11133365;11157804;15197604;21079185;22847150;10839370;32460404;31523542;31426691 False 3 100;0;0 3.352 True ENSG00000105227 ENSG00000105227 HGNC:13797 PSEN1 gene PSEN1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alzheimer disease, type 3, with spastic paraparesis and apraxia, MIM# 607822 33274538 False 3 100;0;0 3.352 True ENSG00000080815 ENSG00000080815 HGNC:9508 PTRH2 gene PTRH2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Infantile multi-system neurologic, endocrine, and pancreatic disease, 616263 25558065;25574476;31057140;27129381 False 3 100;0;0 3.352 True ENSG00000141378 ENSG00000141378 HGNC:24265 PTRH2 gene PTRH2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Infantile multisystem neurologic, endocrine, and pancreatic disease (IMNPED) (MIM#616263);Infantile-onset multisystem disease with intellectual disability, microcephaly, progressive ataxia, sensory neuronal hearing loss, hepatomegaly, pancreatic insufficiency, proximal placement of thumb, SNCV neuropathy 25574476;27129381;28328138 False 3 100;0;0 3.352 True ENSG00000141378 ENSG00000141378 HGNC:24265 PUM1 gene PUM1 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 47, 617931 False 3 100;0;0 3.352 False ENSG00000134644 ENSG00000134644 HGNC:14957 PUS1 gene PUS1 Expert Review Green;Expert Review;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal myopathy, lactic acidosis, and sideroblastic anemia 1 MONDO:0024553 25227147;17056637;15108122;32287105;31641589;28832011 False 3 100;0;0 3.352 True ENSG00000177192 ENSG00000177192 HGNC:15508 PYGM gene PYGM Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease V McArdle disease 232600 AR 32386344 False 3 100;0;0 3.352 True ENSG00000068976 ENSG00000068976 HGNC:9726 PYROXD1 gene PYROXD1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy, myofibrillar, 8, 617258;adult-onset limb girdle muscular dystrophy 30345904;30515627;27745833 False 3 0;100;0 3.352 True ENSG00000121350 ENSG00000121350 HGNC:26162 PYROXD1 gene PYROXD1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myofibrillar myopathy 8 MONDO:0014993 30345904;30515627;27745833 False 3 100;0;0 3.352 True ENSG00000121350 ENSG00000121350 HGNC:26162 RAB3GAP2 gene RAB3GAP2 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Martsolf syndrome 212720" PMID: 32376645 False 3 100;0;0 3.352 True ENSG00000118873 ENSG00000118873 HGNC:17168 RAB7A gene RAB7A Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, type 2B, MIM# 600882;MONDO:0010949 12545426;17060578;32326241;29130394;25614874 False 3 100;0;0 3.352 True ENSG00000075785 ENSG00000075785 HGNC:9788 RAD21 gene RAD21 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mungan syndrome, MIM# 611376: Barrett esophagus, megaduodenum, cardiac abnormalities 14638363;32193685;25575569 False 3 100;0;0 3.352 True ENSG00000164754 ENSG00000164754 HGNC:9811 RAPSN gene RAPSN Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 11, associated with acetylcholine receptor deficiency, 616326;acute respiratory crises;late and early onset 11791205;14504330;20930056;25194721 False 3 100;0;0 3.352 True ENSG00000165917 ENSG00000165917 HGNC:9863 RBCK1 gene RBCK1 Expert Review Green;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polyglucosan body myopathy 1 with or without immunodeficiency 615895 29260357;29695863 False 3 100;0;0 3.352 True ENSG00000125826 ENSG00000125826 HGNC:15864 REEP1 gene REEP1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Spinal muscular atrophy, distal, autosomal recessive, 6, MIM#620011;Neuronopathy, distal hereditary motor, type VB MIM#614751;Spastic paraplegia 31, autosomal dominant MIM#610250 27066569;31872057;22703882;29124833 False 3 100;0;0 3.352 True Other ENSG00000068615 ENSG00000068615 HGNC:25786 REEP1 gene REEP1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spastic paraplegia 31, autosomal dominant, MIM# 610250" 16826527;19034539 False 3 100;0;0 3.352 True ENSG00000068615 ENSG00000068615 HGNC:25786 REEP1 gene REEP1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 31, autosomal dominant MIM#610250 23108492;22703882 False 3 100;0;0 3.352 True ENSG00000068615 ENSG00000068615 HGNC:25786 REEP1 gene REEP1 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 31, autosomal dominant, 610250;MONDO:0012453 16826527;19034539 False 3 100;0;0 3.352 True ENSG00000068615 ENSG00000068615 HGNC:25786 REEP2 gene REEP2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 72, dominant and recessive, MIM# 615625;MONDO:0014282 33526816;28491902;24388663 False 3 100;0;0 3.352 True ENSG00000132563 ENSG00000132563 HGNC:17975 RET gene RET Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Central hypoventilation syndrome, congenital, MIM# 209880;Multiple endocrine neoplasia IIA, MIM# 171400;Multiple endocrine neoplasia IIB, MIM# 162300 False 3 100;0;0 3.352 True ENSG00000165731 ENSG00000165731 HGNC:9967 RETREG1 gene RETREG1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuropathy, hereditary sensory and autonomic, type IIB, 613115;HSAN/SFN 19838196;24327336;31737055;31596031 False 3 100;0;0 3.352 True ENSG00000154153 ENSG00000154153 HGNC:25964 RFC1 gene RFC1 Expert Review Green;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome OMIM 614575 30926972;33103729;35883251;36478048;36289003 False 3 67;33;0 3.352 True Other ENSG00000035928 ENSG00000035928 HGNC:9969 RFC1 gene RFC1 Expert Review Green;Expert list;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575 30926972;33103729;35883251;36478048;36289003 False 3 67;33;0 3.352 True ENSG00000035928 ENSG00000035928 HGNC:9969 RFC4 gene RFC4 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Morimoto-Ryu-Malicdan neuromuscular syndrome, MIM# 621010 PMID: 39106866 False 3 100;0;0 3.352 True ENSG00000163918 ENSG00000163918 HGNC:9972 RINT1 gene RINT1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary spastic paraplegia, MONDO:0019064, RINT1-related 37463447;38990652 False 3 50;50;0 3.352 True ENSG00000135249 ENSG00000135249 HGNC:21876 RMND1 gene RMND1 Expert Review Green;Other;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation defect type 11 MONDO:0013969 23022099;25604853;27843092 False 3 100;0;0 3.352 False ENSG00000155906 ENSG00000155906 HGNC:21176 RNASEH2B gene RNASEH2B Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi Goutieres syndrome 2, MIM# 610181 29691679;30223285;29239743;28762473 False 3 100;0;0 3.352 True ENSG00000136104 ENSG00000136104 HGNC:25671 RNF170 gene RNF170 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 85, autosomal recessive, MIM# 619686 31636353 False 3 100;0;0 3.352 True ENSG00000120925 ENSG00000120925 HGNC:25358 RNF170 gene RNF170 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ataxia, sensory, 1, autosomal dominant, MIM# 608984 32943585;21115467 False 3 100;0;0 3.352 True ENSG00000120925 ENSG00000120925 HGNC:25358 RNF216 gene RNF216 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia and hypogonadotropic hypogonadism MIM#212840 False 3 100;0;0 3.352 True ENSG00000011275 ENSG00000011275 HGNC:21698 RNF216 gene RNF216 Expert list;Royal Melbourne Hospital;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia and hypogonadotrophic hypogonadism;Cerebellar ataxia and hypogonadotropic hypogonadism, 212840 False 3 100;0;0 3.352 False ENSG00000011275 ENSG00000011275 HGNC:21698 RNF220 gene RNF220 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 23, with ataxia, deafness, liver dysfunction, and dilated cardiomyopathy, MIM# 619688;Leukodystrophy;CNS hypomyelination;Ataxia;Intellectual disability;Sensorineural hearing impairment;Elevated hepatic transaminases;Hepatic fibrosis;Dilated cardiomyopathy;Spastic paraplegia;Dysarthria;Abnormality of the corpus callosum 33964137;10881263 False 3 100;0;0 3.352 True ENSG00000187147 ENSG00000187147 HGNC:25552 RNU7-1 gene RNU7-1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 9, MIM# 619487 33230297 False 3 100;0;0 3.352 True ENSG00000238923 ENSG00000238923 HGNC:34033 RORA gene RORA Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder with or without epilepsy or cerebellar ataxia, 618060 29656859 False 3 100;0;0 3.352 True ENSG00000069667 ENSG00000069667 HGNC:10258 RPGRIP1L gene RPGRIP1L Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 7, MIM# 611560" False 3 100;0;0 3.352 True ENSG00000103494 ENSG00000103494 HGNC:29168 RRM2B gene RRM2B Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 8A (encephalomyopathic type with renal tubulopathy), 612075;Mitochondrial DNA depletion syndrome 8B (MNGIE type), 612075;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 5, 613077 32827185;24741716 False 3 100;0;0 3.352 True ENSG00000048392 ENSG00000048392 HGNC:17296 RRM2B gene RRM2B Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 8B (MNGIE type) MIM#612075;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 5 MIM#613077 19667227;23107649 False 3 100;0;0 3.352 True ENSG00000048392 ENSG00000048392 HGNC:17296 RTN2 gene RTN2 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 12, autosomal dominant, 604805;MONDO:0011489 22232211;27165006 False 3 100;0;0 3.352 True ENSG00000125744 ENSG00000125744 HGNC:10468 RTN2 gene RTN2 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 12, autosomal dominant, 604805;MONDO:0011489 22232211;27165006 False 3 100;0;0 3.352 True ENSG00000125744 ENSG00000125744 HGNC:10468 RTN2 gene RTN2 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuronopathy, distal hereditary motor, autosomal recessive 11, with spasticity, MIM# 620854 38527963 False 3 100;0;0 3.352 True ENSG00000125744 ENSG00000125744 HGNC:10468 RUBCN gene RUBCN Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Royal Melbourne Hospital Clinical Genetics Department Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 15, MIM#615705 20826435;23728897 False 3 100;0;0 3.352 True ENSG00000145016 ENSG00000145016 HGNC:28991 RYR1 gene RYR1 Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal {Malignant hyperthermia susceptibility 1}, 145600;Central core disease, 117000;King-Denborough syndrome, 145600;Neuromuscular disease, congenital, with uniform type 1 fiber, 117000;Minicore myopathy with external ophthalmoplegia, 255320 20301325;23553484 False 3 67;33;0 3.352 True ENSG00000196218 ENSG00000196218 HGNC:10483 RYR1 gene RYR1 Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal calf predominant distal myopathy;distal myopathy MONDO:0018949 30842289;33458580 False 3 100;0;0 3.352 True ENSG00000196218 ENSG00000196218 HGNC:10483 RYR1 gene RYR1 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Malignant hyperthermia False 3 100;0;0 3.352 False ENSG00000196218 ENSG00000196218 HGNC:10483 RYR1 gene RYR1 Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Central core disease (MIM#117000);Minicore myopathy with external ophthalmoplegia (MIM#255320);Neuromuscular disease, congenital, with uniform type 1 fiber (MIM#117000) 23553484 False 3 33;33;33 3.352 True ENSG00000196218 ENSG00000196218 HGNC:10483 SACS gene SACS Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia, Charlevoix-Saguenay type MIM#270550 False 3 100;0;0 3.352 True ENSG00000151835 ENSG00000151835 HGNC:10519 SACS gene SACS Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charlevoix-Saguenay spastic ataxia (MONDO:0010041;MIM#270550) 20301432;20876471 False 3 100;0;0 3.352 True ENSG00000151835 ENSG00000151835 HGNC:10519 SACS gene SACS Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia, Charlevoix-Saguenay type, 270550;MONDO:0010041 False 3 100;0;0 3.352 True ENSG00000151835 ENSG00000151835 HGNC:10519 SACS gene SACS Expert list;Royal Melbourne Hospital;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia, Charlevoix-Saguenay type;Charlevoix-Saguenay spastic ataxia, 270550 False 3 100;0;0 3.352 False ENSG00000151835 ENSG00000151835 HGNC:10519 SACS gene SACS Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic ataxia, Charlevoix-Saguenay type, MIM@ 270550" False 3 100;0;0 3.352 True ENSG00000151835 ENSG00000151835 HGNC:10519 SAMD9 gene SAMD9 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted MIRAGE syndrome, MIM# 617053 27182967 False 3 100;0;0 3.352 True ENSG00000205413 ENSG00000205413 HGNC:1348 SAMD9L gene SAMD9L Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 49, MIM# 619806;Ataxia-pancytopaenia syndrome, MIM# 159550 35310830;33884299;28570036 False 3 100;0;0 3.352 True ENSG00000177409 ENSG00000177409 HGNC:1349 SAMHD1 gene SAMHD1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi Goutieres syndrome 5, MIM# 612952 False 3 100;0;0 3.352 True ENSG00000101347 ENSG00000101347 HGNC:15925 SARS gene SARS Expert Review Green;Literature;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Genetic peripheral neuropathy MONDO#0020127, SARS1-related 36088542 False 3 67;33;0 3.352 True ENSG00000031698 ENSG00000031698 HGNC:10537 SBF1 gene SBF1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, type 4B3 , MIM#615284;MONDO:0014117 23749797;23749797;32444983;30039846;28005197 False 3 100;0;0 3.352 True ENSG00000100241 ENSG00000100241 HGNC:10542 SBF1 gene SBF1 Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, type 4B3 , MIM#615284;MONDO:0014117 23749797;23749797;32444983;30039846;28005197 False 3 100;0;0 3.352 True ENSG00000100241 ENSG00000100241 HGNC:10542 SBF2 gene SBF2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMSN;Charcot Marie Tooth disease, type 4B2, MIM#604563 12554688;15477569;12687498;15304601;31772832;31070812 False 3 100;0;0 3.352 True ENSG00000133812 ENSG00000133812 HGNC:2135 SCN10A gene SCN10A Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown HSAN/SFN;Episodic pain syndrome, familial, 2, 615551 23115331;33775738;30731422;30554136 False 3 100;0;0 3.352 True ENSG00000185313 ENSG00000185313 HGNC:10582 SCN11A gene SCN11A Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Neuropathy, hereditary sensory and autonomic, type VII, MIM# 615548" 27503742;25118027 False 3 100;0;0 3.352 True ENSG00000168356 ENSG00000168356 HGNC:10583 SCN11A gene SCN11A Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuropathy, hereditary sensory and autonomic, type VII, MIM# 615548;MONDO:0014244 24036948;25118027;30395542;33884296;32831372;30046661 False 3 100;0;0 3.352 True ENSG00000168356 ENSG00000168356 HGNC:10583 SCN1A gene SCN1A Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 6 (Dravet syndrome), MIM# 607208 27264139;27817982;28732259 False 3 67;33;0 3.352 True ENSG00000144285 ENSG00000144285 HGNC:10585 SCN2A gene SCN2A Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Early infantile epileptic encephalopathy 11, MIM# 613721 False 3 100;0;0 3.352 True ENSG00000136531 ENSG00000136531 HGNC:10588 SCN4A gene SCN4A Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hyperkalemic Periodic Paralysis;Hypokalemic periodic paralysis, type 2, 613;Thyrotoxic Periodic Paralysis, Susceptibility To, 2;Hypokalemic Periodic Paralysis;Episodic weakness;Myotonia;Potassium-Aggravated Myotonia;Hyperkalemic periodic paralysis, type 2, 170500;Myasthenic syndrome, acetazolamide-responsive, 614198 8385748;11591859 False 3 100;0;0 3.352 True ENSG00000007314 ENSG00000007314 HGNC:10591 SCN4A gene SCN4A Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 16, 614198 12766226;25707578;32849172 False 3 100;0;0 3.352 True ENSG00000007314 ENSG00000007314 HGNC:10591 SCN4A gene SCN4A Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Paramyotonia congenita, 168300;Myotonia congenita, atypical, acetazolamide-responsive, 608390;Hypokalemic periodic paralysis, type 2, 613345;Myasthenic syndrome, congenital, 16, 614198;Hyperkalemic periodic paralysis, type 2, 170500 23801527;28779239;32978841 False 3 100;0;0 3.352 True ENSG00000007314 ENSG00000007314 HGNC:10591 SCN8A gene SCN8A Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy 13, 614558;Cognitive impairment with or without cerebellar ataxia, 614306 31904124;31887642;31675620 False 3 100;0;0 3.352 True ENSG00000196876 ENSG00000196876 HGNC:10596 SCN9A gene SCN9A Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Erythermalgia, primary, MIM# 133020;Insensitivity to pain, congenital, MIM# 243000;Neuropathy, hereditary sensory and autonomic, type IID, MIM# 243000;Paroxysmal extreme pain disorder, MIM# 167400;Small fiber neuropathy,MIM# 133020 False 3 100;0;0 3.352 True ENSG00000169432 ENSG00000169432 HGNC:10597 SCO2 gene SCO2 Expert Review Green;Other;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency 1 MONDO:0011451 23719228 False 3 100;0;0 3.352 True ENSG00000130489 ENSG00000130489 HGNC:10604 SCO2 gene SCO2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal autosomal recessive axonal charcot-marie-tooth disease due to copper metabolism defect MONDO:0033850 29351582;31844624;35112411 False 3 100;0;0 3.352 True ENSG00000130489 ENSG00000130489 HGNC:10604 SCYL1 gene SCYL1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 21 (MIM#616719);acute infantile liver failure-cerebellar ataxia-peripheral sensory motor neuropathy syndrome (MONDO:0014744);Spinocerebellar ataxia, autosomal recessive 21;Early-onset ataxia (<1 year) with recurrent episodes of liver failure, sensory-motor axonal neuropathy, cerebellar atrophy 26581903;30531813 False 3 100;0;0 3.352 True ENSG00000142186 ENSG00000142186 HGNC:14372 SCYL1 gene SCYL1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 21, 616719;Early-onset ataxia (<1 year) with recurrent episodes of liver failure, sensory-motor axonal neuropathy, cerebellar atrophy 29419818;17571074;26581903;30531813 False 3 100;0;0 3.352 True ENSG00000142186 ENSG00000142186 HGNC:14372 SELENON gene SELENON Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, rigid spine, 1 (MIM#602771) 11528383 False 3 100;0;0 3.352 True ENSG00000162430 ENSG00000162430 HGNC:15999 SEPT9 gene SEPT9 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophy, hereditary neuralgic, MIM# 162100;HMSN 16186812;19451530;19939853;19139049 False 3 100;0;0 3.352 True ENSG00000184640 ENSG00000184640 HGNC:7323 SERAC1 gene SERAC1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome, MIM# 614739 False 3 100;0;0 3.352 True ENSG00000122335 ENSG00000122335 HGNC:21061 SETX gene SETX Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal dHMN/dSMA;Amyotrophic lateral sclerosis 4, juvenile MIM# 602433;Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 2 23129421;16644229;30052327 False 3 100;0;0 3.352 True ENSG00000107290 ENSG00000107290 HGNC:445 SETX gene SETX Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic Lateral Sclerosis 4, juvenile (MIM#602433) 15106121;9497266 False 3 100;0;0 3.352 True ENSG00000107290 ENSG00000107290 HGNC:445 SETX gene SETX Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 2 MIM#606002 False 3 100;0;0 3.352 True ENSG00000107290 ENSG00000107290 HGNC:445 SETX gene SETX Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spinocerebellar ataxia type 1, 606002;ataxia with oculomotor apraxia type 2 (AOA2), juvenile amyotrophic lateral sclerosis (ALS4) and autosomal dominant ataxia;Ataxia-ocular apraxia-2 14770181;20301333 False 3 100;0;0 3.352 True ENSG00000107290 ENSG00000107290 HGNC:445 SGCA gene SGCA Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 3 MIM#608099 27297959;26453141;23989969 False 3 100;0;0 3.352 True ENSG00000108823 ENSG00000108823 HGNC:10805 SGCA gene SGCA Expert Review Green;Expert Review Green;Expert Review;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Limb-girdle muscular dystrophy;Muscular dystrophy, limb-girdle, type 2D, 608099;autosomal recessive limb-girdle muscular dystrophy, MONDO:0015152 30007747;9192266;34404573 False 3 100;0;0 3.352 True ENSG00000108823 ENSG00000108823 HGNC:10805 SGCB gene SGCB Expert Review;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, type 2E, 604286 False 3 100;0;0 3.352 False ENSG00000163069 ENSG00000163069 HGNC:10806 SGCD gene SGCD Expert Review Green;Expert Review;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, type 2F, 601287 False 3 67;0;33 3.352 False ENSG00000170624 ENSG00000170624 HGNC:10807 SGCG gene SGCG Expert Review Green;Expert Review;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, type 2C, 253700 30838351;25802879 False 3 100;0;0 3.352 True ENSG00000102683 ENSG00000102683 HGNC:10809 SH3TC2 gene SH3TC2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal HMSN;Charcot Marie Tooth disease, type 4C, 601596;Mononeuropathy of the median nerve, mild, 613353 19744956;20220177;19744956;20028792 False 3 100;0;0 3.352 True ENSG00000169247 ENSG00000169247 HGNC:29427 SHMT2 gene SHMT2 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with cardiomyopathy, spasticity, and brain abnormalities (NEDCASB), MIM#619121;Congenital microcephaly;Infantile axial hypotonia;Spastic paraparesis;Global developmental delay;Intellectual disability;Abnormality of the corpus callosum;Abnormal cortical gyration;Hypertrophic cardiomyopathy;Abnormality of the face;Proximal placement of thumb;2-3 toe syndactyly 33015733 False 3 100;0;0 3.352 True ENSG00000182199 ENSG00000182199 HGNC:10852 SIGMAR1 gene SIGMAR1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ?Distal spinal muscular atrophy, autosomal recessive 2;dHMN/dSMA;Distal hereditary motor neuropathy of Jerash type (HMNJ) 31511340 False 3 100;0;0 3.352 True ENSG00000147955 ENSG00000147955 HGNC:8157 SIGMAR1 gene SIGMAR1 Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 67;33;0 3.352 False ENSG00000147955 ENSG00000147955 HGNC:8157 SIL1 gene SIL1 Royal Melbourne Hospital;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Marinesco-Sjogren syndrome, 248800 False 3 100;0;0 3.352 False ENSG00000120725 ENSG00000120725 HGNC:24624 SIL1 gene SIL1 Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Marinesco-Sjogren syndrome (MIM#248800)" 16282977;24176978 False 3 100;0;0 3.352 True ENSG00000120725 ENSG00000120725 HGNC:24624 SIL1 gene SIL1 Expert Review Green;Expert Review Green;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Marinesco-Sjogren syndrome 248800 False 3 100;0;0 3.352 False ENSG00000120725 ENSG00000120725 HGNC:24624 SLC12A6 gene SLC12A6 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Andermann syndrome;Hereditary Motor and Sensory Neuropathy with Agenesis of the Corpus Callosum;Charcot-Marie-Tooth disease, axonal, type 2II , MIM#620068 31439721 False 3 100;0;0 3.352 True ENSG00000140199 ENSG00000140199 HGNC:10914 SLC12A6 gene SLC12A6 Expert Review Green;Other Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, axonal, type 2II (MIM#620068) 31439721;27485015;33323309 False 3 100;0;0 3.352 True ENSG00000140199 ENSG00000140199 HGNC:10914 SLC13A3 gene SLC13A3 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy, acute reversible, with increased urinary alpha-ketoglutarate (MIM# 618384) https://www.neurology.org/doi/full/10.1212/NXG.0000000000200101 (No PMID) False 3 100;0;0 3.352 True ENSG00000158296 ENSG00000158296 HGNC:14430 SLC16A2 gene SLC16A2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Allan-Herndon-Dudley syndrome, 300523, XL 15980113;31410843;20301789 False 3 100;0;0 3.352 True ENSG00000147100 ENSG00000147100 HGNC:10923 SLC17A5 gene SLC17A5 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Salla disease;Sialic acid storage disease, severe infantile type, MIM# 269920 26171070 False 3 100;0;0 3.352 True ENSG00000119899 ENSG00000119899 HGNC:10933 SLC18A3 gene SLC18A3 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ophthalmopleggia and apnea;Myasthenic syndrome, congenital, 21, presynaptic, 617239 27590285;20123977;28188302;31059209 False 3 100;0;0 3.352 True ENSG00000187714 ENSG00000187714 HGNC:10936 SLC1A3 gene SLC1A3 Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic ataxia, type 6 MIM#612656 False 3 100;0;0 3.352 False ENSG00000079215 ENSG00000079215 HGNC:10941 SLC1A3 gene SLC1A3 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Episodic ataxia, type 6;Episodic ataxia type 6, 612656 False 3 100;0;0 3.352 False ENSG00000079215 ENSG00000079215 HGNC:10941 SLC1A4 gene SLC1A4 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic tetraplegia, thin corpus callosum, and progressive microcephaly, 616657;MONDO:0014725 25930971;26138499;26041762;27193218;29989513 False 3 100;0;0 3.352 True ENSG00000115902 ENSG00000115902 HGNC:10942 SLC22A5 gene SLC22A5 Expert Review Green;Literature;NHS GMS;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Carnitine deficiency, systemic primary 212140 9916797;10072434;10051646;10425211;10480371;10679939;9837751;23379544;31399326 False 3 100;0;0 3.352 True ENSG00000197375 ENSG00000197375 HGNC:10969 SLC25A1 gene SLC25A1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ?Myasthenic syndrome, congenital, 23, presynaptic;618197 26870663;31527857 False 3 100;0;0 3.352 True ENSG00000100075 ENSG00000100075 HGNC:10979 SLC25A15 gene SLC25A15 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperornithinemia-hyperammonemia-homocitrullinemia syndrome MIM#238970 16376511;22465082;28592010 False 3 100;0;0 3.352 True ENSG00000102743 ENSG00000102743 HGNC:10985 SLC25A19 gene SLC25A19 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Progressive demyelinating neuropathy with bilateral striatal necrosis MONDO:0013382 20301539 False 3 100;0;0 3.352 True ENSG00000125454 ENSG00000125454 HGNC:14409 SLC25A20 gene SLC25A20 Expert Review Green;Literature;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Carnitine-acylcarnitine translocase deficiency MIM#212138 24088670 False 3 100;0;0 3.352 True ENSG00000178537 ENSG00000178537 HGNC:1421 SLC25A32 gene SLC25A32 Expert Review Green;Literature;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Exercise intolerance, riboflavin-responsive MONDO:0014795 26933868;35727412;34764427;28443623 False 3 100;0;0 3.352 True ENSG00000164933 ENSG00000164933 HGNC:29683 SLC25A4 gene SLC25A4 Expert Review Green;Expert Review;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 12B (cardiomyopathic type) AR MIM#615418 28823815 False 3 100;0;0 3.352 True ENSG00000151729 ENSG00000151729 HGNC:10990 SLC25A46 gene SLC25A46 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Neuropathy, hereditary motor and sensory, type VIB, MIM# 616505;Pontocerebellar hypoplasia, type 1E, MIM# 619303" 26168012;27543974 False 3 100;0;0 3.352 True ENSG00000164209 ENSG00000164209 HGNC:25198 SLC25A46 gene SLC25A46 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary motor and sensory neuropathy type VIB, MIM#616505;Pontocerebellar hypoplasia, type 1E, MIM# 619303 30178502;26168012;27543974;27430653;27390132;28934388;28558379 False 3 100;0;0 3.352 True ENSG00000164209 ENSG00000164209 HGNC:25198 SLC2A1 gene SLC2A1 Expert Review Green;Expert list;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal dystonia 9;GLUT1 deficiency syndrome 2, 612126;GLUT1 DEFICIENCY SYNDROME 1;paroxysmal exertion-induced dyskinesia with or without epilepsy and/or hemolytic anemia;GLUT1 deficiency syndrome 1, 606777;Dystonia 9, 601042;EPILEPSY, IDIOPATHIC GENERALIZED False 3 100;0;0 3.352 False ENSG00000117394 ENSG00000117394 HGNC:11005 SLC2A1 gene SLC2A1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal GLUT1 deficiency syndrome 1, infantile onset, severe, MIM# 606777;Developmental delay;autosomal dominant, complicated hereditary spastic paraplegia (HSP);paroxysmal choreoathetosis;spastic paraplegia;seizure False 3 100;0;0 3.352 True ENSG00000117394 ENSG00000117394 HGNC:11005 SLC44A1 gene SLC44A1 Expert Review Green;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Childhood-onset neurodegeneration;progressive ataxia tremor cognitive decline dysphagia optic atrophy dysarthria 31855247 False 3 100;0;0 3.352 True ENSG00000070214 ENSG00000070214 HGNC:18798 SLC4A10 gene SLC4A10 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with hypotonia and characteristic brain abnormalities, MIM# 620746 PMID: 37459438 False 3 100;0;0 3.352 True ENSG00000144290 ENSG00000144290 HGNC:13811 SLC52A2 gene SLC52A2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bwon-Vialetto-Van Laere syndrome 2, 614707 False 3 100;0;0 3.352 True ENSG00000185803 ENSG00000185803 HGNC:30224 SLC52A2 gene SLC52A2 Expert Review Green;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 3.352 False ENSG00000185803 ENSG00000185803 HGNC:30224 SLC52A2 gene SLC52A2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Brown-Vialetto-van Laere syndrome 2 (BVVLS2) (MONDO:0013867) 22740598;24253200 False 3 100;0;0 3.352 True ENSG00000185803 ENSG00000185803 HGNC:30224 SLC52A2 gene SLC52A2 Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Brown-Vialetto-van Laere syndrome 2 MONDO:0013867 29193829;31868069;29053833;26072523 False 3 100;0;0 3.352 True ENSG00000185803 ENSG00000185803 HGNC:30224 SLC52A3 gene SLC52A3 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Brown-Vialetto-Van Laere syndrome 1 (MIM#211530);dHMN;Brown-Vialetto-Van Laere syndrome 1;Fazio-Londe disease 20206331 False 3 100;0;0 3.352 True ENSG00000101276 ENSG00000101276 HGNC:16187 SLC52A3 gene SLC52A3 Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Brown-Vialetto-van Laere syndrome 1 MONDO:0024537 29193829;31868069;29053833;26072523 False 3 100;0;0 3.352 True ENSG00000101276 ENSG00000101276 HGNC:16187 SLC52A3 gene SLC52A3 Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Amytrophic Lateral Sclerosis (ALS);Brown-Vialetto-van Laere syndrome 1 (MIM# 211530) 26072523 False 3 100;0;0 3.352 True ENSG00000101276 ENSG00000101276 HGNC:16187 SLC5A6 gene SLC5A6 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peripheral motor neuropathy, childhood-onset, biotin-responsive, MIM# 619903 35013551 False 3 100;0;0 3.352 True ENSG00000138074 ENSG00000138074 HGNC:11041 SLC5A7 gene SLC5A7 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 20, presynaptic, 617143;Hereditory motor neuropathy 27569547;29189923;30172469 False 3 100;0;0 3.352 True ENSG00000115665 ENSG00000115665 HGNC:14025 SLC5A7 gene SLC5A7 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuronopathy, distal hereditary motor, type VIIA, MIM# 158580;MONDO:0008024 23141292;15173594;29782645;29582019 False 3 100;0;0 3.352 True ENSG00000115665 ENSG00000115665 HGNC:14025 SLC9A6 gene SLC9A6 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Mental retardation, X-linked syndromic, Christianson type, 300243 False 3 100;0;0 3.352 False ENSG00000198689 ENSG00000198689 HGNC:11079 SMCHD1 gene SMCHD1 Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Facioscapulohumeral muscular dystrophy MONDO:0001347 20301616 False 3 100;0;0 3.352 True ENSG00000101596 ENSG00000101596 HGNC:29090 SMN1 gene SMN1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinal muscular atrophy-1, MIM# 253300;Spinal muscular atrophy-2, MIM# 253550;Spinal muscular atrophy-3, MIM# 253400;Spinal muscular atrophy-4, MIM# 271150 False 3 100;0;0 3.352 True ENSG00000172062 ENSG00000172062 HGNC:11117 SMN1 gene SMN1 Expert Review Green;Literature;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinal muscular atrophy-1, MIM# 253300 20301623 False 3 100;0;0 3.352 True ENSG00000172062 ENSG00000172062 HGNC:11117 SMPX gene SMPX Expert Review Green;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Myopathy, distal, 7, adult-onset, X-linked, MIM# 301075 33974137 False 3 100;0;0 3.352 True Other ENSG00000091482 ENSG00000091482 HGNC:11122 SNAP25 gene SNAP25 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown ?Myasthenic syndrome, congenital, 18, 616330;cerebellar ataxia and seizures 29491473;25381298;17283335 False 3 100;0;0 3.352 True ENSG00000132639 ENSG00000132639 HGNC:11132 SNAP29 gene SNAP29 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome (CEDNIK) Syndrome (MONDO:0012290) (MIM#609528);Cerebral Dysgenesis and severe psychomotor retardation, axonal sensory-motor Neuropathy, Ichthyosis, palmoplantar Keratoderma, fatal by second decade of life 33977139 False 3 0;100;0 3.352 True ENSG00000099940 ENSG00000099940 HGNC:11133 SNAPC4 gene SNAPC4 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with motor regression, progressive spastic paraplegia, and oromotor dysfunction, MIM# 620515 36965478 False 3 100;0;0 3.352 True ENSG00000165684 ENSG00000165684 HGNC:11137 SNUPN gene SNUPN Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 29, MIM# 620793 PMID: 38413582;PMID: 38366623 False 3 100;0;0 3.352 True ENSG00000169371 ENSG00000169371 HGNC:14245 SNUPN gene SNUPN Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 29, MIM# 620793 PMID: 38413582;PMID: 38366623 False 3 100;0;0 3.352 True ENSG00000169371 ENSG00000169371 HGNC:14245 SNX14 gene SNX14 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spinocerebellar ataxia 20, 616354;Autosomal recessive spinocerebellar ataxia (#616354) False 3 100;0;0 3.352 False ENSG00000135317 ENSG00000135317 HGNC:14977 SOD1 gene SOD1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic tetraplegia and axial hypotonia, progressive, MIM#618598 PMID: 31314961;31332433;34788402 False 3 100;0;0 3.352 True ENSG00000142168 ENSG00000142168 HGNC:11179 SOD1 gene SOD1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Amyotrophic lateral sclerosis 1 (105400 AD, AR);Spastic tetraplegia and axial hypotonia, progressive (618598 AR) 8625408;21545237;16503123 False 3 100;0;0 3.352 True ENSG00000142168 ENSG00000142168 HGNC:11179 SORD gene SORD Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal isolated hereditary neuropathy;Sorbitol dehydrogenase deficiency with peripheral neuropathy (SORDDPN), MIM#618912 32367058 False 3 100;0;0 3.352 True ENSG00000140263 ENSG00000140263 HGNC:11184 SOX10 gene SOX10 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted PCWH syndrome, MIM# 609136 10762540;10482261;15004559 False 3 100;0;0 3.352 True ENSG00000100146 ENSG00000100146 HGNC:11190 SOX10 gene SOX10 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown PCWH Syndrome (MIM#609136;MONDO:0012198);Waardenburg syndrome, type 4C, 613266;Hypopigmentation of the hair and skin, sensory hearing loss, demyelinating neuropathy, dysmyelinating leukodystrophy, developmental delay, spasticity, ataxia, Hirschsprung disease;Waardenburg syndrome, type 2E, with or without neurologic involvement, 611584;HMSN 15004559 False 3 0;100;0 3.352 True ENSG00000100146 ENSG00000100146 HGNC:11190 SPART gene SPART Expert Review Green;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 3.352 False ENSG00000133104 ENSG00000133104 HGNC:18514 SPART gene SPART Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Troyer syndrome, MIM# 275900;SPG20;MONDO:0010156 12134148;20437587;26003402;27112432;31535723;31535723;28875386;28679690 False 3 100;0;0 3.352 True ENSG00000133104 ENSG00000133104 HGNC:18514 SPAST gene SPAST Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spastic paraplegia 4, autosomal dominant, 182601 30476002;30006150 False 3 100;0;0 3.352 True ENSG00000021574 ENSG00000021574 HGNC:11233 SPAST gene SPAST Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spastic paraplegia 4, autosomal dominant;Spasticity;Hereditary Neuropathies False 3 100;0;0 3.352 True ENSG00000021574 ENSG00000021574 HGNC:11233 SPAST gene SPAST Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spastic paraplegia 4, autosomal dominant, MIM# 182601" False 3 100;0;0 3.352 True ENSG00000021574 ENSG00000021574 HGNC:11233 SPAST gene SPAST Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted 16765570;19364936 False 3 100;0;0 3.352 True ENSG00000021574 ENSG00000021574 HGNC:11233 SPEG gene SPEG Expert Review Green;Other;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Centronuclear myopathy 5, MIM# 615959 25087613;30412272 False 3 100;0;0 3.352 True ENSG00000072195 ENSG00000072195 HGNC:16901 SPG11 gene SPG11 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMSN;Hereditary Neuropathies;axonal Charcot-Marie-Tooth disease type 2X;MONDO:0014726 26556829;33581793 False 3 100;0;0 3.352 True ENSG00000104133 ENSG00000104133 HGNC:11226 SPG11 gene SPG11 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 11, autosomal recessive, MIM# 604360 18067136 False 3 100;0;0 3.352 True ENSG00000104133 ENSG00000104133 HGNC:11226 SPG11 gene SPG11 Expert Review Green;Royal Melbourne Hospital;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Amyotrophic lateral sclerosis 5, juvenile, MIM# 602099 20110243 False 3 100;0;0 3.352 True ENSG00000104133 ENSG00000104133 HGNC:11226 SPG11 gene SPG11 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 11, autosomal recessive, MIM# 604360" 18067136 False 3 100;0;0 3.352 True ENSG00000104133 ENSG00000104133 HGNC:11226 SPG21 gene SPG21 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mast syndrome, 248900;Spastic Paraplegia, autosomal recessive 14564668;24451228;28752238;26978163 False 3 100;0;0 3.352 True ENSG00000090487 ENSG00000090487 HGNC:20373 SPG7 gene SPG7 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 7, autosomal recessive, 607259;MONDO:0011803 22571692 False 3 100;0;0 3.352 True ENSG00000197912 ENSG00000197912 HGNC:11237 SPG7 gene SPG7 Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 7, autosomal recessive MIM#607259 16765570;19364936 False 3 100;0;0 3.352 True ENSG00000197912 ENSG00000197912 HGNC:11237 SPG7 gene SPG7 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 7, autosomal recessive, MIM# 607259" 22571692 False 3 100;0;0 3.352 True ENSG00000197912 ENSG00000197912 HGNC:11237 SPG7 gene SPG7 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 7 (#607259) complex forms of the disease. Actually associated with a range of phenotypes including adult-onset ataxia;Autosomal recessive spastic paraplegia 7, 607259 False 3 100;0;0 3.352 False ENSG00000197912 ENSG00000197912 HGNC:11237 SPR gene SPR Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Dopa-responsive dystonia due to sepiaterin reductase deficiency, 612716;Dystonia, dopa-responsive, due to sepiapterin reductase deficiency 612716 False 3 100;0;0 3.352 True ENSG00000116096 ENSG00000116096 HGNC:11257 SPTAN1 gene SPTAN1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic Paraplegia MONDO:0019064, SPTAN1-related;Autosomal dominant spastic paraplegia-91, with or without cerebellar ataxia (SPG91), MIM#620538 PMID: 35150594;34526651;31515523 False 3 100;0;0 3.352 True ENSG00000197694 ENSG00000197694 HGNC:11273 SPTAN1 gene SPTAN1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuronopathy, distal hereditary motor, 11, autosomal dominant, MIM# 620528 33578420;31332438 False 3 100;0;0 3.352 True ENSG00000197694 ENSG00000197694 HGNC:11273 SPTBN2 gene SPTBN2 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Spinocerebellar ataxia, autosomal recessive 14, MIM# 615386;Spinocerebellar ataxia 5, MIM# 600224" 23236289;23838597;22781464;31617442;31066025 False 3 100;0;0 3.352 True ENSG00000173898 ENSG00000173898 HGNC:11276 SPTBN2 gene SPTBN2 Expert Review Green;Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spinocerebellar ataxia 5, 600224;Spinocerebellar ataxia, autosomal recessive 14, 615386 False 3 100;0;0 3.352 True ENSG00000173898 ENSG00000173898 HGNC:11276 SPTBN4 gene SPTBN4 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with hypotonia, neuropathy, and deafness MIM#617519 28540413;29861105 False 3 100;0;0 3.352 False ENSG00000160460 ENSG00000160460 HGNC:14896 SPTLC1 gene SPTLC1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted juvenile amyotrophic lateral sclerosis MONDO:0017593 34059824;35900868;34459874 False 3 100;0;0 3.352 True Other ENSG00000090054 ENSG00000090054 HGNC:11277 SPTLC1 gene SPTLC1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Juvenile amyotrophic lateral sclerosis-27, MIM#620285;HSAN/SFN;Hereditary Sensory and Autonomic Neuropathy, Type II;Neuropathy, hereditary sensory and autonomic, type IA, 162400 11242114;11242106;15037712;26681808 False 3 100;0;0 3.352 True ENSG00000090054 ENSG00000090054 HGNC:11277 SPTLC2 gene SPTLC2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuropathy, hereditary sensory and autonomic, type IC, 613640;MONDO:0013337;HSAN/SFN 20920666;23658386;31509666;30866134 False 3 100;0;0 3.352 True ENSG00000100596 ENSG00000100596 HGNC:11278 SQSTM1 gene SQSTM1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration with ataxia, dystonia, and gaze palsy, childhood-onset, MIM# 617145 27545679 False 3 100;0;0 3.352 True ENSG00000161011 ENSG00000161011 HGNC:11280 SRD5A3 gene SRD5A3 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Kahrizi syndrome, 612713;Congenital disorder of glycosylation, type Iq, 612379;Congenital disorder of glycosylation type Iq, 612379 False 3 100;0;0 3.352 True ENSG00000128039 ENSG00000128039 HGNC:25812 SRPK3 gene SRPK3 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Myopathy, MONDO:0005336, digenic SRPK3- and TTN-related 38429495 False 3 100;0;0 3.352 True ENSG00000184343 ENSG00000184343 HGNC:11402 STAC3 gene STAC3 Expert Review Green;Other;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital myopathy 13 (MIM#255995) 28411587;28777491 False 3 100;0;0 3.352 True ENSG00000185482 ENSG00000185482 HGNC:28423 STIM1 gene STIM1 Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Myopathy, tubular aggregate, 1 (MIM#160565);Stormorken syndrome (MIM#185070)" 31448844 False 3 67;33;0 3.352 True Other ENSG00000167323 ENSG00000167323 HGNC:11386 STIM1 gene STIM1 Expert Review Green;Literature;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted tubular aggregate myopathy MONDO:0008051 38982518;31448844 False 3 100;0;0 3.352 True Other ENSG00000167323 ENSG00000167323 HGNC:11386 STUB1 gene STUB1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spinocerebellar ataxia, autosomal recessive 16, MIM# 615768" 32342324;32337344 False 3 100;0;0 3.352 False ENSG00000103266 ENSG00000103266 HGNC:11427 STUB1 gene STUB1 Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spinocerebellar ataxia 48, MIM#618093 32337344;30381368;31126790 False 3 100;0;0 3.352 True ENSG00000103266 ENSG00000103266 HGNC:11427 STUB1 gene STUB1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spinocerebellar ataxia, autosomal recessive 16, MIM# 615768" 25258038;24742043 False 3 100;0;0 3.352 True ENSG00000103266 ENSG00000103266 HGNC:11427 SUCLA2 gene SUCLA2 Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 5 (encephalomyopathic with or without methylmalonic aciduria) 612073 15877282;17287286;17301081;23759946;33231368;33230181;28243576;27913098;27651038 False 3 100;0;0 3.352 True ENSG00000136143 ENSG00000136143 HGNC:11448 SUCLG1 gene SUCLG1 Expert Review Green;Other;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal mitochondrial DNA depletion syndrome 9 MONDO:0009504 30560055;29217198 False 3 100;0;0 3.352 True ENSG00000163541 ENSG00000163541 HGNC:11449 SUFU gene SUFU Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted congenital ocular motor apraxia (forme fruste of Joubert syndrome) 33024317 False 3 100;0;0 3.352 True ENSG00000107882 ENSG00000107882 HGNC:16466 SURF1 gene SURF1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leigh syndrome, due to COX IV deficiency, 256000;HMSN;Leigh syndrome (early onset progressive neurodegeneration of the brain stem, basal ganglia and spinal cord), neuropathy with SNCV False 3 100;0;0 3.352 False ENSG00000148290 ENSG00000148290 HGNC:11474 SVBP gene SVBP Expert Review Green;Expert list;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly, 618569 31363758;30607023 False 3 100;0;0 3.352 True ENSG00000177868 ENSG00000177868 HGNC:29204 SYNE1 gene SYNE1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spinocerebellar ataxia, autosomal recessive 8, MIM# 610743" 23325900;27086870 False 3 100;0;0 3.352 True ENSG00000131018 ENSG00000131018 HGNC:17089 SYNE1 gene SYNE1 Expert Review;Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Emery-Dreifuss muscular dystrophy 4, autosomal dominant 612998 False 3 100;0;0 3.352 False ENSG00000131018 ENSG00000131018 HGNC:17089 SYNE1 gene SYNE1 Expert Review Green;Expert Review;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Emery-Dreifuss muscular dystrophy 4, autosomal dominant 612998 27782104;19542096 False 3 100;0;0 3.352 True ENSG00000131018 ENSG00000131018 HGNC:17089 SYNE1 gene SYNE1 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 8;Cerebellar Ataxia;Autosomal recessive spinocerebellar ataxia type 8 False 3 100;0;0 3.352 False ENSG00000131018 ENSG00000131018 HGNC:17089 SYT2 gene SYT2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Myasthenic syndrome, congenital, 7, presynaptic;HMSN 25192047;30533528;26519543 False 3 100;0;0 3.352 True ENSG00000143858 ENSG00000143858 HGNC:11510 SYT2 gene SYT2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 7, presynaptic, MIM# 616040;Myasthenic syndrome, congenital, 7B, presynaptic, autosomal recessive MIM#619461 25192047;32776697;32250532;30533528 False 3 100;0;0 3.352 True ENSG00000143858 ENSG00000143858 HGNC:11510 TAMM41 gene TAMM41 Expert Review Green;Other;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency-56 (COXPD56), MIM#620139 35321494;29253589 False 3 100;0;0 3.352 True ENSG00000144559 ENSG00000144559 HGNC:25187 TANGO2 gene TANGO2 Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Metabolic encephalomyopathic crises, recurrent, with rhabdomyolysis, cardiac arrhythmias, and neurodegeneration, 616878 26805781 False 3 100;0;0 3.352 True ENSG00000183597 ENSG00000183597 HGNC:25439 TARDBP gene TARDBP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 10, with or without FTD;Frontotemporal lobar degeneration, TARDBP-related (MIM#612069;MONDO: 0012790) 20301761;18309045;19609911 False 3 100;0;0 3.352 True ENSG00000120948 ENSG00000120948 HGNC:11571 TAZ gene TAZ Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Barth syndrome MIM#302060 26845103 False 3 100;0;0 3.352 True ENSG00000102125 ENSG00000102125 HGNC:11577 TBC1D23 gene TBC1D23 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia type 11, 617695 28823707;28823706 False 3 100;0;0 3.352 True ENSG00000036054 ENSG00000036054 HGNC:25622 TBCE gene TBCE Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Encephalopathy, progressive, with amyotrophy and optic atrophy 617207" PMID: 27666369 False 3 100;0;0 3.352 True ENSG00000116957 ENSG00000116957 HGNC:11582 TBCE gene TBCE Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Encephalopathy, progressive, with amyotrophy and optic atrophy, OMIM #617207 PubMed: 27666369 False 3 100;0;0 3.352 True ENSG00000116957 ENSG00000116957 HGNC:11582 TBK1 gene TBK1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 4 (MIM#616439;MONDO:0011223) 20301623;25803835 False 3 100;0;0 3.352 True ENSG00000183735 ENSG00000183735 HGNC:11584 TCAP gene TCAP Expert Review Green;Expert Review Green;Expert Review Green;Expert Review;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, type 2G, 601954 25055047;22029105;18948002 False 3 100;0;0 3.352 True ENSG00000173991 ENSG00000173991 HGNC:11610 TCTN1 gene TCTN1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 13, MIM# 614173" 31302911;28631893;21725307;26477546;26489806 False 3 100;0;0 3.352 True ENSG00000204852 ENSG00000204852 HGNC:26113 TCTN2 gene TCTN2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 24, MIM# 616654" 25118024;21565611 False 3 100;0;0 3.352 True ENSG00000168778 ENSG00000168778 HGNC:25774 TCTN3 gene TCTN3 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 18, MIM# 614815;Orofaciodigital syndrome IV, MIM# 258860 22883145;25118024 False 3 100;0;0 3.352 True ENSG00000119977 ENSG00000119977 HGNC:24519 TDP2 gene TDP2 Expert Review Green;Expert list;Royal Melbourne Hospital;GeneReviews Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 23 31410782;30109272;24658003 False 3 100;0;0 3.352 True ENSG00000111802 ENSG00000111802 HGNC:17768 TECPR2 gene TECPR2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 49, autosomal recessive, 615031;Autonomic-sensory neuropathy 23176824;26542466 False 3 100;0;0 3.352 True ENSG00000196663 ENSG00000196663 HGNC:19957 TECPR2 gene TECPR2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 49, autosomal recessive;HSAN/SFN False 3 100;0;0 3.352 False ENSG00000196663 ENSG00000196663 HGNC:19957 TFG gene TFG Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 57, autosomal recessive, MIM# 615658 30467354;30157421;28124177;27601211;27492651;23479643 False 3 100;0;0 3.352 True ENSG00000114354 ENSG00000114354 HGNC:11758 TFG gene TFG Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary motor and sensory neuropathy, Okinawa type, MIM# 604484 25098539;23553329;22883144;31449671;31111683 False 3 100;0;0 3.352 True ENSG00000114354 ENSG00000114354 HGNC:11758 THG1L gene THG1L Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia with developmental delay 27307223;30214071;31168944 False 3 100;0;0 3.352 True ENSG00000113272 ENSG00000113272 HGNC:26053 TINF2 gene TINF2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Autosomal dominant dyskeratosis congenita 3, 613990;Revesz syndrome, 268130 18252230;21477109;18979121 False 3 100;0;0 3.352 True ENSG00000092330 ENSG00000092330 HGNC:11824 TK2 gene TK2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 2 (myopathic type), 609560 33457207 False 3 100;0;0 3.352 True ENSG00000166548 ENSG00000166548 HGNC:11831 TMEM106B gene TMEM106B Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypomyelinating leukodystrophy 16, 617964 29186371;29444210 False 3 100;0;0 3.352 True ENSG00000106460 ENSG00000106460 HGNC:22407 TMEM126B gene TMEM126B Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal mitochondrial complex 1 deficiency, nuclear type 29 MONDO:0032633 27374774;27374773 False 3 100;0;0 3.352 True ENSG00000171204 ENSG00000171204 HGNC:30883 TMEM216 gene TMEM216 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 2, MIM# 608091" 20036350;20512146 False 3 100;0;0 3.352 True ENSG00000187049 ENSG00000187049 HGNC:25018 TMEM237 gene TMEM237 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 14, MIM# 614424" False 3 100;0;0 3.352 True ENSG00000155755 ENSG00000155755 HGNC:14432 TMEM240 gene TMEM240 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spinocerebellar ataxia 21, MIM# 607454" 25070513 False 3 100;0;0 3.352 True ENSG00000205090 ENSG00000205090 HGNC:25186 TMEM240 gene TMEM240 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 21, 607454 False 3 100;0;0 3.352 False ENSG00000205090 ENSG00000205090 HGNC:25186 TMEM5 gene TMEM5 Expert Review Green;Expert Review;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041 23217329;23519211 False 3 100;0;0 3.352 True ENSG00000118600 ENSG00000118600 HGNC:13530 TMEM63C gene TMEM63C Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 87, autosomal recessive, MIM# 619966 PMID: 35718349 False 3 100;0;0 3.352 True ENSG00000165548 ENSG00000165548 HGNC:23787 TMEM67 gene TMEM67 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 6, MIM# 610688" False 3 100;0;0 3.352 True ENSG00000164953 ENSG00000164953 HGNC:28396 TNNT1 gene TNNT1 Expert Review Green;Other;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Nemaline myopathy 5 MONDO:0011539;Nemaline myopathy MONDO:0018958 10952871;32994279;32819427;31970803;31604653;29931346;29178646 False 3 100;0;0 3.352 True ENSG00000105048 ENSG00000105048 HGNC:11948 TNNT3 gene TNNT3 Expert Review Green;Other;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Nemaline myopathy MONDO:0018958 33977145;29266598;23775847 False 3 100;0;0 3.352 True ENSG00000130595 ENSG00000130595 HGNC:11950 TNPO3 gene TNPO3 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Muscular dystrophy, limb-girdle, autosomal dominant 2, 608423 23667635;23543484;31071488;31192305 False 3 100;0;0 3.352 True Other ENSG00000064419 ENSG00000064419 HGNC:17103 TOR1AIP1 gene TOR1AIP1 Expert Review Green;Literature;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, autosomal recessive, with rigid spine and distal joint contractures MIM#617072;Progeroid appearance;Cataracts;Microcephaly;Deafness;Contractures 24856141;31299614;30723199;27342937;32055997 False 3 100;0;0 3.352 True ENSG00000143337 ENSG00000143337 HGNC:29456 TPM2 gene TPM2 Expert Review Green;Other Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Nemaline myopathy 4, autosomal dominant (MIM#609285) 17846275;23378224 False 3 100;0;0 3.352 True ENSG00000198467 ENSG00000198467 HGNC:12011 TPM3 gene TPM3 Expert Review Green;Other;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Congenital myopathy 4A, autosomal dominant (MIM#255310);Congenital myopathy 4B, autosomal recessive (MIM#609284) 26418456;18300303;10619715;12196661;18382475 False 3 100;0;0 3.352 True ENSG00000143549 ENSG00000143549 HGNC:12012 TPP1 gene TPP1 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spinocerebellar ataxia 7, 609270;Neuronal ceroid lipofuscinosis, 204500;Spinocerebellar ataxia, autosomal recessive 7, 609270;Ceroid lipofuscinosis, neuronal, 2, 204500 False 3 100;0;0 3.352 False ENSG00000166340 ENSG00000166340 HGNC:2073 TRAPPC11 gene TRAPPC11 Expert Review Green;Expert Review Green;Expert list;Expert Review;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 18 (MIM#615356) 23830518;26322222;29855340;30105108 False 3 100;0;0 3.352 True ENSG00000168538 ENSG00000168538 HGNC:25751 TRAPPC11 gene TRAPPC11 Expert Review Green;Expert Review Green;Expert Review;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, type 2S, 615356 23830518;26322222;29855340;30105108 False 3 100;0;0 3.352 True ENSG00000168538 ENSG00000168538 HGNC:25751 TRDN gene TRDN Expert Review Green;Other Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ventricular tachycardia, catecholaminergic polymorphic, 5, with or without muscle weakness, MIM# 615441 28202702;30649896;34415104 False 3 0;0;0 3.352 True ENSG00000186439 ENSG00000186439 HGNC:12261 TRIM2 gene TRIM2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, type 2R, MIM# 615490;MONDO:0014208;HMSN 23562820;25893792;18687884;32815244;32205255;25893792 False 3 100;0;0 3.352 True ENSG00000109654 ENSG00000109654 HGNC:15974 TRIM32 gene TRIM32 Expert Review Green;Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, type 2H, 254110 False 3 50;0;50 3.352 False ENSG00000119401 ENSG00000119401 HGNC:16380 TRIP4 gene TRIP4 Expert Review Green;Other;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ?Muscular dystrophy, congenital, Davignon-Chauveau type (MIM#617066) 27008887;31794073 False 3 100;0;0 3.352 True ENSG00000103671 ENSG00000103671 HGNC:12310 TRIP4 gene TRIP4 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinal muscular atrophy with congenital bone fractures 1, MIM# 616866 26924529 False 3 100;0;0 3.352 True ENSG00000103671 ENSG00000103671 HGNC:12310 TRPV4 gene TRPV4 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted HMSN, dHMN/dSMA;Hereditary motor and sensory neuropathy, type IIc, MIM# 606071;Neuronopathy, distal hereditary motor, type VIII, MIM# 600175 False 3 100;0;0 3.352 True ENSG00000111199 ENSG00000111199 HGNC:18083 TSFM gene TSFM Expert Review Green;Royal Melbourne Hospital;GeneReviews Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 3 False 3 100;0;0 3.352 True ENSG00000123297 ENSG00000123297 HGNC:12367 TSFM gene TSFM Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 3 610505 31267352;17033963 False 3 100;0;0 3.352 True ENSG00000123297 ENSG00000123297 HGNC:12367 TSPOAP1 gene TSPOAP1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia, intellectual disability and cerebellar atrophy 33539324 False 3 100;0;0 3.352 True ENSG00000005379 ENSG00000005379 HGNC:16831 TTBK2 gene TTBK2 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 11, 604432;Spinocerebellar ataxia 11 False 3 50;50;0 3.352 False ENSG00000128881 ENSG00000128881 HGNC:19141 TTC19 gene TTC19 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex III deficiency nuclear type II, 615157;Mitochondrial complex III deficiency, nuclear type 2, 615157 False 3 100;0;0 3.352 True ENSG00000011295 ENSG00000011295 HGNC:26006 TTI1 gene TTI1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly and movement abnormalities, MIM# 620445 26539891;30315573;36724785 False 3 50;25;25 3.352 True ENSG00000101407 ENSG00000101407 HGNC:29029 TTN gene TTN Expert Review Green;Literature;Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal TTN-related myopathy MONDO:0100175 38429495;38982518 False 3 100;0;0 3.352 True ENSG00000155657 ENSG00000155657 HGNC:12403 TTN gene TTN Expert Review Green;Expert Review;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal dilated cardiomyopathy;Distal myopathy;HMERF;Myofibrillar myopathy;Congenital myopathy;Muscular dystrophy, limb-girdle, type 2J, 608807;arthrogryposis False 3 100;0;0 3.352 False ENSG00000155657 ENSG00000155657 HGNC:12403 TTPA gene TTPA Expert Review Green;NHS GMS;Expert list;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia with isolated vitamin E deficiency;Ataxia with Vitamin E Deficiency;Ataxia with isolated vitamin E deficiency, 277460 False 3 100;0;0 3.352 False ENSG00000137561 ENSG00000137561 HGNC:12404 TTPA gene TTPA Expert Review Green;NHS GMS;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia with vitamin E deficiency;Early-onset ataxia and sensory axonal neuropathy similar to Friedreich s ataxia, head titubation, normal fat absorption unlike abetalipoproteinemia, rarely retinitis pigmentosa False 3 100;0;0 3.352 False ENSG00000137561 ENSG00000137561 HGNC:12404 TTPA gene TTPA NHS GMS;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Ataxia with isolated vitamin E deficiency, MIM# 277460" False 3 100;0;0 3.352 True ENSG00000137561 ENSG00000137561 HGNC:12404 TTR gene TTR Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyloidosis, hereditary, transthyretin-related MIM#105210;Cardiomyopathy;Amyloidogenic transthyretin amyloidosis;HSAN/SFN 20301373;8071954;19180884;24101130 False 3 100;0;0 3.352 True ENSG00000118271 ENSG00000118271 HGNC:12405 TUBA4A gene TUBA4A Expert Review Green;Royal Melbourne Hospital;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 22 with or without frontotemporal dementia, MIM# 616208 25374358;25893256;28069311;38463699;38884572;26675813 False 3 50;50;0 3.352 True ENSG00000127824 ENSG00000127824 HGNC:12407 TUBA4A gene TUBA4A Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary ataxia MONDO:0100309, TUBA4A-related 38884572;37418012 False 3 100;0;0 3.352 True Other ENSG00000127824 ENSG00000127824 HGNC:12407 TUBA4A gene TUBA4A Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary ataxia MONDO:0100309, TUBA4A-related 38884572;37418012 False 3 100;0;0 3.352 True Other ENSG00000127824 ENSG00000127824 HGNC:12407 TUBA4A gene TUBA4A Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary ataxia MONDO:0100309, TUBA4A-related 38884572;37418012 False 3 100;0;0 3.352 True Other ENSG00000127824 ENSG00000127824 HGNC:12407 TUBA4A gene TUBA4A Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary ataxia MONDO:0100309, TUBA4A-related 38884572;37418012 False 3 100;0;0 3.352 True ENSG00000127824 ENSG00000127824 HGNC:12407 TUBB3 gene TUBB3 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Fibrosis of extraocular muscles, congenital, 3A (MIM#600638);Neuropathy 20074521;34652576 False 3 50;50;0 3.352 True ENSG00000258947 ENSG00000258947 HGNC:20772 TUBB4A gene TUBB4A Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Leukodystrophy, hypomyelinating, 6, 612438;Dystonia 4, 128101, Hypomyelinating leukodystrophy 6, 612438;Dystonia 4, torsion, autosomal dominant, 128101 False 3 100;0;0 3.352 False ENSG00000104833 ENSG00000104833 HGNC:20774 TUBB4A gene TUBB4A Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Leukodystrophy, hypomyelinating, 6, MIM# 612438" 23582646;24850488 False 3 100;0;0 3.352 True ENSG00000104833 ENSG00000104833 HGNC:20774 TWNK gene TWNK Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Perrault syndrome (MIM#616138);Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3, MIM# 609286 25254289;25355836;27650058;28178980;35011763 False 3 100;0;0 3.352 True ENSG00000107815 ENSG00000107815 HGNC:1160 TWNK gene TWNK Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3 MIM#609286 20880070 False 3 100;0;0 3.352 True ENSG00000107815 ENSG00000107815 HGNC:1160 TWNK gene TWNK Royal Melbourne Hospital;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 7, 271245;Ataxia Neuropathy Spectrum Disorders, Dominant;Progressive external ophthalmoplegia with mitochondrial DNA deletions, 609286;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3, 609286;Perrault syndrome 5, 616138;Mitochondrial DNA depletion syndrome 7 (hepatocerebral type), 271245;Spinocerebellar Ataxia, Recessive False 3 100;0;0 3.352 False ENSG00000107815 ENSG00000107815 HGNC:1160 TYMP gene TYMP Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 1 (MNGIE type), MIM# 603041;MNGIE: ptosis, ophthalmoplegia & ophthalmoparesis, hearing loss, neuropathy 9924029;14757860 False 3 100;0;0 3.352 True ENSG00000025708 ENSG00000025708 HGNC:3148 TYMP gene TYMP Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 1 (MNGIE type);HMSN False 3 0;100;0 3.352 True ENSG00000025708 ENSG00000025708 HGNC:3148 UBA1 gene UBA1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females dHMN/dSMA;Spinal muscular atrophy, X-linked 2, MIM# 301830 18179898;32181232;31932168;29034082;27699224;26028276;23518311 False 3 100;0;0 3.352 True ENSG00000130985 ENSG00000130985 HGNC:12469 UBAP1 gene UBAP1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Childhood-onset hereditary spastic paraplegia;Spastic paraplegia 80, autosomal dominant 618418" 31696996 False 3 100;0;0 3.352 True Other ENSG00000165006 ENSG00000165006 HGNC:12461 UBAP1 gene UBAP1 Expert Review Green;Literature;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 80, autosomal dominant 618418 31696996;32934340 False 3 100;0;0 3.352 True Other ENSG00000165006 ENSG00000165006 HGNC:12461 UBQLN2 gene UBQLN2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Amyotrophic lateral sclerosis type 15 (MONDO:0010459;MIM#300857) 20301623;21857683 False 3 100;0;0 3.352 True ENSG00000188021 ENSG00000188021 HGNC:12509 UBTF gene UBTF Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672;MONDO:0044701 29300972 False 3 100;0;0 3.352 True ENSG00000108312 ENSG00000108312 HGNC:12511 UCHL1 gene UCHL1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 79A, autosomal dominant, MIM# 620221;Spastic paraplegia 79, autosomal recessive, 615491;MONDO:0014209;Neurodegenerative disease, MONDO:0005559, UCHL1-related 23359680;3340629;28007905;32656641;29735986;28007905;35986737 False 3 100;0;0 3.352 True ENSG00000154277 ENSG00000154277 HGNC:12513 UCHL1 gene UCHL1 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 79, autosomal recessive, MIM#615491;Neurodegenerative disease, MONDO:0005559, UCHL1-related 28007905;23359680;11555633;35986737 False 3 100;0;0 3.352 True ENSG00000154277 ENSG00000154277 HGNC:12513 UCHL1 gene UCHL1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegenerative disease, MONDO:0005559, UCHL1-related 35986737 False 3 100;0;0 3.352 True ENSG00000154277 ENSG00000154277 HGNC:12513 UNC45B gene UNC45B Expert Review Green;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal False 3 100;0;0 3.352 True ENSG00000141161 ENSG00000141161 HGNC:14304 UNC45B gene UNC45B Expert Review Green;Other;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myofibrillar myopathy 11 (MIM#619178) 33217308;31852522 False 3 100;0;0 3.352 True ENSG00000141161 ENSG00000141161 HGNC:14304 VAMP1 gene VAMP1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal presynaptic CMS;Myasthenic syndrome, congenital, 25, MIM# 618323 28168212;28253535;28600779;17102983 False 3 100;0;0 3.352 True ENSG00000139190 ENSG00000139190 HGNC:12642 VAPB gene VAPB Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Adult proximal spinal muscular atrophy, autosomal dominant;dHMN/dSMA;Spinal muscular atrophy, late-onset, Finkel type, MIM# 182980 15372378;32162544;28993872;28173107;26566915 False 3 100;0;0 3.352 True ENSG00000124164 ENSG00000124164 HGNC:12649 VAPB gene VAPB Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinal muscular atrophy, late-onset, Finkel type (MIM# 182980);Amyotrophic lateral sclerosis 8 20301623;15372378 False 3 100;0;0 3.352 True ENSG00000124164 ENSG00000124164 HGNC:12649 VCP gene VCP Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Inclusion body myopathy with early-onset Paget disease and frontotemporal dementia 1 167320 False 3 0;0;0 3.352 False ENSG00000165280 ENSG00000165280 HGNC:12666 VCP gene VCP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 6 (ALS) (MIM#613954) 20301649;20301623;21145000 False 3 100;0;0 3.352 True ENSG00000165280 ENSG00000165280 HGNC:12666 VCP gene VCP Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, type 2Y, MIM# 616687 25125609;25878907;32165109 False 3 50;50;0 3.352 True Other ENSG00000165280 ENSG00000165280 HGNC:12666 VLDLR gene VLDLR Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, mental retardation and dysequilibirum syndrome 1, 224050;Cerebellar hypoplasia and mental retardation with or without quadrupedal locomotion 1, 224050 False 3 100;0;0 3.352 False ENSG00000147852 ENSG00000147852 HGNC:12698 VMA21 gene VMA21 Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Myopathy, X-linked, with excessive autophagy (MIM#310440) 27916343;25809233;23315026 False 3 0;100;0 3.352 True ENSG00000160131 ENSG00000160131 HGNC:22082 VPS13A gene VPS13A Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal chorea-acanthocytosis MONDO:0008695 33652783;20301561 False 3 100;0;0 3.352 True ENSG00000197969 ENSG00000197969 HGNC:1908 VPS13D gene VPS13D Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spinocerebellar ataxia, autosomal recessive 4, MIM# 607317" 29604224;29518281 False 3 100;0;0 3.352 True ENSG00000048707 ENSG00000048707 HGNC:23595 VPS13D gene VPS13D Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 4, 607317 False 3 100;0;0 3.352 True ENSG00000048707 ENSG00000048707 HGNC:23595 VPS41 gene VPS41 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia-29 (SCAR29), MIM#619389;Progressive neurodevelopmental disorder with ataxia, hypotonia, dystonia, intellectual disability and speech delay 32808683;33764426 False 3 100;0;0 3.352 True ENSG00000006715 ENSG00000006715 HGNC:12713 VRK1 gene VRK1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuronopathy, distal hereditary motor, autosomal recessive 10, MIM# 620542 31560180;32242460;31178479;31837156;30847374 False 3 100;0;0 3.352 True ENSG00000100749 ENSG00000100749 HGNC:12718 VWA1 gene VWA1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary motor neuropathy 33459760;33693694;33559681 False 3 0;0;0 3.352 True ENSG00000179403 ENSG00000179403 HGNC:30910 WARS2 gene WARS2 Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinsonism-dystonia 3, childhood-onset, MIM# 619738;Neurodevelopmental disorder, mitochondrial, with abnormal movements and lactic acidosis, with or without seizures, MIM# 617710 29120065;31970218;34890876;28236339;28650581;28905505;30920170 False 3 100;0;0 3.352 True ENSG00000116874 ENSG00000116874 HGNC:12730 WASHC5 gene WASHC5 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 8, autosomal dominant, 603563;MONDO:0011339 23455931;17160902;31814071;26572744 False 3 100;0;0 3.352 True ENSG00000164961 ENSG00000164961 HGNC:28984 WDR45B gene WDR45B Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Profound developmental delay, early-onset refractory epilepsy, progressive spastic quadriplegia and contractures, and brain malformations;Neurodevelopmental disorder with spastic quadriplegia and brain abnormalities with or without seizures, MIM#617977 21937992;28503735;27431290 False 3 100;0;0 3.352 True ENSG00000141580 ENSG00000141580 HGNC:25072 WDR73 gene WDR73 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Galloway Mowat syndrome, when patients are ambulant ataxia is a recognisednfeature;Galloway-Mowat Syndrome 1, 251300 False 3 100;0;0 3.352 False ENSG00000177082 ENSG00000177082 HGNC:25928 WDR81 gene WDR81 Expert Review Red;Expert Review Red;Expert list;Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital hydrocephalus 3 with brain anomalies, 617967;Cerebellar ataxia, mental retardation, and dysequilibrium syndrome 2, 610185;Cerebellar ataxia, mental retardation and dysequilibrium syndrome 2, 610185 21885617;28556411;28969387 False 3 33;0;67 3.352 True ENSG00000167716 ENSG00000167716 HGNC:26600 WFS1 gene WFS1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Wolfram syndrome 1, 222300 25211237 False 3 100;0;0 3.352 True ENSG00000109501 ENSG00000109501 HGNC:12762 WNK1 gene WNK1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HSAN/SFN;Neuropathy, hereditary sensory and autonomic, type II, MIM# 201300;MONDO:0024309 15060842;15911806;15455397;16534117 False 3 100;0;0 3.352 True ENSG00000060237 ENSG00000060237 HGNC:14540 WWOX gene WWOX Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spinocerebellar ataxia 12, 6143232;Early infantile epileptic encephalopathy 28, 616211;Autosomal recessive spinocerebellar ataxia 12, 614322 False 3 100;0;0 3.352 False ENSG00000186153 ENSG00000186153 HGNC:12799 XK gene XK Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females McLeod syndrome with or without chronic granulomatous disease (MIM#300842) 11761473 False 3 100;0;0 3.352 True ENSG00000047597 ENSG00000047597 HGNC:12811 XRCC1 gene XRCC1 Royal Melbourne Hospital;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ocular motor apraxia, axonal neuropathy, and progressive cerebellar ataxia;Autosomal recessive spinocerebellar ataxia 26, 617633 29472272;28002403 False 3 100;0;0 3.352 False ENSG00000073050 ENSG00000073050 HGNC:12828 XRCC1 gene XRCC1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 26 MIM#617633 28002403;29472272 False 3 100;0;0 3.352 True ENSG00000073050 ENSG00000073050 HGNC:12828 XRCC1 gene XRCC1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 26 MIM#617633 28002403;29472272 False 3 100;0;0 3.352 False ENSG00000073050 ENSG00000073050 HGNC:12828 YARS gene YARS Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, dominant intermediate C, MIM# 608323;MONDO:0012012 16429158;24354524;31587308;26725087 False 3 100;0;0 3.352 True ENSG00000134684 ENSG00000134684 HGNC:12840 YARS2 gene YARS2 Expert Review Green;Expert Review;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy, lactic acidosis, and sideroblastic anemia 2 MIM#613561 28395030 False 3 100;0;0 3.352 True ENSG00000139131 ENSG00000139131 HGNC:24249 ZFYVE26 gene ZFYVE26 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 15, autosomal recessive, 270700;MONDO:0010044 31385551 False 3 100;0;0 3.352 True ENSG00000072121 ENSG00000072121 HGNC:20761 ZFYVE26 gene ZFYVE26 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 15, autosomal recessive, MIM# 270700" False 3 100;0;0 3.352 True ENSG00000072121 ENSG00000072121 HGNC:20761 ZFYVE26 gene ZFYVE26 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 15 MIM#270700 17661097;19438933 False 3 100;0;0 3.352 True ENSG00000072121 ENSG00000072121 HGNC:20761 CANVAS str RFC1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575 30926972 False 3 100;0;0 3.352 False ENSG00000035928 ENSG00000035928 HGNC:9969 4 39350045 39350103 39348425 39348483 AAGGG 0 400 CANVAS str RFC1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575 30926972 False 3 100;0;0 3.352 False ENSG00000035928 ENSG00000035928 HGNC:9969 4 39350045 39350103 39348425 39348483 AAGGG 0 400 DM1 str DMPK Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myotonic dystrophy 1 MIM#160900 20301344;29325606 False 3 100;0;0 3.352 True ENSG00000104936 ENSG00000104936 HGNC:2933 19 46273463 46273522 45770205 45770264 CTG 34 50 DRPLA str ATN1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dentatorubral-pallidoluysian atrophy MIM#125370 29325606;20301664 False 3 100;0;0 3.352 False ENSG00000111676 ENSG00000111676 HGNC:3033 12 7045892 7045936 6936729 6936773 CAG 35 48 EPM1 str CSTB Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800 29325606;20301321 False 3 100;0;0 3.352 False ENSG00000160213 ENSG00000160213 HGNC:2482 21 45196325 45196360 43776444 43776479 CCCCGCCCCGCG 3 30 FRDA str FXN Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Friedreich ataxia MIM#229300 20301458 False 3 100;0;0 3.352 False ENSG00000165060 ENSG00000165060 HGNC:3951 9 71652203 71652220 69037287 69037304 GAA 33 66 FTDALS str C9orf72 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550 25577942;21944779;21944778 False 3 100;0;0 3.352 True ENSG00000147894 ENSG00000147894 HGNC:28337 9 27573427 27573544 27573529 27573546 GGGGCC 25 60 FXTAS str FMR1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Fragile X tremor/ataxia syndrome MIM#300623 23765048;25227148 False 3 100;0;0 3.352 False ENSG00000102081 ENSG00000102081 HGNC:3775 X 146993569 146993628 147912051 147912110 CGG 44 55 LRP12-ALS_CGG str LRP12 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Amyotrophic lateral sclerosis MONDO:0004976;Amyotrophic lateral sclerosis 28, MIM# 620452" 37339631 False 3 100;0;0 3.352 True ENSG00000147650 ENSG00000147650 HGNC:31708 8 105601201 105601227 104588973 104588999 CGG 50 61 MRUPAV str PLIN4 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted myopathy, distal, with rimmed vacuoles MONDO:0014945 32451610;37145156;36151849;35499779 False 3 100;0;0 3.352 True ENSG00000167676 ENSG00000167676 HGNC:29393 19 4510975 4511073 4510963 4511061 ACTGAAGACAGTGTCCTTGGTACCCATAAGCACAGCCTTGGAGGCGTCCACGCCGGTCTGCACGGTTCCTTTGGCCACATTCACTGCCCCCGTGACTCC 31 39 NIID str NOTCH2NL Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuronal intranuclear inclusion disease MIM#603472;Oculopharyngodistal myopathy 3 MIM#619473;Tremor, hereditary essential, 6 MIM#618866 31178126;31332381;31819945;33887199;33943039;32250060;31332380;32852534;32989102;34333668 False 3 100;0;0 3.352 True ENSG00000213240 ENSG00000264343 HGNC:31862 1 145209324 145209344 149390803 149390829 GGC 40 60 NIID str NOTCH2NL Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuronal intranuclear inclusion disease MIM#603472;Oculopharyngodistal myopathy 3 MIM#619473;Tremor, hereditary essential, 6 MIM#618866 31178126;31332381;31819945;33887199;33943039;32250060;31332380;32852534;32989102;34333668 False 3 100;0;0 3.352 True ENSG00000213240 ENSG00000264343 HGNC:31862 1 145209324 145209344 149390803 149390829 GGC 40 60 OPDM1 str LRP12 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Oculopharyngodistal myopathy 1 MIM#164310 31332380;34047774 False 3 100;0;0 3.352 True ENSG00000147650 ENSG00000147650 HGNC:31708 8 105601201 105601227 104588973 104588999 CGG 45 85 OPDM2 str GIPC1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Oculopharyngodistal myopathy 2 MIM#618940 32413282;33374016 False 3 100;0;0 3.352 True ENSG00000123159 ENSG00000123159 HGNC:1226 19 14606854 14606886 14496042 14496074 CGG 32 70 OPDM4_RILPL1_CGG str RILPL1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Oculopharyngodistal myopathy MONDO:0025193 35148830 False 3 100;0;0 3.352 True ENSG00000188026 ENSG00000188026 HGNC:26814 12 124018270 124018296 123533723 123533749 CGG 16 139 OPDM_ABCD3_GCC str ABCD3 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Oculopharyngodistal myopathy MONDO:0025193 39068203 False 3 100;0;0 3.352 True ENSG00000117528 ENSG00000117528 HGNC:67 1 94883977 94883998 94418421 94418442 GCC 50 118 SBMA str AR Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Spinal and bulbar muscular atrophy of Kennedy MIM#313200 20301508;29325606 False 3 100;0;0 3.352 True ENSG00000169083 ENSG00000169083 HGNC:644 X 66765160 66765225 67545318 67545383 CAG 34 38 SCA1 str ATXN1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 1 MIM#164400 29325606;20301363 False 3 100;0;0 3.352 False ENSG00000124788 ENSG00000124788 HGNC:10548 6 16327918 16327953 16327687 16327722 CAG 35 39 SCA10 str ATXN10 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 10 MIM#603516 20301354 False 3 0;0;0 3.352 False ENSG00000130638 ENSG00000130638 HGNC:10549 22 46191235 46191304 45795355 45795424 ATTCT 32 800 SCA12 str PPP2R2B Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 12 MIM#604326 27864267;33811808 False 3 100;0;0 3.352 True ENSG00000156475 ENSG00000156475 HGNC:9305 5 146258292 146258321 146878729 146878758 CAG 32 51 SCA17 str TBP Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 17 MIM#607136 20301611;29325606 False 3 100;0;0 3.352 False ENSG00000112592 ENSG00000112592 HGNC:11588 6 170870996 170871109 170561908 170562021 CAG 40 49 SCA2 str ATXN2 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 2 MIM#183090 20301452 False 3 100;0;0 3.352 True ENSG00000204842 ENSG00000204842 HGNC:10555 12 112036755 112036823 111598951 111599016 CAG 31 35 SCA2 str ATXN2 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 2 MIM#183090 29325606;20301452 False 3 100;0;0 3.352 False ENSG00000204842 ENSG00000204842 HGNC:10555 12 112036755 112036823 111598951 111599019 CAG 31 35 SCA27B str FGF14 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia type 27B MONDO:0012247;Spinocerebellar ataxia 50;late-onset cerebellar ataxias (LOCAs) 37165652;36516086;36493768 False 3 100;0;0 3.352 True ENSG00000102466 ENSG00000102466 HGNC:3671 13 102813926 102814076 102161576 102161726 GAA 249 300 SCA3 str ATXN3 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Machado-Joseph disease MIM#109150;Spinocerebellar ataxia type 3 20301375;29325606 False 3 100;0;0 3.352 False ENSG00000066427 ENSG00000066427 HGNC:7106 14 92537355 92537396 92071011 92071052 CAG 44 60 SCA31 str BEAN1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 31 MIM#117210 19878914;31755042 False 3 100;0;0 3.352 False ENSG00000166546 ENSG00000166546 HGNC:24160 16 66524301 66524302 66490398 66490399 TGGAA 22 80 SCA36 str NOP56 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 36 MIM#614153 21683323 False 3 100;0;0 3.352 False ENSG00000101361 ENSG00000101361 HGNC:15911 20 2633380 2633403 2652734 2652757 GGCCTG 14 650 SCA37 str DAB1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 37 MIM#615945 28686858;31145571 False 3 100;0;0 3.352 False ENSG00000173406 ENSG00000173406 HGNC:2661 1 57832716 57832797 57367044 57367121 ATTTC 0 31 SCA4_ZFHX3_GGC str ZFHX3 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted spinocerebellar ataxia type 4 MONDO:0010847 38035881;38197134 False 3 100;0;0 3.352 True ENSG00000140836 ENSG00000140836 HGNC:777 16 72821594 72821657 72787695 72787758 GGC 30 48 SCA4_ZFHX3_GGC str ZFHX3 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted spinocerebellar ataxia type 4 MONDO:0010847 38035881;38197134 False 3 100;0;0 3.352 True ENSG00000140836 ENSG00000140836 HGNC:777 16 72821594 72821657 72787695 72787758 GGC 30 48 SCA6 str CACNA1A Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 6 MIM#183086;Episodic ataxia, type 2 MIM#108500 20301319;29325606 False 3 100;0;0 3.352 False ENSG00000141837 ENSG00000141837 HGNC:1388 19 13318673 13318691 13207859 13207897 CAG 18 20 SCA7 str ATXN7 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 7 MIM#164500 29325606;20301433 False 3 100;0;0 3.352 False ENSG00000163635 ENSG00000163635 HGNC:10560 3 63898362 63898391 63912686 63912715 CAG 27 37 SCA8 str ATXN8OS Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 8 MIM#608768 20301445 False 3 100;0;0 3.352 False ENSG00000230223 ENSG00000230223 HGNC:10561 13 70713486 70713560 70139354 70139428 CTG 50 80