Repeat Disorders
STR: CJD
NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X]
Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat.
Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype.
Sources: Expert listCreated: 31 Aug 2021, 12:42 p.m.
Mode of inheritance
MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes
Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440
Publications
Clinically RelevantInterruptions in the repeated sequence are reported as part of standard diagnostic practise
Tag adult-onset tag was added to STR: CJD.
Str: cjd has been classified as Green List (High Evidence).
Str: cjd has been classified as Green List (High Evidence).
STR: CJD was added STR: CJD was added to Repeat Disorders. Sources: Expert list Mode of inheritance for STR: CJD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: CJD were set to 2159587; 20301407 Phenotypes for STR: CJD were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440 Review for STR: CJD was set to GREEN STR: CJD was marked as clinically relevant