Repeat Disorders
STR: MRUPAVGRCh37 Position: 4510975-4511073
GRCh38 Position: 4510963-4511061
Repeated Sequence: ACTGAAGACAGTGTCCTTGGTACCCATAAGCACAGCCTTGGAGGCGTCCACGCCGGTCTGCACGGTTCCTTTGGCCACATTCACTGCCCCCGTGACTCC
Normal Number of Repeats: < 31
Pathogenic Number of Repeats: = or > 39
PLIN4 (perilipin 4)
EnsemblGeneIds (GRCh38): ENSG00000167676
EnsemblGeneIds (GRCh37): ENSG00000167676
OMIM: 613247, Gene2Phenotype
PLIN4 is in 0 panels
1 review
Bryony Thompson (Royal Melbourne Hospital)
Expansion of 33-mer (33 amino acids, 99 bp) identified in coding exon 3 (exon 5) of PLIN4 via linkage analysis and long read sequencing in a large Italian cohort with progressive myopathy with specific pathology including rimmed ubiquitin-positive autophagic vacuolation.
Suggested disease name myopathy with rimmed ubiquitin-positive autophagic vacuolation (MRUPAV)
An additional 4 unrelated Chinese families/probands were reported.
Normal PLIN4 alleles: 27-31 x 33-mer
Pathogenic: ≥39 x 33-mer
Sources: LiteratureCreated: 7 Jun 2023, 4:37 a.m.
Mode of inheritance
MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes
myopathy, distal, with rimmed vacuoles MONDO:0014945
Publications
Clinically RelevantInterruptions in the repeated sequence are reported as part of standard diagnostic practise
Details
- Name
- MRUPAV
- Chromosome
- 19
- GRCh37 Coordinates
- 4510975-4511073
- GRCh38 Coordinates
- 4510963-4511061
- Repeated Sequence
- ACTGAAGACAGTGTCCTTGGTACCCATAAGCACAGCCTTGGAGGCGTCCACGCCGGTCTGCACGGTTCCTTTGGCCACATTCACTGCCCCCGTGACTCC
- Normal Number of Repeats: <
- 31
- Pathogenic Number of Repeats: = or >
- 39
- Mode of Inheritance
- MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
- Sources
-
- Expert Review Green
- Literature
- Phenotypes
-
- myopathy, distal, with rimmed vacuoles MONDO:0014945
- Tags
- OMIM
- 613247
- Clinvar variants
- Variants in PLIN4
- Penetrance
- None
- Publications
History Filter Activity
Entity classified by Genomics England curator
Bryony Thompson (Royal Melbourne Hospital)Str: mrupav has been classified as Green List (High Evidence).
Entity classified by Genomics England curator
Bryony Thompson (Royal Melbourne Hospital)Str: mrupav has been classified as Green List (High Evidence).
Created, Added New Source, Added Tag, Set mode of inheritance, Set publications, Set Phenotypes
Bryony Thompson (Royal Melbourne Hospital)STR: MRUPAV was added STR: MRUPAV was added to Repeat Disorders. Sources: Literature adult-onset tags were added to STR: MRUPAV. Mode of inheritance for STR: MRUPAV was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: MRUPAV were set to 32451610; 37145156; 36151849; 35499779 Phenotypes for STR: MRUPAV were set to myopathy, distal, with rimmed vacuoles MONDO:0014945 Review for STR: MRUPAV was set to GREEN STR: MRUPAV was marked as clinically relevant