Entity Name Entity type Gene Symbol Sources(; separated) Level4 Level3 Level2 Model_Of_Inheritance Phenotypes Omim Orphanet HPO Publications Description Flagged GEL_Status UserRatings_Green_amber_red version ready Mode of pathogenicity EnsemblId(GRch37) EnsemblId(GRch38) HGNC Position Chromosome Position GRCh37 Start Position GRCh37 End Position GRCh38 Start Position GRCh38 End STR Repeated Sequence STR Normal Repeats STR Pathogenic Repeats Region Haploinsufficiency Score Region Triplosensitivity Score Region Required Overlap Percentage Region Variant Type Region Verbose Name BPES str FOXL2 Expert Review Green;Expert list Repeat Disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Blepharophimosis, epicanthus inversus, and ptosis type 1 and 2 MIM#110100;Premature ovarian failure 3 MIM#608996 11468277;33811808 False 3 100;0;0 0.168 True ENSG00000183770 ENSG00000183770 HGNC:1092 3 138664863 138664904 138946021 138946062 GCN 14 19 CANVAS str RFC1 Expert Review Green;Expert list Repeat Disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575 30926972;32851396;33237689;31230722 False 3 100;0;0 0.168 True ENSG00000035928 ENSG00000035928 HGNC:9969 4 39350045 39350103 39348425 39348483 AAGGG 0 400 CCHS str PHOX2B Expert Review Green;Expert list Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Central hypoventilation syndrome, congenital, with or without Hirschsprung disease MIM#209880 12640453;34012823;20301600;18798833 False 3 100;0;0 0.168 True ENSG00000109132 ENSG00000109132 HGNC:9143 4 41747989 41748048 41745972 41746031 GCN 20 25 CJD str PRNP Expert Review Green;Expert list Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440 2159587;20301407 False 3 100;0;0 0.168 True ENSG00000171867 ENSG00000171867 HGNC:9449 20 4680026 4680073 4699380 4699427 GGTGGTGGCTGGGGGCAGCCTCAT 4 5 DBQD2 str XYLT1 Expert Review Green;Expert list Repeat Disorders BIALLELIC, autosomal or pseudoautosomal Desbuquois dysplasia 2 MIM#615777 30554721 False 3 100;0;0 0.168 True ENSG00000103489 ENSG00000103489 HGNC:15516 16 17564765 17564779 17470908 17470922 GGC 20 120 DM1 str DMPK Expert Review Green;Expert list Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myotonic dystrophy 1 MIM#160900 20301344;29325606;1546325 False 3 100;0;0 0.168 True ENSG00000104936 ENSG00000104936 HGNC:2933 19 46273463 46273522 45770205 45770264 CTG 34 50 DM2 str CNBP Expert Review Green;Expert list Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myotonic dystrophy 2 MIM#602668 20301639;11486088 False 3 100;0;0 0.168 True ENSG00000169714 ENSG00000169714 HGNC:13164 3 128891420 128891499 129172577 129172656 CCTG 26 75 DRPLA str ATN1 Expert Review Green;Expert list Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dentatorubral-pallidoluysian atrophy MIM#125370 8136840;8136826;29325606;20301664 False 3 100;0;0 0.168 True ENSG00000111676 ENSG00000111676 HGNC:3033 12 7045892 7045936 6936729 6936773 CAG 35 48 EIEE1_tract1 str ARX Expert Review Green;Expert list Repeat Disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Developmental and epileptic encephalopathy 1 MIM#308350;Intellectual disability, X-linked 29 and others MIM#300419;Partington syndrome MIM#309510 11889467;33811808 False 3 100;0;0 0.168 True ENSG00000004848 ENSG00000004848 HGNC:18060 X 25031767 25031814 25013650 25013697 GCN 16 23 EIEE1_tract2 str ARX Expert Review Green;Expert list Repeat Disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Developmental and epileptic encephalopathy 1 MIM#308350;Intellectual disability, X-linked 29 and others MIM#300419;Partington syndrome MIM#309510 11889467;33811808 False 3 100;0;0 0.168 True ENSG00000004848 ENSG00000004848 HGNC:18060 X 25031647 25031682 25013530 25013565 GCN 12 20 EPM1 str CSTB Expert Review Green;Expert list Repeat Disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800 29325606;20301321;9126745 False 3 100;0;0 0.168 True ENSG00000160213 ENSG00000160213 HGNC:2482 21 45196325 45196360 43776444 43776479 CCCCGCCCCGCG 3 30 FAME1 str SAMD12 Expert Review Green;Expert list Repeat Disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Epilepsy, familial adult myoclonic, 1 MIM#601068 30194086;29507423 False 3 100;0;0 0.168 True ENSG00000177570 ENSG00000177570 HGNC:31750 8 119379055 119379157 118366816 118366918 TTTCA 0 100 FAME2 str STARD7 Expert Review Green;Literature Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epilepsy, familial adult myoclonic, 2 MIM#607876 31664034 False 3 100;0;0 0.168 True ENSG00000084090 ENSG00000084090 HGNC:18063 2 96862805 96862859 96197067 96197121 ATTTC 0 661 FAME3 str MARCH6 Expert Review Green;Literature Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epilepsy, familial adult myoclonic, 3 MIM#613608 31664039 False 3 100;0;0 0.168 True ENSG00000145495 ENSG00000145495 HGNC:30550 5 10356451 10356519 10356347 10356411 TTTCA 0 660 FECD3 str TCF4 Expert Review Green;Expert list Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Corneal dystrophy, Fuchs endothelial, 3 MIM#613267 25722209;24255041 False 3 100;0;0 0.168 True ENSG00000196628 ENSG00000196628 HGNC:11634 18 53253387 53253458 55586156 55586227 CTG 31 51 FRAXE str AFF2 Expert Review Green;Expert list Repeat Disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Intellectual developmental disorder, X-linked 109 MIM#309548 8334699;8673085;11388762 False 3 100;0;0 0.168 True ENSG00000155966 ENSG00000155966 HGNC:3776 X 147582158 147582202 148500638 148500682 GCC 44 200 FRDA str FXN Expert Review Green;Expert list Repeat Disorders BIALLELIC, autosomal or pseudoautosomal Friedreich ataxia MIM#229300 20301458;8596916 False 3 100;0;0 0.168 True ENSG00000165060 ENSG00000165060 HGNC:3951 9 71652203 71652220 69037287 69037304 GAA 33 66 FTDALS str C9orf72 Expert Review Green;Expert list Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550 25577942;21944779;21944778 False 3 100;0;0 0.168 True ENSG00000147894 ENSG00000147894 HGNC:28337 9 27573427 27573544 27573529 27573546 GGGGCC 25 60 FXPOI str FMR1 Expert Review Green;Expert list Repeat Disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Premature ovarian failure 1 MIM#311360 20301558;9647544 False 3 100;0;0 0.168 True ENSG00000102081 ENSG00000102081 HGNC:3775 X 146993569 146993628 147912051 147912110 CGG 44 55 FXS str FMR1 Expert Review Green;Expert list Repeat Disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) "Fragile X syndrome MIM#300624" 33795824;25227148;1710175;2031184 False 3 100;0;0 0.168 True ENSG00000102081 ENSG00000102081 HGNC:3775 X 146993569 146993628 147912051 147912110 CGG 44 200 FXTAS str FMR1 Expert Review Green;Expert list Repeat Disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Fragile X tremor/ataxia syndrome MIM#300623 23765048;25227148;11445641 False 3 100;0;0 0.168 True ENSG00000102081 ENSG00000102081 HGNC:3775 X 146993569 146993628 147912051 147912110 CGG 44 55 GDPAG str GLS Expert Review Green;Literature Repeat Disorders BIALLELIC, autosomal or pseudoautosomal Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412 30970188 False 3 100;0;0 0.168 True ENSG00000115419 ENSG00000115419 HGNC:4331 2 191745599 191745646 190880873 190880920 GCA 16 400 HD str HTT Expert Review Green;Expert list Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Huntington disease MIM#143100 8458085;20301482;29325606 False 3 100;0;0 0.168 True ENSG00000197386 ENSG00000197386 HGNC:4851 4 3076604 3076666 3074877 3074939 CAG 26 40 HDL2 str JPH3 Expert Review Green;Expert list Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Huntington disease-like 2 MIM#606438 11558794;20301701 False 3 100;0;0 0.168 True ENSG00000154118 ENSG00000154118 HGNC:14203 16 87637894 87637935 87604288 87604329 CTG 28 40 HFGS_tract1 str HOXA13 Expert Review Green;Expert list Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hand-foot-uterus syndrome MIM#140000 10839976;12073020;33811808 False 3 100;0;0 0.168 True ENSG00000106031 ENSG00000106031 HGNC:5102 7 27239538 27239585 27199919 27199966 GCN 16 22 HFGS_tract2 str HOXA13 Expert Review Green;Expert list Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hand-foot-uterus syndrome MIM#140000 10839976;12073020;33811808 False 3 100;0;0 0.168 True ENSG00000106031 ENSG00000106031 HGNC:5102 7 27239445 27239480 27199826 27199861 GCN 12 18 HFGS_tract3 str HOXA13 Expert Review Green;Expert list Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hand-foot-uterus syndrome MIM#140000 10839976;12073020;33811808 False 3 100;0;0 0.168 True ENSG00000106031 ENSG00000106031 HGNC:5102 7 27239298 27239351 27199679 27199732 GCN 18 24 HMNMYO str VWA1 Expert Review Green;Literature Repeat Disorders BIALLELIC, autosomal or pseudoautosomal "Neuropathy, hereditary motor, with myopathic features MIM#619216" 33559681;33459760 False 3 100;0;0 0.168 True ENSG00000179403 ENSG00000179403 HGNC:30910 1 1371179 1371198 1435799 1435818 GCGCGGAGCG 2 3 HPE5 str ZIC2 Expert Review Green;Expert list Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Holoprosencephaly 5 MIM#609637 11285244;33811808 False 3 100;0;0 0.168 True ENSG00000043355 ENSG00000043355 HGNC:12873 13 100637703 100637747 99985449 99985493 GCN 15 25 HSAN8 str PRDM12 Expert Review Green;Literature Repeat Disorders BIALLELIC, autosomal or pseudoautosomal Neuropathy, hereditary sensory and autonomic, type VIII MIM#616488 26005867 False 3 100;0;0 0.168 True ENSG00000130711 ENSG00000130711 HGNC:13997 9 133556993 133557026 130681606 130681639 GCC 14 18 MEDPSACH str COMP Expert Review Green;Literature Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epiphyseal dysplasia, multiple, 1 MIM#132400;Pseudoachondroplasia MIM#177170 9887340;17133256;21922596 False 3 100;0;0 0.168 True ENSG00000105664 ENSG00000105664 HGNC:2227 19 18896844 18896859 18786034 18786049 GAC 5 6 MRUPAV str PLIN4 Expert Review Green;Literature Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted myopathy, distal, with rimmed vacuoles MONDO:0014945 32451610;37145156;36151849;35499779 False 3 100;0;0 0.168 True ENSG00000167676 ENSG00000167676 HGNC:29393 19 4510975 4511073 4510963 4511061 ACTGAAGACAGTGTCCTTGGTACCCATAAGCACAGCCTTGGAGGCGTCCACGCCGGTCTGCACGGTTCCTTTGGCCACATTCACTGCCCCCGTGACTCC 31 39 NIID str NOTCH2NL Expert Review Green;Expert list Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuronal intranuclear inclusion disease MIM#603472;Oculopharyngodistal myopathy 3 MIM#619473;Tremor, hereditary essential, 6 MIM#618866 31178126;31332381;31819945;33887199;33943039;32250060;31332380;32852534;32989102;34333668 False 3 100;0;0 0.168 True ENSG00000213240 ENSG00000264343 HGNC:31862 1 145209324 145209344 149390803 149390829 GGC 40 60 OPDM1 str LRP12 Expert Review Green;Expert list Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Oculopharyngodistal myopathy 1 MIM#164310;Amyotrophic lateral sclerosis MONDO:0004976 31332380;34047774;37339631 False 3 100;0;0 0.168 True ENSG00000147650 ENSG00000147650 HGNC:31708 8 105601201 105601227 104588973 104588999 CGG 45 85 OPDM2 str GIPC1 Expert Review Green;Expert list Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Oculopharyngodistal myopathy 2 MIM#618940 32413282;33374016 False 3 100;0;0 0.168 True ENSG00000123159 ENSG00000123159 HGNC:1226 19 14606854 14606886 14496042 14496074 CGG 32 70 OPDM4 str RILPL1 Expert Review Green;Literature Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Oculopharyngodistal myopathy MONDO:0025193 35148830;35700120 False 3 100;0;0 0.168 True ENSG00000188026 ENSG00000188026 HGNC:26814 12 124018270 124018296 123533723 123533749 CGG 16 139 OPDM_ABCD3_GCC str ABCD3 Expert Review Green;Other Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Oculopharyngodistal myopathy MONDO:0025193 https://doi.org/10.1101/2023.10.09.23296582 False 3 100;0;0 0.168 True ENSG00000117528 ENSG00000117528 HGNC:67 1 94883977 94883998 94418421 94418442 GCC 50 118 OPMD str PABPN1 Expert Review Green;Expert list Repeat Disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Oculopharyngeal muscular dystrophy MIM#164300 9462747;20301305 False 3 100;0;0 0.168 False ENSG00000100836 ENSG00000100836 HGNC:8565 14 23790682 23790711 23321473 23321502 GCN 10 11 PHPX str SOX3 Expert Review Green;Expert list Repeat Disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Intellectual disability, X-linked, with isolated growth hormone deficiency MIM#300123;Panhypopituitarism, X-linked MIM#312000 12428212;15800844;33811808;23505376;19654509 False 3 100;0;0 0.168 True ENSG00000134595 ENSG00000134595 HGNC:11199 X 139586482 139586526 140504317 140504361 GCN 15 22 RCPS str EIF4A3 Expert Review Green;Literature Repeat Disorders BIALLELIC, autosomal or pseudoautosomal Robin sequence with cleft mandible and limb anomalies MIM#268305;Richieri-Costa-Pereira syndrome 24360810;29112243 False 3 100;0;0 0.168 True ENSG00000141543 ENSG00000141543 HGNC:18683 17 78120803 78120938 80147004 80147139 TCGGCAGCGGCGCAGCGAGG 12 14 SBMA str AR Expert Review Green;Expert list Repeat Disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Spinal and bulbar muscular atrophy of Kennedy MIM#313200 2062380;20301508;29325606 False 3 100;0;0 0.168 True ENSG00000169083 ENSG00000169083 HGNC:644 X 66765160 66765225 67545318 67545383 CAG 34 38 SCA1 str ATXN1 Expert Review Green;Expert list Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 1 MIM#164400 8358429;29325606;20301363 False 3 100;0;0 0.168 True ENSG00000124788 ENSG00000124788 HGNC:10548 6 16327918 16327953 16327687 16327722 CAG 35 39 SCA10 str ATXN10 Expert Review Green;Expert list Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 10 MIM#603516 20301354;11017075 False 3 100;0;0 0.168 True ENSG00000130638 ENSG00000130638 HGNC:10549 22 46191235 46191304 45795355 45795424 ATTCT 32 800 SCA12 str PPP2R2B Expert Review Green;Expert list Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 12 MIM#604326 27864267;33811808;10581021 False 3 100;0;0 0.168 True ENSG00000156475 ENSG00000156475 HGNC:9305 5 146258292 146258321 146878729 146878758 CAG 32 51 SCA17 str TBP Expert Review Green;Expert list Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 17 MIM#607136 10484774;20301611;29325606 False 3 100;0;0 0.168 True ENSG00000112592 ENSG00000112592 HGNC:11588 6 170870996 170871109 170561908 170562021 CAG 40 49 SCA2 str ATXN2 Expert Review Green;Expert list Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 2 MIM#183090 8896555;29325606;20301452 False 3 100;0;0 0.168 True ENSG00000204842 ENSG00000204842 HGNC:10555 12 112036755 112036823 111598951 111599019 CAG 31 35 SCA27B str FGF14 Expert Review Green;Literature Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia type 27B MONDO:0012247;Spinocerebellar ataxia 50;late-onset cerebellar ataxias (LOCAs) 37165652;36516086;36493768 False 3 100;0;0 0.168 True ENSG00000102466 ENSG00000102466 HGNC:3671 13 102813926 102814076 102161576 102161726 GAA 249 300 SCA3 str ATXN3 Expert Review Green;Expert list Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Machado-Joseph disease MIM#109150;Spinocerebellar ataxia type 3 7874163;20301375;29325606 False 3 100;0;0 0.168 True ENSG00000066427 ENSG00000066427 HGNC:7106 14 92537355 92537396 92071011 92071052 CAG 44 60 SCA31 str BEAN1 Expert Review Green;Expert list Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 31 MIM#117210 19878914;31755042 False 3 100;0;0 0.168 True ENSG00000166546 ENSG00000166546 HGNC:24160 16 66524301 66524302 66490398 66490399 TGGAA 22 80 SCA36 str NOP56 Expert Review Green;Expert list Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 36 MIM#614153 21683323 False 3 100;0;0 0.168 True ENSG00000101361 ENSG00000101361 HGNC:15911 20 2633380 2633403 2652734 2652757 GGCCTG 14 650 SCA37 str DAB1 Expert Review Green;Expert list Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 37 MIM#615945 28686858;31145571 False 3 100;0;0 0.168 True ENSG00000173406 ENSG00000173406 HGNC:2661 1 57832716 57832797 57367044 57367121 ATTTC 0 31 SCA4_ZFHX3_GGC str ZFHX3 Expert Review Green;Literature Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted spinocerebellar ataxia type 4 MONDO:0010847 38035881;38197134 False 3 100;0;0 0.168 True ENSG00000140836 ENSG00000140836 HGNC:777 16 72821594 72821657 72787695 72787758 GGC 30 48 SCA6 str CACNA1A Expert Review Green;Expert list Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 6 MIM#183086;Episodic ataxia, type 2 MIM#108500 8988170;20301319;29325606 False 3 100;0;0 0.168 True ENSG00000141837 ENSG00000141837 HGNC:1388 19 13318673 13318691 13207859 13207897 CAG 18 20 SCA7 str ATXN7 Expert Review Green;Expert list Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 7 MIM#164500 8908515;29325606;20301433 False 3 100;0;0 0.168 True ENSG00000163635 ENSG00000163635 HGNC:10560 3 63898362 63898391 63912686 63912715 CAG 27 37 SCA8 str ATXN8OS Expert Review Green;Expert list Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 8 MIM#608768 20301445;10192387 False 3 100;0;0 0.168 True ENSG00000230223 ENSG00000230223 HGNC:10561 13 70713486 70713560 70139354 70139428 CTG 50 80 SPD1 str HOXD13 Expert Review Green;Expert list Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Synpolydactyly 1 MIM#186000 8817328;33811808;33533119 False 3 100;0;0 0.168 True ENSG00000128714 ENSG00000128714 HGNC:5136 2 176957787 176957831 176093059 176093103 GCG 15 24 TOF str TBX1 Expert Review Green;Literature Repeat Disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Tetralogy of Fallot MIM#187500 19948535;11748311 False 3 100;0;0 0.168 True ENSG00000184058 ENSG00000184058 HGNC:11592 22 19754285 19754330 19766762 19766807 GCN 15 25 XDP str TAF1 Expert Review Green;Expert list Repeat Disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Dystonia-Parkinsonism, X-linked MIM#314250 17273961;29229810 False 3 100;0;0 0.168 True ENSG00000147133 ENSG00000147133 HGNC:11535 X 70672905 70672979 71453055 71453129 CCCTCT 13 30