Entity Name	Entity type	Gene Symbol	Sources(; separated)	Level4	Level3	Level2	Model_Of_Inheritance	Phenotypes	Omim	Orphanet	HPO	Publications	Description	Flagged	GEL_Status	UserRatings_Green_amber_red	version	ready	Mode of pathogenicity	EnsemblId(GRch37)	EnsemblId(GRch38)	HGNC	Position Chromosome	Position GRCh37 Start	Position GRCh37 End	Position GRCh38 Start	Position GRCh38 End	STR Repeated Sequence	STR Normal Repeats	STR Pathogenic Repeats	Region Haploinsufficiency Score	Region Triplosensitivity Score	Region Required Overlap Percentage	Region Variant Type	Region Verbose Name
BPES	str	FOXL2	Expert Review Green;Expert list	Repeat Disorders			BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Blepharophimosis, epicanthus inversus, and ptosis type 1 and 2 MIM#110100;Premature ovarian failure 3 MIM#608996				11468277;33811808		False	3	100;0;0	0.168	True		ENSG00000183770	ENSG00000183770	HGNC:1092	3	138664863	138664904	138946021	138946062	GCN	14	19					
CANVAS	str	RFC1	Expert Review Green;Expert list	Repeat Disorders			BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575				30926972;32851396;33237689;31230722		False	3	100;0;0	0.168	True		ENSG00000035928	ENSG00000035928	HGNC:9969	4	39350045	39350103	39348425	39348483	AAGGG	0	400					
CCHS	str	PHOX2B	Expert Review Green;Expert list	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Central hypoventilation syndrome, congenital, with or without Hirschsprung disease MIM#209880				12640453;34012823;20301600;18798833		False	3	100;0;0	0.168	True		ENSG00000109132	ENSG00000109132	HGNC:9143	4	41747989	41748048	41745972	41746031	GCN	20	25					
CJD	str	PRNP	Expert Review Green;Expert list	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440				2159587;20301407		False	3	100;0;0	0.168	True		ENSG00000171867	ENSG00000171867	HGNC:9449	20	4680026	4680073	4699380	4699427	GGTGGTGGCTGGGGGCAGCCTCAT	4	5					
DBQD2	str	XYLT1	Expert Review Green;Expert list	Repeat Disorders			BIALLELIC, autosomal or pseudoautosomal	Desbuquois dysplasia 2 MIM#615777				30554721		False	3	100;0;0	0.168	True		ENSG00000103489	ENSG00000103489	HGNC:15516	16	17564765	17564779	17470908	17470922	GGC	20	120					
DM1	str	DMPK	Expert Review Green;Expert list	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Myotonic dystrophy 1 MIM#160900				20301344;29325606;1546325		False	3	100;0;0	0.168	True		ENSG00000104936	ENSG00000104936	HGNC:2933	19	46273463	46273522	45770205	45770264	CTG	34	50					
DM2	str	CNBP	Expert Review Green;Expert list	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Myotonic dystrophy 2 MIM#602668				20301639;11486088		False	3	100;0;0	0.168	True		ENSG00000169714	ENSG00000169714	HGNC:13164	3	128891420	128891499	129172577	129172656	CCTG	26	75					
DRPLA	str	ATN1	Expert Review Green;Expert list	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dentatorubral-pallidoluysian atrophy MIM#125370				8136840;8136826;29325606;20301664		False	3	100;0;0	0.168	True		ENSG00000111676	ENSG00000111676	HGNC:3033	12	7045892	7045936	6936729	6936773	CAG	35	48					
EIEE1_tract1	str	ARX	Expert Review Green;Expert list	Repeat Disorders			X-LINKED: hemizygous mutation in males, biallelic mutations in females	Developmental and epileptic encephalopathy 1 MIM#308350;Intellectual disability, X-linked 29 and others MIM#300419;Partington syndrome MIM#309510				11889467;33811808		False	3	100;0;0	0.168	True		ENSG00000004848	ENSG00000004848	HGNC:18060	X	25031767	25031814	25013650	25013697	GCN	16	23					
EIEE1_tract2	str	ARX	Expert Review Green;Expert list	Repeat Disorders			X-LINKED: hemizygous mutation in males, biallelic mutations in females	Developmental and epileptic encephalopathy 1 MIM#308350;Intellectual disability, X-linked 29 and others MIM#300419;Partington syndrome MIM#309510				11889467;33811808		False	3	100;0;0	0.168	True		ENSG00000004848	ENSG00000004848	HGNC:18060	X	25031647	25031682	25013530	25013565	GCN	12	20					
EPM1	str	CSTB	Expert Review Green;Expert list	Repeat Disorders			BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800				29325606;20301321;9126745		False	3	100;0;0	0.168	True		ENSG00000160213	ENSG00000160213	HGNC:2482	21	45196325	45196360	43776444	43776479	CCCCGCCCCGCG	3	30					
FAME1	str	SAMD12	Expert Review Green;Expert list	Repeat Disorders			BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Epilepsy, familial adult myoclonic, 1 MIM#601068				30194086;29507423		False	3	100;0;0	0.168	True		ENSG00000177570	ENSG00000177570	HGNC:31750	8	119379055	119379157	118366816	118366918	TTTCA	0	100					
FAME2	str	STARD7	Expert Review Green;Literature	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epilepsy, familial adult myoclonic, 2 MIM#607876				31664034		False	3	100;0;0	0.168	True		ENSG00000084090	ENSG00000084090	HGNC:18063	2	96862805	96862859	96197067	96197121	ATTTC	0	661					
FAME3	str	MARCH6	Expert Review Green;Literature	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epilepsy, familial adult myoclonic, 3 MIM#613608				31664039		False	3	100;0;0	0.168	True		ENSG00000145495	ENSG00000145495	HGNC:30550	5	10356451	10356519	10356347	10356411	TTTCA	0	660					
FECD3	str	TCF4	Expert Review Green;Expert list	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Corneal dystrophy, Fuchs endothelial, 3 MIM#613267				25722209;24255041		False	3	100;0;0	0.168	True		ENSG00000196628	ENSG00000196628	HGNC:11634	18	53253387	53253458	55586156	55586227	CTG	31	51					
FRAXE	str	AFF2	Expert Review Green;Expert list	Repeat Disorders			X-LINKED: hemizygous mutation in males, biallelic mutations in females	Intellectual developmental disorder, X-linked 109 MIM#309548				8334699;8673085;11388762		False	3	100;0;0	0.168	True		ENSG00000155966	ENSG00000155966	HGNC:3776	X	147582158	147582202	148500638	148500682	GCC	44	200					
FRDA	str	FXN	Expert Review Green;Expert list	Repeat Disorders			BIALLELIC, autosomal or pseudoautosomal	Friedreich ataxia MIM#229300				20301458;8596916		False	3	100;0;0	0.168	True		ENSG00000165060	ENSG00000165060	HGNC:3951	9	71652203	71652220	69037287	69037304	GAA	33	66					
FTDALS	str	C9orf72	Expert Review Green;Expert list	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550				25577942;21944779;21944778		False	3	100;0;0	0.168	True		ENSG00000147894	ENSG00000147894	HGNC:28337	9	27573427	27573544	27573529	27573546	GGGGCC	25	60					
FXPOI	str	FMR1	Expert Review Green;Expert list	Repeat Disorders			X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Premature ovarian failure 1 MIM#311360				20301558;9647544		False	3	100;0;0	0.168	True		ENSG00000102081	ENSG00000102081	HGNC:3775	X	146993569	146993628	147912051	147912110	CGG	44	55					
FXS	str	FMR1	Expert Review Green;Expert list	Repeat Disorders			X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	"Fragile X syndrome	MIM#300624"				33795824;25227148;1710175;2031184		False	3	100;0;0	0.168	True		ENSG00000102081	ENSG00000102081	HGNC:3775	X	146993569	146993628	147912051	147912110	CGG	44	200					
FXTAS	str	FMR1	Expert Review Green;Expert list	Repeat Disorders			X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Fragile X tremor/ataxia syndrome MIM#300623				23765048;25227148;11445641		False	3	100;0;0	0.168	True		ENSG00000102081	ENSG00000102081	HGNC:3775	X	146993569	146993628	147912051	147912110	CGG	44	55					
GDPAG	str	GLS	Expert Review Green;Literature	Repeat Disorders			BIALLELIC, autosomal or pseudoautosomal	Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412				30970188		False	3	100;0;0	0.168	True		ENSG00000115419	ENSG00000115419	HGNC:4331	2	191745599	191745646	190880873	190880920	GCA	16	400					
HD	str	HTT	Expert Review Green;Expert list	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Huntington disease MIM#143100				8458085;20301482;29325606		False	3	100;0;0	0.168	True		ENSG00000197386	ENSG00000197386	HGNC:4851	4	3076604	3076666	3074877	3074939	CAG	26	40					
HDL2	str	JPH3	Expert Review Green;Expert list	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Huntington disease-like 2 MIM#606438				11558794;20301701		False	3	100;0;0	0.168	True		ENSG00000154118	ENSG00000154118	HGNC:14203	16	87637894	87637935	87604288	87604329	CTG	28	40					
HFGS_tract1	str	HOXA13	Expert Review Green;Expert list	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hand-foot-uterus syndrome MIM#140000				10839976;12073020;33811808		False	3	100;0;0	0.168	True		ENSG00000106031	ENSG00000106031	HGNC:5102	7	27239538	27239585	27199919	27199966	GCN	16	22					
HFGS_tract2	str	HOXA13	Expert Review Green;Expert list	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hand-foot-uterus syndrome MIM#140000				10839976;12073020;33811808		False	3	100;0;0	0.168	True		ENSG00000106031	ENSG00000106031	HGNC:5102	7	27239445	27239480	27199826	27199861	GCN	12	18					
HFGS_tract3	str	HOXA13	Expert Review Green;Expert list	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hand-foot-uterus syndrome MIM#140000				10839976;12073020;33811808		False	3	100;0;0	0.168	True		ENSG00000106031	ENSG00000106031	HGNC:5102	7	27239298	27239351	27199679	27199732	GCN	18	24					
HMNMYO	str	VWA1	Expert Review Green;Literature	Repeat Disorders			BIALLELIC, autosomal or pseudoautosomal	"Neuropathy, hereditary motor, with myopathic features	MIM#619216"				33559681;33459760		False	3	100;0;0	0.168	True		ENSG00000179403	ENSG00000179403	HGNC:30910	1	1371179	1371198	1435799	1435818	GCGCGGAGCG	2	3					
HPE5	str	ZIC2	Expert Review Green;Expert list	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Holoprosencephaly 5 MIM#609637				11285244;33811808		False	3	100;0;0	0.168	True		ENSG00000043355	ENSG00000043355	HGNC:12873	13	100637703	100637747	99985449	99985493	GCN	15	25					
HSAN8	str	PRDM12	Expert Review Green;Literature	Repeat Disorders			BIALLELIC, autosomal or pseudoautosomal	Neuropathy, hereditary sensory and autonomic, type VIII MIM#616488				26005867		False	3	100;0;0	0.168	True		ENSG00000130711	ENSG00000130711	HGNC:13997	9	133556993	133557026	130681606	130681639	GCC	14	18					
MEDPSACH	str	COMP	Expert Review Green;Literature	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epiphyseal dysplasia, multiple, 1 MIM#132400;Pseudoachondroplasia MIM#177170				9887340;17133256;21922596		False	3	100;0;0	0.168	True		ENSG00000105664	ENSG00000105664	HGNC:2227	19	18896844	18896859	18786034	18786049	GAC	5	6					
MRUPAV	str	PLIN4	Expert Review Green;Literature	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	myopathy, distal, with rimmed vacuoles MONDO:0014945				32451610;37145156;36151849;35499779		False	3	100;0;0	0.168	True		ENSG00000167676	ENSG00000167676	HGNC:29393	19	4510975	4511073	4510963	4511061	ACTGAAGACAGTGTCCTTGGTACCCATAAGCACAGCCTTGGAGGCGTCCACGCCGGTCTGCACGGTTCCTTTGGCCACATTCACTGCCCCCGTGACTCC	31	39					
NIID	str	NOTCH2NL	Expert Review Green;Expert list	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neuronal intranuclear inclusion disease MIM#603472;Oculopharyngodistal myopathy 3 MIM#619473;Tremor, hereditary essential, 6 MIM#618866				31178126;31332381;31819945;33887199;33943039;32250060;31332380;32852534;32989102;34333668		False	3	100;0;0	0.168	True		ENSG00000213240	ENSG00000264343	HGNC:31862	1	145209324	145209344	149390803	149390829	GGC	40	60					
OPDM1	str	LRP12	Expert Review Green;Expert list	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Oculopharyngodistal myopathy 1 MIM#164310;Amyotrophic lateral sclerosis MONDO:0004976				31332380;34047774;37339631		False	3	100;0;0	0.168	True		ENSG00000147650	ENSG00000147650	HGNC:31708	8	105601201	105601227	104588973	104588999	CGG	45	85					
OPDM2	str	GIPC1	Expert Review Green;Expert list	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Oculopharyngodistal myopathy 2 MIM#618940				32413282;33374016		False	3	100;0;0	0.168	True		ENSG00000123159	ENSG00000123159	HGNC:1226	19	14606854	14606886	14496042	14496074	CGG	32	70					
OPDM4	str	RILPL1	Expert Review Green;Literature	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Oculopharyngodistal myopathy MONDO:0025193				35148830;35700120		False	3	100;0;0	0.168	True		ENSG00000188026	ENSG00000188026	HGNC:26814	12	124018270	124018296	123533723	123533749	CGG	16	139					
OPDM_ABCD3_GCC	str	ABCD3	Expert Review Green;Other	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Oculopharyngodistal myopathy MONDO:0025193				https://doi.org/10.1101/2023.10.09.23296582		False	3	100;0;0	0.168	True		ENSG00000117528	ENSG00000117528	HGNC:67	1	94883977	94883998	94418421	94418442	GCC	50	118					
OPMD	str	PABPN1	Expert Review Green;Expert list	Repeat Disorders			BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Oculopharyngeal muscular dystrophy MIM#164300				9462747;20301305		False	3	100;0;0	0.168	False		ENSG00000100836	ENSG00000100836	HGNC:8565	14	23790682	23790711	23321473	23321502	GCN	10	11					
PHPX	str	SOX3	Expert Review Green;Expert list	Repeat Disorders			X-LINKED: hemizygous mutation in males, biallelic mutations in females	Intellectual disability, X-linked, with isolated growth hormone deficiency MIM#300123;Panhypopituitarism, X-linked MIM#312000				12428212;15800844;33811808;23505376;19654509		False	3	100;0;0	0.168	True		ENSG00000134595	ENSG00000134595	HGNC:11199	X	139586482	139586526	140504317	140504361	GCN	15	22					
RCPS	str	EIF4A3	Expert Review Green;Literature	Repeat Disorders			BIALLELIC, autosomal or pseudoautosomal	Robin sequence with cleft mandible and limb anomalies MIM#268305;Richieri-Costa-Pereira syndrome				24360810;29112243		False	3	100;0;0	0.168	True		ENSG00000141543	ENSG00000141543	HGNC:18683	17	78120803	78120938	80147004	80147139	TCGGCAGCGGCGCAGCGAGG	12	14					
SBMA	str	AR	Expert Review Green;Expert list	Repeat Disorders			X-LINKED: hemizygous mutation in males, biallelic mutations in females	Spinal and bulbar muscular atrophy of Kennedy MIM#313200				2062380;20301508;29325606		False	3	100;0;0	0.168	True		ENSG00000169083	ENSG00000169083	HGNC:644	X	66765160	66765225	67545318	67545383	CAG	34	38					
SCA1	str	ATXN1	Expert Review Green;Expert list	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 1 MIM#164400				8358429;29325606;20301363		False	3	100;0;0	0.168	True		ENSG00000124788	ENSG00000124788	HGNC:10548	6	16327918	16327953	16327687	16327722	CAG	35	39					
SCA10	str	ATXN10	Expert Review Green;Expert list	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 10 MIM#603516				20301354;11017075		False	3	100;0;0	0.168	True		ENSG00000130638	ENSG00000130638	HGNC:10549	22	46191235	46191304	45795355	45795424	ATTCT	32	800					
SCA12	str	PPP2R2B	Expert Review Green;Expert list	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 12 MIM#604326				27864267;33811808;10581021		False	3	100;0;0	0.168	True		ENSG00000156475	ENSG00000156475	HGNC:9305	5	146258292	146258321	146878729	146878758	CAG	32	51					
SCA17	str	TBP	Expert Review Green;Expert list	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 17 MIM#607136				10484774;20301611;29325606		False	3	100;0;0	0.168	True		ENSG00000112592	ENSG00000112592	HGNC:11588	6	170870996	170871109	170561908	170562021	CAG	40	49					
SCA2	str	ATXN2	Expert Review Green;Expert list	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 2 MIM#183090				8896555;29325606;20301452		False	3	100;0;0	0.168	True		ENSG00000204842	ENSG00000204842	HGNC:10555	12	112036755	112036823	111598951	111599019	CAG	31	35					
SCA27B	str	FGF14	Expert Review Green;Literature	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia type 27B MONDO:0012247;Spinocerebellar ataxia 50;late-onset cerebellar ataxias (LOCAs)				37165652;36516086;36493768		False	3	100;0;0	0.168	True		ENSG00000102466	ENSG00000102466	HGNC:3671	13	102813926	102814076	102161576	102161726	GAA	249	300					
SCA3	str	ATXN3	Expert Review Green;Expert list	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Machado-Joseph disease MIM#109150;Spinocerebellar ataxia type 3				7874163;20301375;29325606		False	3	100;0;0	0.168	True		ENSG00000066427	ENSG00000066427	HGNC:7106	14	92537355	92537396	92071011	92071052	CAG	44	60					
SCA31	str	BEAN1	Expert Review Green;Expert list	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 31 MIM#117210				19878914;31755042		False	3	100;0;0	0.168	True		ENSG00000166546	ENSG00000166546	HGNC:24160	16	66524301	66524302	66490398	66490399	TGGAA	22	80					
SCA36	str	NOP56	Expert Review Green;Expert list	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 36 MIM#614153				21683323		False	3	100;0;0	0.168	True		ENSG00000101361	ENSG00000101361	HGNC:15911	20	2633380	2633403	2652734	2652757	GGCCTG	14	650					
SCA37	str	DAB1	Expert Review Green;Expert list	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 37 MIM#615945				28686858;31145571		False	3	100;0;0	0.168	True		ENSG00000173406	ENSG00000173406	HGNC:2661	1	57832716	57832797	57367044	57367121	ATTTC	0	31					
SCA4_ZFHX3_GGC	str	ZFHX3	Expert Review Green;Literature	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	spinocerebellar ataxia type 4 MONDO:0010847				38035881;38197134		False	3	100;0;0	0.168	True		ENSG00000140836	ENSG00000140836	HGNC:777	16	72821594	72821657	72787695	72787758	GGC	30	48					
SCA6	str	CACNA1A	Expert Review Green;Expert list	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 6 MIM#183086;Episodic ataxia, type 2 MIM#108500				8988170;20301319;29325606		False	3	100;0;0	0.168	True		ENSG00000141837	ENSG00000141837	HGNC:1388	19	13318673	13318691	13207859	13207897	CAG	18	20					
SCA7	str	ATXN7	Expert Review Green;Expert list	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 7 MIM#164500				8908515;29325606;20301433		False	3	100;0;0	0.168	True		ENSG00000163635	ENSG00000163635	HGNC:10560	3	63898362	63898391	63912686	63912715	CAG	27	37					
SCA8	str	ATXN8OS	Expert Review Green;Expert list	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 8 MIM#608768				20301445;10192387		False	3	100;0;0	0.168	True		ENSG00000230223	ENSG00000230223	HGNC:10561	13	70713486	70713560	70139354	70139428	CTG	50	80					
SPD1	str	HOXD13	Expert Review Green;Expert list	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Synpolydactyly 1 MIM#186000				8817328;33811808;33533119		False	3	100;0;0	0.168	True		ENSG00000128714	ENSG00000128714	HGNC:5136	2	176957787	176957831	176093059	176093103	GCG	15	24					
TOF	str	TBX1	Expert Review Green;Literature	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Tetralogy of Fallot MIM#187500				19948535;11748311		False	3	100;0;0	0.168	True		ENSG00000184058	ENSG00000184058	HGNC:11592	22	19754285	19754330	19766762	19766807	GCN	15	25					
XDP	str	TAF1	Expert Review Green;Expert list	Repeat Disorders			X-LINKED: hemizygous mutation in males, biallelic mutations in females	Dystonia-Parkinsonism, X-linked MIM#314250				17273961;29229810		False	3	100;0;0	0.168	True		ENSG00000147133	ENSG00000147133	HGNC:11535	X	70672905	70672979	71453055	71453129	CCCTCT	13	30					
CANVAS_ACAGG	str	RFC1	Expert Review Amber;Literature	Repeat Disorders			BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome;fasciculations;elevated serum creatine kinase levels;denervation				33237689;32694621;33103729		False	2	0;100;0	0.168	True		ENSG00000035928	ENSG00000035928	HGNC:9969	4	39350045	39350103	39348425	39348483	ACAGG	0	400					
CCD	str	RUNX2	Expert Review Amber;Expert list	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cleidocranial dysplasia MIM#119600				9182765;33811808;20560987;26220009;25852448		False	2	0;100;0	0.168	True		ENSG00000124813	ENSG00000124813	HGNC:10472	6	45390488	45390538	45422751	45422801	GCN	18	20					
DMD	str	DMD	Expert Review Amber;Literature	Repeat Disorders			X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Duchenne muscular dystrophy MIM#310200;Becker muscular dystrophy MIM#300376				27417533;36048237		False	2	0;100;0	0.168	True		ENSG00000198947	ENSG00000198947	HGNC:2928	X	31302674	31302722	31284557	31284605	GAA	33	59					
FAME7	str	RAPGEF2	Expert Review Amber;Literature	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epilepsy, familial adult myoclonic, 7 MIM#618075				29507423;30351492;33791773		False	2	0;100;0	0.168	True		ENSG00000109756	ENSG00000109756	HGNC:16854	4	160263679	160263768	159342527	159342616	TTTCA	0	1					
FRA12A	str	DIP2B	Expert Review Amber;Literature	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, FRA12A type MIM#136630				17236128		False	2	0;100;0	0.168	True		ENSG00000066084	ENSG00000066084	HGNC:29284	12	50898787	50898807	50505004	50505024	CGG	23	280					
FRA2A	str	AFF3	Expert Review Amber;Literature	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental delay				24763282		False	2	0;100;0	0.168	True		ENSG00000144218	ENSG00000144218	HGNC:6473	2	100721262	100721285	100104800	100104823	CGG	20	300					
FRA7A	str	ZNF713	Expert Review Amber;Literature	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Autism spectrum disorder				25196122		False	2	0;100;0	0.168	True		ENSG00000178665	ENSG00000178665	HGNC:22043	7	55955295	55955330	55887602	55887637	CGG	22	450					
SCA_THAP11_CAG	str	THAP11	Expert Review Amber;Other	Repeat Disorders			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Spinocerebellar ataxia 51, MIM#	620947"				15368101;24677642;34165550;38113319		False	2	0;100;0	0.168	True		ENSG00000168286	ENSG00000168286	HGNC:23194	16	67876766	67876853	67842863	67842950	CAG	39	47					
