Repeat Disorders
STR: RCPSGRCh37 Position: 78120803-78120938
GRCh38 Position: 80147004-80147139
Repeated Sequence: TCGGCAGCGGCGCAGCGAGG
Normal Number of Repeats: < 12
Pathogenic Number of Repeats: = or > 14
EIF4A3 (eukaryotic translation initiation factor 4A3)
EnsemblGeneIds (GRCh38): ENSG00000141543
EnsemblGeneIds (GRCh37): ENSG00000141543
OMIM: 608546, Gene2Phenotype
EIF4A3 is in 0 panels
1 review
Bryony Thompson (Royal Melbourne Hospital)
NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X]
Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant.
Sources: LiteratureCreated: 5 Sep 2021, 6 a.m. | Last Modified: 5 Sep 2021, 6:03 a.m.
Panel Version: 0.128
Mode of inheritance
BIALLELIC, autosomal or pseudoautosomal
Phenotypes
Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome
Publications
Clinically RelevantInterruptions in the repeated sequence are reported as part of standard diagnostic practise
Details
- Name
- RCPS
- Chromosome
- 17
- GRCh37 Coordinates
- 78120803-78120938
- GRCh38 Coordinates
- 80147004-80147139
- Repeated Sequence
- TCGGCAGCGGCGCAGCGAGG
- Normal Number of Repeats: <
- 12
- Pathogenic Number of Repeats: = or >
- 14
- Mode of Inheritance
- BIALLELIC, autosomal or pseudoautosomal
- Sources
-
- Expert Review Green
- Literature
- Phenotypes
-
- Robin sequence with cleft mandible and limb anomalies MIM#268305
- Richieri-Costa-Pereira syndrome
- Tags
- OMIM
- 608546
- Clinvar variants
- Variants in EIF4A3
- Penetrance
- None
- Publications
History Filter Activity
Added Tag
Zornitza Stark (Victorian Clinical Genetics Services; Australian Genomics)Tag paediatric-onset tag was added to STR: RCPS.
Entity classified by Genomics England curator
Bryony Thompson (Royal Melbourne Hospital)Str: rcps has been classified as Green List (High Evidence).
Entity classified by Genomics England curator
Bryony Thompson (Royal Melbourne Hospital)Str: rcps has been classified as Green List (High Evidence).
Created, Added New Source, Set mode of inheritance, Set publications, Set Phenotypes
Bryony Thompson (Royal Melbourne Hospital)STR: RCPS was added STR: RCPS was added to Repeat Disorders. Sources: Literature Mode of inheritance for STR: RCPS was set to BIALLELIC, autosomal or pseudoautosomal Publications for STR: RCPS were set to 24360810; 29112243 Phenotypes for STR: RCPS were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome Review for STR: RCPS was set to GREEN STR: RCPS was marked as clinically relevant