Entity Name Entity type Gene Symbol Sources(; separated) Level4 Level3 Level2 Model_Of_Inheritance Phenotypes Omim Orphanet HPO Publications Description Flagged GEL_Status UserRatings_Green_amber_red version ready Mode of pathogenicity EnsemblId(GRch37) EnsemblId(GRch38) HGNC Position Chromosome Position GRCh37 Start Position GRCh37 End Position GRCh38 Start Position GRCh38 End STR Repeated Sequence STR Normal Repeats STR Pathogenic Repeats Region Haploinsufficiency Score Region Triplosensitivity Score Region Required Overlap Percentage Region Variant Type Region Verbose Name AAAS gene AAAS Expert list;Expert Review Green;Royal Melbourne Hospital;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Triple A syndrome, 231550;Achalasia-addisonianism-alacrimia syndrome, 231550 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 True ENSG00000094914 ENSG00000094914 HGNC:13666 ABCD1 gene ABCD1 Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) spastic paraparesis;Hereditary spastic paraplegia;Adrenoleukodystrophy, 300100;VLCFA accumulation;adrenal failure Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 True ENSG00000101986 ENSG00000101986 HGNC:61 ABCD1 gene ABCD1 Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Adrenoleukodystrophy Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 True ENSG00000101986 ENSG00000101986 HGNC:61 ABHD12 gene ABHD12 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polyneuropathy, Hearing Loss, Ataxia, Retinitis Pigmentosa and Cataract (PHARC);Polyneuropathy, hearing loss, ataxia, retinitis pigmentosa and cataract, 612674;Polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and cataract Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000100997 ENSG00000100997 HGNC:15868 ADAR gene ADAR Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 6;neuroinflammatory disorder with cerebral calcification;progressive loss of cognition;spasticity;dystonia;parkinsonism;OMIM 615010 Neurodegeneration;HP:0002180 PMID: 32911246 False 3 100;0;0 6.47 True ENSG00000160710 ENSG00000160710 HGNC:225 AFG3L2 gene AFG3L2 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Ataxia, spastic, 5, autosomal recessive;spastic ataxia 5, 614487;Spinocerebellar ataxia 28;Spinocerebellar ataxia 28, 610246;Spinocerebellar Ataxia, Dominant Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000141385 ENSG00000141385 HGNC:315 ALDH18A1 gene ALDH18A1 Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 9B, autosomal recessive, MIM# 616586;Spastic paraplegia 9A, autosomal dominant, MIM# 601162 Neurodegeneration;HP:0002180 26026163;29915212 False 3 100;0;0 6.47 True ENSG00000059573 ENSG00000059573 HGNC:9722 ALS2 gene ALS2 Expert Review Green;Literature;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Amyotrophic lateral sclerosis 2, juvenile (MIM# 205100;MONDO: MONDO:0008780) Neurodegeneration;HP:0002180 24562058;11586298 False 3 100;0;0 6.47 True ENSG00000003393 ENSG00000003393 HGNC:443 ANO10 gene ANO10 Expert list;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia autosomal recessive type 10, 613728;Spinocerebellar ataxia, autosomal recessive 10 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000160746 ENSG00000160746 HGNC:25519 ANXA11 gene ANXA11 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted amyotrophic lateral sclerosis type 23 MONDO:0027694 Neurodegeneration;HP:0002180 36458208;39755715;38896345;38896262 False 3 100;0;0 6.47 True Other ENSG00000122359 ENSG00000122359 HGNC:535 ANXA11 gene ANXA11 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amytrophic lateral sclerosis 23 MIM#617839 Neurodegeneration;HP:0002180 28469040;29845112;30109997 False 3 100;0;0 6.47 False ENSG00000122359 ENSG00000122359 HGNC:535 AP5Z1 gene AP5Z1 Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 48, autosomal recessive, MIM# 613647;MONDO:0013342 Neurodegeneration;HP:0002180 26085577;33543803;27606357 False 3 100;0;0 6.47 True ENSG00000242802 ENSG00000242802 HGNC:22197 APP gene APP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alzheimer disease MONDO:0007088 Neurodegeneration;HP:0002180 20301340;1671712;1678058;1908231;1302033 False 3 100;0;0 6.47 True Other ENSG00000142192 ENSG00000142192 HGNC:620 ARSA gene ARSA Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Metachromatic leukodystrophy, MIM# 250100, adult-onset Neurodegeneration;HP:0002180 29486463;26890752;15710861 False 3 100;0;0 6.47 True ENSG00000100299 ENSG00000100299 HGNC:713 ASCC1 gene ASCC1 Expert Review Green;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal spinal muscular atrophy with congenital bone fractures 2 (MONDO:0014807;MIM#616867) Neurodegeneration;HP:0002180 26924529;28218388 False 3 100;0;0 6.47 True ENSG00000138303 ENSG00000138303 HGNC:24268 ATL1 gene ATL1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 3A, autosomal dominant MIM#182600 Neurodegeneration;HP:0002180 16765570 False 3 100;0;0 6.47 False ENSG00000198513 ENSG00000198513 HGNC:11231 ATL1 gene ATL1 Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 3A, MIM 182600;Hereditary spastic paraplegia, AR Neurodegeneration;HP:0002180 16401858;16537571;17657515;28396731;24473461;26888483 False 3 100;0;0 6.47 True ENSG00000198513 ENSG00000198513 HGNC:11231 ATM gene ATM Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia-telangiectasia, 607585;Ataxia-Telangiectasia Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000149311 ENSG00000149311 HGNC:795 ATP13A2 gene ATP13A2 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Kufor-Rakeb syndrome MIM#606693 Neurodegeneration;HP:0002180 21362476;21696388;31588715;32559632;33033738;33091395;34405108 False 3 100;0;0 6.47 True ENSG00000159363 ENSG00000159363 HGNC:30213 ATP13A2 gene ATP13A2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Kufor-Rakeb syndrome, MIM# 606693 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 True ENSG00000159363 ENSG00000159363 HGNC:30213 ATP13A2 gene ATP13A2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal parkinsonism due to ATP13A2 deficiency MONDO:0017809 Neurodegeneration;HP:0002180 25900096;20301402 False 3 100;0;0 6.47 True ENSG00000159363 ENSG00000159363 HGNC:30213 ATP13A2 gene ATP13A2 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 78, autosomal recessive, 617225;Kufor-Rakeb syndrome, 606693 AR;complicated hereditary spastic paraplegia;Adult-onset lower-limb predominant spastic paraparesis Neurodegeneration;HP:0002180 27217339;28137957 False 3 100;0;0 6.47 True ENSG00000159363 ENSG00000159363 HGNC:30213 ATP1A3 gene ATP1A3 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted CAPOS syndrome, 601338;Cerebellar ataxia, areflexia, pes cavus, optic atrophy and sensorineural hearing loss (CAPOS, #601338);Dystonia-12, 128235;Alternating hemiplegia of childhood 2, 614820;DYSTONIA 12, 128235;ALTERNATING HEMIPLEGIA OF CHILDHOOD 2, 614820;Alternating hemiplegia of childhood 2 (#614820) and Dystonia 12 (#128235) Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000105409 ENSG00000105409 HGNC:801 ATP1A3 gene ATP1A3 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ATP1A3-associated neurological disorder MONDO:0700002 Neurodegeneration;HP:0002180 20301294;17282997;15260953;17595045;17516473;22534615 False 3 100;0;0 6.47 True ENSG00000105409 ENSG00000105409 HGNC:801 ATP6AP2 gene ATP6AP2 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females "Parkinsonism with spasticity, X-linked, MIM# 300911" Neurodegeneration;HP:0002180 30985297;23595882 False 3 100;0;0 6.47 True ENSG00000182220 ENSG00000182220 HGNC:18305 ATP7B gene ATP7B Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Wilson disease MIM#277900 Neurodegeneration;HP:0002180 17435591 False 3 50;50;0 6.47 True ENSG00000123191 ENSG00000123191 HGNC:870 B4GALNT1 gene B4GALNT1 Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 26, autosomal recessive, 609195 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 True ENSG00000135454 ENSG00000135454 HGNC:4117 BSCL2 gene BSCL2 Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Silver spastic paraplegia syndrome, 270685;HSP 17, MONDO:0010043 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 True ENSG00000168000 ENSG00000168000 HGNC:15832 BSCL2 gene BSCL2 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Silver spastic paraplegia syndrome MIM#270685;Neuropathy, distal hereditary motor, type VA MIM#600794 Neurodegeneration;HP:0002180 16765570 False 3 100;0;0 6.47 False ENSG00000168000 ENSG00000168000 HGNC:15832 C19orf12 gene C19orf12 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodegeneration with brain iron accumulation 4, MIM# 614298 Neurodegeneration;HP:0002180 23278385;21981780;23269600 False 3 100;0;0 6.47 True ENSG00000131943 ENSG00000131943 HGNC:25443 C19orf12 gene C19orf12 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Neurodegeneration with brain iron accumulation 4, MIM# 614298;Spastic paraplegia 43, autosomal recessive, MIM# 615043" Neurodegeneration;HP:0002180 20039086;21981780;23269600;31087512 False 3 100;0;0 6.47 True ENSG00000131943 ENSG00000131943 HGNC:25443 C19orf12 gene C19orf12 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted neurodegeneration with brain iron accumulation 4 MONDO:0013674 Neurodegeneration;HP:0002180 21981780;23278385;23447832 False 3 100;0;0 6.47 True ENSG00000131943 ENSG00000131943 HGNC:25443 C9orf3 gene C9orf3 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia 31, MIM# 619565;Childhood/Adolescence onset generalised dystonia;Dystonia parkinsonism;Zech-Boesch Syndrome Neurodegeneration;HP:0002180 PMID: 35306330 False 3 100;0;0 6.47 True ENSG00000148120 ENSG00000148120 HGNC:1361 CACNA1A gene CACNA1A Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 6;familial hemiplegic migraine type 1, 141500;Familial hemiplegic migraine 1, 141500;SCA6, 183086;episodic ataxia type 2 (EA2),108500;Episodic ataxia type 2, 108500;Migraine, familial hemiplegic, 1, with progressive cerebellar ataxia;Episodic ataxia, type 2 Neurodegeneration;HP:0002180 False 3 0;100;0 6.47 False ENSG00000141837 ENSG00000141837 HGNC:1388 CACNA1G gene CACNA1G Expert Review Green;Expert list;Expert Review Green;Royal Melbourne Hospital;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown early-onset SCA42 with neurodevelopmental deficits, 618087;Spinocerebellar ataxia 42, 616795 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 True ENSG00000006283 ENSG00000006283 HGNC:1394 CAPN1 gene CAPN1 Expert Review Green;Expert list;Expert Review Amber;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 76, autosomal recessive, 616907;MONDO:0014827 Neurodegeneration;HP:0002180 27320912;29678961;30572172;31023339;31104286 False 3 50;50;0 6.47 True ENSG00000014216 ENSG00000014216 HGNC:1476 CAPN1 gene CAPN1 Expert Review Green;Royal Melbourne Hospital;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 76 autosomal recessive, 616907;MONDO:0014827 Neurodegeneration;HP:0002180 27153400 False 3 100;0;0 6.47 True ENSG00000014216 ENSG00000014216 HGNC:1476 CHCHD10 gene CHCHD10 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 2, MIM# 615911 Neurodegeneration;HP:0002180 24934289;31690696;30877432;32369233;28069311 False 3 100;0;0 6.47 True ENSG00000250479 ENSG00000250479 HGNC:15559 CHCHD10 gene CHCHD10 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000250479 ENSG00000250479 HGNC:15559 CHCHD2 gene CHCHD2 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Parkinson disease 22, autosomal dominant MIM#616710 Neurodegeneration;HP:0002180 32068847;25662902;31600778;26705026 False 3 100;0;0 6.47 False ENSG00000106153 ENSG00000106153 HGNC:21645 CHMP2B gene CHMP2B Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 7 (MIM#600795;MONDO:0010936) Neurodegeneration;HP:0002180 20301378;16041373 False 3 100;0;0 6.47 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000083937 ENSG00000083937 HGNC:24537 CHMP2B gene CHMP2B Expert Review Green;Royal Melbourne Hospital;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 7 (MIM#600795, MONDO:0010936) Neurodegeneration;HP:0002180 20301378;16041373 False 3 100;0;0 6.47 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000083937 ENSG00000083937 HGNC:24537 CLCN2 gene CLCN2 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal {Epilepsy, juvenile absence, susceptibility to, 2}, 607628;Leukoencephalopathy with ataxia, 615651;{Epilepsy, juvenile myoclonic, susceptibility to, 8}, 607628;{Epilepsy, idiopathic generalized, susceptibility to, 11}, 607628 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000114859 ENSG00000114859 HGNC:2020 CLN3 gene CLN3 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 3 MIM#204200 Neurodegeneration;HP:0002180 19489875;11342698 False 3 100;0;0 6.47 True ENSG00000188603 ENSG00000188603 HGNC:2074 CLN6 gene CLN6 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, Kufs type, adult onset MIM#204300 Neurodegeneration;HP:0002180 30561534 False 3 100;0;0 6.47 True ENSG00000128973 ENSG00000128973 HGNC:2077 COA7 gene COA7 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia with axonal neuropathy Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000162377 ENSG00000162377 HGNC:25716 COL4A1 gene COL4A1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Brain small vessel disease 1 with or without ocular anomalies MONDO:0008289;Microangiopathy and leukoencephalopathy, pontine, autosomal dominant MONDO:0032814" Neurodegeneration;HP:0002180 35699195;37272523;36300346;30413629 False 3 100;0;0 6.47 True ENSG00000187498 ENSG00000187498 HGNC:2202 COQ4 gene COQ4 Expert Review Green;Expert Review Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 10, autosomal recessive, MIM# 620666 Neurodegeneration;HP:0002180 36047608;38014483;38013626 False 3 100;0;0 6.47 True ENSG00000167113 ENSG00000167113 HGNC:19693 CP gene CP Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hemosiderosis, systemic, due to aceruloplasminemia MIM#604290 Neurodegeneration;HP:0002180 7539672;https://doi.org/10.1093/qjmed/89.5.355;28874056;28012953 False 3 100;0;0 6.47 False ENSG00000047457 ENSG00000047457 HGNC:2295 CP gene CP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aceruloplasminaemia, MIM#604290 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 True ENSG00000047457 ENSG00000047457 HGNC:2295 CP gene CP Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aceruloplasminemia, 604290;Cerebellar ataxia, 604290;Hemosiderosis, systemic, due to aceruloplasminemia, 604290 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000047457 ENSG00000047457 HGNC:2295 CPT1C gene CPT1C Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 73, autosomal dominant, MIM#616282;MONDO:0014568 Neurodegeneration;HP:0002180 25751282;30911584;30564185;23973755 False 3 100;0;0 6.47 True ENSG00000169169 ENSG00000169169 HGNC:18540 CSF1R gene CSF1R Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000182578 ENSG00000182578 HGNC:2433 CSF1R gene CSF1R Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Leukoencephalopathy, diffuse hereditary, with spheroids MIM#221820;ataxia Neurodegeneration;HP:0002180 24198292;25563800;25935893 False 3 100;0;0 6.47 True ENSG00000182578 ENSG00000182578 HGNC:2433 CSF1R gene CSF1R Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted leukoencephalopathy, diffuse hereditary, with spheroids 1 MONDO:0800027 Neurodegeneration;HP:0002180 25935893;22934315;22934315 False 3 100;0;0 6.47 True ENSG00000182578 ENSG00000182578 HGNC:2433 CST3 gene CST3 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cerebral amyloid angiopathy MIM#105150;leukodystrophy MONDO:0019046 Neurodegeneration;HP:0002180 22435454;8866434;2602413;8108423;38489591 False 3 50;50;0 6.47 True Other ENSG00000101439 ENSG00000101439 HGNC:2475 CTSF gene CTSF Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Ceroid lipofuscinosis, neuronal, 13, Kufs type 615362" Neurodegeneration;HP:0002180 PMID: 28749476;27668283;27524508 False 3 100;0;0 6.47 True ENSG00000174080 ENSG00000174080 HGNC:2531 CYP27A1 gene CYP27A1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebrotendinous xanthomatosis, MIM# 213700 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 True ENSG00000135929 ENSG00000135929 HGNC:2605 CYP27A1 gene CYP27A1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Cerebrotendinous xanthomatosis, MIM# 213700;Cerebrotendinous xanthomatosis, infantile-onset diarrhoea, juvenile-onset cataract, young adult-onset tendon xanthomas;Epilepsy;Parkinsonism;Ataxia;Peripheral neuropathy" Neurodegeneration;HP:0002180 PMID: 30054180 False 3 100;0;0 6.47 True ENSG00000135929 ENSG00000135929 HGNC:2605 CYP27A1 gene CYP27A1 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebrotendinous xanthomatosis, 213700;MONDO:0008948;progressive lower extremity spasticity,often disproportionate to any degree of weakness Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 True ENSG00000135929 ENSG00000135929 HGNC:2605 CYP7B1 gene CYP7B1 Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 5A, autosomal recessive, 270800;MONDO:0010047 Neurodegeneration;HP:0002180 19439420;18252231 False 3 100;0;0 6.47 True ENSG00000172817 ENSG00000172817 HGNC:2652 DARS gene DARS Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Brain stem and spinal cord Hypomyelination;leg spasticity;Hypomyelination with brainstem and spinal cord involvement and leg spasticity, 615281 Neurodegeneration;HP:0002180 25527264;23643384 False 3 100;0;0 6.47 True ENSG00000115866 ENSG00000115866 HGNC:2678 DCTN1 gene DCTN1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Perry syndrome MONDO:0008201 Neurodegeneration;HP:0002180 20945553 False 3 100;0;0 6.47 True ENSG00000204843 ENSG00000204843 HGNC:2711 DCTN1 gene DCTN1 Expert Review Green;Expert Review Amber;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000204843 ENSG00000204843 HGNC:2711 DCTN1 gene DCTN1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Perry syndrome, MIM# 168605 Neurodegeneration;HP:0002180 19136952 False 3 100;0;0 6.47 True ENSG00000204843 ENSG00000204843 HGNC:2711 DDHD1 gene DDHD1 Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 28, autosomal recessive, 609340;MONDO:0012256 Neurodegeneration;HP:0002180 23176821 False 3 100;0;0 6.47 True ENSG00000100523 ENSG00000100523 HGNC:19714 DDHD2 gene DDHD2 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 54, autosomal recessive, MIM# 615033;MONDO:0014018 Neurodegeneration;HP:0002180 23486545;24482476;23176823;31302745 False 3 100;0;0 6.47 True ENSG00000085788 ENSG00000085788 HGNC:29106 DNAJB2 gene DNAJB2 Expert Review Green;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuronopathy, distal hereditary motor, autosomal recessive 5 (MIM#614881) Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 True ENSG00000135924 ENSG00000135924 HGNC:5228 DNAJC12 gene DNAJC12 Expert Review Green;Expert Review Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperphenylalaninemia, mild, non-BH4-deficient, MIM#617384 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 True ENSG00000108176 ENSG00000108176 HGNC:28908 DNAJC5 gene DNAJC5 Royal Melbourne Hospital;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ceroid lipofuscinosis, neuronal, 4, Parry type 162350;Ceroid neuronal lipofuscinosis 4, Parry type, 162350 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000101152 ENSG00000101152 HGNC:16235 DNAJC5 gene DNAJC5 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ceroid lipofuscinosis, neuronal, 4, Parry type, MIM# 162350 Neurodegeneration;HP:0002180 22978711;21820099;22235333 False 3 100;0;0 6.47 True ENSG00000101152 ENSG00000101152 HGNC:16235 DNAJC5 gene DNAJC5 Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000101152 ENSG00000101152 HGNC:16235 DNAJC6 gene DNAJC6 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal juvenile onset Parkinson disease 19A MONDO:0014231 Neurodegeneration;HP:0002180 33983693 False 3 100;0;0 6.47 True ENSG00000116675 ENSG00000116675 HGNC:15469 DNMT1 gene DNMT1 Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Neurodegeneration;HP:0002180 False 3 0;100;0 6.47 False ENSG00000130816 ENSG00000130816 HGNC:2976 DNMT1 gene DNMT1 Royal Melbourne Hospital;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cerebellar ataxia, deafness and narcolepsy, 604121;Cerebellar ataxia, deafness, and narcolepsy, autosomal dominant,;Hereditary sensory neuropathy type IE, 614116 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000130816 ENSG00000130816 HGNC:2976 EIF2AK2 gene EIF2AK2 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Leukoencephalopathy, developmental delay, and episodic neurologic regression syndrome, MIM# 618877;Neurodevelopmental Syndrome;Developmental delays;Ataxia;Parkinsonism;White matter alterations Neurodegeneration;HP:0002180 PMID: 32197074 False 3 100;0;0 6.47 True ENSG00000055332 ENSG00000055332 HGNC:9437 EIF2B1 gene EIF2B1 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter, 603896;Childhood ataxia with central nervous system hypomyelination/vanishing white matter disease Neurodegeneration;HP:0002180 31438897 False 3 100;0;0 6.47 False ENSG00000111361 ENSG00000111361 HGNC:3257 EIF2B2 gene EIF2B2 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter, 603896;Childhood ataxia with central nervous system hypomyelination/vanishing white matter disease Neurodegeneration;HP:0002180 31438897 False 3 100;0;0 6.47 False ENSG00000119718 ENSG00000119718 HGNC:3258 EIF2B3 gene EIF2B3 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter, 603896;Childhood ataxia with central nervous system hypomyelination/vanishing white matter disease Neurodegeneration;HP:0002180 31438897 False 3 100;0;0 6.47 False ENSG00000070785 ENSG00000070785 HGNC:3259 EIF2B4 gene EIF2B4 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter, 603896;Childhood ataxia with central nervous system hypomyelination/vanishing white matter disease Neurodegeneration;HP:0002180 31438897 False 3 100;0;0 6.47 False ENSG00000115211 ENSG00000115211 HGNC:3260 EIF2B5 gene EIF2B5 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter, 603896;Childhood ataxia with central nervous system hypomyelination/vanishing white matter disease Neurodegeneration;HP:0002180 31438897 False 3 100;0;0 6.47 False ENSG00000145191 ENSG00000145191 HGNC:3261 ELOVL4 gene ELOVL4 Expert Review Green;Royal Melbourne Hospital;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 34 133190;Spinocerebellar ataxia 34, 133190 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000118402 ENSG00000118402 HGNC:14415 ELOVL5 gene ELOVL5 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 38, MIM#615957 Neurodegeneration;HP:0002180 25065913 False 3 100;0;0 6.47 True ENSG00000012660 ENSG00000012660 HGNC:21308 EPM2A gene EPM2A Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 2A (Lafora) MIM#254780 Neurodegeneration;HP:0002180 12019207 False 3 100;0;0 6.47 True ENSG00000112425 ENSG00000112425 HGNC:3413 ERCC4 gene ERCC4 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Cerebellar ataxia;Xeroderma pigmentosum, group F, MIM# 278760" Neurodegeneration;HP:0002180 29403087;28431612;29892709 False 3 100;0;0 6.47 True ENSG00000175595 ENSG00000175595 HGNC:3436 ERLIN2 gene ERLIN2 Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 18, autosomal recessive, MIM# 611225;Spastic paraplegia 18A, autosomal dominant, MIM# 620512 Neurodegeneration;HP:0002180 23109145;21330303;32094424;29528531 False 3 100;0;0 6.47 True ENSG00000147475 ENSG00000147475 HGNC:1356 FA2H gene FA2H Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 35, autosomal recessive, 611026;MONDO:0012866 Neurodegeneration;HP:0002180 20104589;23745665;19068277;20853438;22146942;30446360 False 3 100;0;0 6.47 True ENSG00000103089 ENSG00000103089 HGNC:21197 FAT2 gene FAT2 Expert Review Green;Expert Review Green;Expert list;Expert list;Royal Melbourne Hospital;GeneReviews Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 45, MIM#617769 Neurodegeneration;HP:0002180 29053796;33884300 False 3 50;50;0 6.47 True ENSG00000086570 ENSG00000086570 HGNC:3596 FBXO7 gene FBXO7 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal parkinsonian-pyramidal syndrome MONDO:0009830 Neurodegeneration;HP:0002180 20301402 False 3 100;0;0 6.47 True ENSG00000100225 ENSG00000100225 HGNC:13586 FBXO7 gene FBXO7 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease 15, autosomal recessive MIM#260300 Neurodegeneration;HP:0002180 18513678;19038853 False 3 100;0;0 6.47 True ENSG00000100225 ENSG00000100225 HGNC:13586 FGF14 gene FGF14 Expert Review Green;Literature;Royal Melbourne Hospital;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia type 27, 609307;Spinocerebellar ataxia 27 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000102466 ENSG00000102466 HGNC:3671 FLVCR1 gene FLVCR1 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Posterior column ataxia with retinitis pigmentosa, 609033;Ataxia, posterior column, with retinitis pigmentosa,;Posterior Column Ataxia with Retinitis Pigmentosa Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000162769 ENSG00000162769 HGNC:24682 FOXG1 gene FOXG1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Rett syndrome, congenital variant, MIM# 613454;Developmental and Epileptic Encephalopathy;Dystonia,;Athetosis;Parkinsonism;Stereotypies" Neurodegeneration;HP:0002180 PMID: 21953941 False 3 100;0;0 6.47 True ENSG00000176165 ENSG00000176165 HGNC:3811 FRRS1L gene FRRS1L Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 37, MIM# 616981;Seizures;Chorea;Parkinsonism;Developmental delay Neurodegeneration;HP:0002180 PMID: 29086067 False 3 100;0;0 6.47 True ENSG00000260230 ENSG00000260230 HGNC:1362 FTL gene FTL Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration with brain iron accumulation 3, MIM# 606159 Neurodegeneration;HP:0002180 11438811;18854324;15099026;15173247 False 3 100;0;0 6.47 True ENSG00000087086 ENSG00000087086 HGNC:3999 FTL gene FTL Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration;HP:0002180 23447832;20301320 False 3 100;0;0 6.47 False ENSG00000087086 ENSG00000087086 HGNC:3999 FUS gene FUS Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 6, with or without frontotemporal dementia, MIM# 608030 Neurodegeneration;HP:0002180 32941707;32770214 False 3 100;0;0 6.47 True ENSG00000089280 ENSG00000089280 HGNC:4010 FUS gene FUS Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 6, with or without frontotemporal dementia (MIM#608030) Neurodegeneration;HP:0002180 19251628;19251627 False 3 100;0;0 6.47 True ENSG00000089280 ENSG00000089280 HGNC:4010 FXN gene FXN Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Friedreich ataxia, 229300 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 True ENSG00000165060 ENSG00000165060 HGNC:3951 FXN gene FXN Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Friedreich ataxia with retained reflexes,229300;Friedreich ataxia, 229300;Friedreichataxia, 229300 Neurodegeneration;HP:0002180 False 3 0;0;0 6.47 False ENSG00000165060 ENSG00000165060 HGNC:3951 GALC gene GALC Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Krabbe disease MIM#245200 Neurodegeneration;HP:0002180 9272171;11971051;22959700;26396125;26915362;28547031;31185936;32064984 False 3 100;0;0 6.47 True ENSG00000054983 ENSG00000054983 HGNC:4115 GBA gene GBA Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Parkinson's disease, MONDO:0005180, GBA-related Neurodegeneration;HP:0002180 PMID: 12809640;35639160 False 3 100;0;0 6.47 True ENSG00000177628 ENSG00000177628 HGNC:4177 GBA2 gene GBA2 Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 46, autosomal recessive, 614409;MONDO:0013737 Neurodegeneration;HP:0002180 23332916;23332917;29524657 False 3 100;0;0 6.47 True ENSG00000070610 ENSG00000070610 HGNC:18986 GBE1 gene GBE1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polyglucosan body disease, adult form MIM#263570 Neurodegeneration;HP:0002180 23034915 False 3 100;0;0 6.47 True ENSG00000114480 ENSG00000114480 HGNC:4180 GBE1 gene GBE1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Polyglucosan body disease, adult form MIM#263570" Neurodegeneration;HP:0002180 20301758;26194201 False 3 100;0;0 6.47 False ENSG00000114480 ENSG00000114480 HGNC:4180 GCH1 gene GCH1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Dystonia, DOPA-responsive, with or without hyperphenylalaninemia, MIM# 128230" Neurodegeneration;HP:0002180 21935284;24509643 False 3 100;0;0 6.47 True ENSG00000131979 ENSG00000131979 HGNC:4193 GCH1 gene GCH1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia, DOPA-responsive, with or without hyperphenylalaninemia, MIM# 128230 Neurodegeneration;HP:0002180 32170445;32278297;32746945;30314816 False 3 100;0;0 6.47 True ENSG00000131979 ENSG00000131979 HGNC:4193 GDAP2 gene GDAP2 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spinocerebellar ataxia Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000196505 ENSG00000196505 HGNC:18010 GFAP gene GFAP Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alexander disease MONDO:0008752 Neurodegeneration;HP:0002180 11138011;18684770 False 3 100;0;0 6.47 True Other ENSG00000131095 ENSG00000131095 HGNC:4235 GFAP gene GFAP Royal Melbourne Hospital;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Alexander disease, 203450;Autosomal Dominant Ataxia;Alexander disease Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000131095 ENSG00000131095 HGNC:4235 GJA1 gene GJA1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary spastic paraplegia;Oculodentodigital dysplasia, 164200, Oculodentodigital dysplasia, autosomal recessive, 257850 Neurodegeneration;HP:0002180 31023660 False 3 100;0;0 6.47 True ENSG00000152661 ENSG00000152661 HGNC:4274 GLA gene GLA Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) "Fabry disease MONDO:0010526" Neurodegeneration;HP:0002180 36927868;38254927;9213072;23949010;32510623 False 3 100;0;0 6.47 True ENSG00000102393 ENSG00000102393 HGNC:4296 GLB1 gene GLB1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GM1-gangliosidosis, type III , MIM#230650;Parkinsonism Neurodegeneration;HP:0002180 PMID: 34514040 False 3 100;0;0 6.47 True ENSG00000170266 ENSG00000170266 HGNC:4298 GRN gene GRN Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted frontotemporal dementia and/or amyotrophic lateral sclerosis MONDO:0030923 Neurodegeneration;HP:0002180 20301545;17436289 False 3 100;0;0 6.47 True ENSG00000030582 ENSG00000030582 HGNC:4601 GRN gene GRN Expert Review Green;ClinGen Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted frontotemporal dementia and/or amyotrophic lateral sclerosis MONDO:0030923 Neurodegeneration;HP:0002180 18184915;23596077 False 3 100;0;0 6.47 True ENSG00000030582 ENSG00000030582 HGNC:4601 GRN gene GRN Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal lobar degeneration with ubiquitin-positive inclusions, MIM# 607485 Neurodegeneration;HP:0002180 17923627;20301545 False 3 100;0;0 6.47 False ENSG00000030582 ENSG00000030582 HGNC:4601 HEXA gene HEXA Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GM2-gangliosidosis, several forms or Tay-Sachs disease MIM#272800 Neurodegeneration;HP:0002180 31995250;31076878 False 3 100;0;0 6.47 True ENSG00000213614 ENSG00000213614 HGNC:4878 HEXB gene HEXB Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sandhoff disease, infantile, juvenile, and adult forms MIM#268800 Neurodegeneration;HP:0002180 31995250;24263030 False 3 100;0;0 6.47 True ENSG00000049860 ENSG00000049860 HGNC:4879 HNRNPA1 gene HNRNPA1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 20 MIM#615426 Neurodegeneration;HP:0002180 23455423;34291734 False 3 100;0;0 6.47 True ENSG00000135486 ENSG00000135486 HGNC:5031 HTRA1 gene HTRA1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal CARASIL syndrome MIM#600142;Cerebral arteriopathy, autosomal dominant, with subcortical infarcts and leukoencephalopathy, type 2 MIM#616779 Neurodegeneration;HP:0002180 29895533;26063658;19387015 False 3 100;0;0 6.47 False ENSG00000166033 ENSG00000166033 HGNC:9476 ITM2B gene ITM2B Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cerebral amyloid angiopathy MONDO:0005620 Neurodegeneration;HP:0002180 10391242;10781099;20385796;33814452 False 3 100;0;0 6.47 True ENSG00000136156 ENSG00000136156 HGNC:6174 ITM2B gene ITM2B Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Cerebellar ataxia, cataract, deafness, and dementia or psychosis;Danish familial dementia Neurodegeneration;HP:0002180 10391242;10781099;33814452 False 3 100;0;0 6.47 True ENSG00000136156 ENSG00000136156 HGNC:6174 ITPR1 gene ITPR1 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Gillespie syndrome, 206700;Spinocerebellar ataxia 29;Spinocerebellar ataxia 29, 117360;Spinocerebellar ataxia 15;Spinocerebellar ataxia 15, 606658 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000150995 ENSG00000150995 HGNC:6180 KCNA2 gene KCNA2 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary spastic paraplegia and ataxia Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 True ENSG00000177301 ENSG00000177301 HGNC:6220 KCNC3 gene KCNC3 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 13;Spinocerebellar ataxia 13, 605259 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000131398 ENSG00000131398 HGNC:6235 KCND3 gene KCND3 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 19, MIM# 607346 Neurodegeneration;HP:0002180 23280837;23280838;34361012;34067185;33575485;32823520 False 3 100;0;0 6.47 True ENSG00000171385 ENSG00000171385 HGNC:6239 KIAA1161 gene KIAA1161 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Basal ganglia calcification, idiopathic, 7, autosomal recessive, OMIM #618317;Primary familial brain calcification;Atypical parkinsonism;Supranuclear gaze palsy Neurodegeneration;HP:0002180 32211515;30656188;30649222;30460687;29910000;31951047 False 3 100;0;0 6.47 True ENSG00000164976 ENSG00000164976 HGNC:19918 KIF1A gene KIF1A Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 30, autosomal dominant MIM# 610357;Spastic paraplegia 30, autosomal recessive 620607 Neurodegeneration;HP:0002180 26410750;21487076;22258533;32096284;31488895;29159194;25585697 False 3 100;0;0 6.47 True ENSG00000130294 ENSG00000130294 HGNC:888 KIF1C gene KIF1C Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 2,autosomal recessive;Autosomal recessive spastic ataxia 2, 611302 Neurodegeneration;HP:0002180 24482476;24319291;31413903;29544888 False 3 100;0;0 6.47 True ENSG00000129250 ENSG00000129250 HGNC:6317 KIF5A gene KIF5A Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spastic paraplegia 10, autosomal dominant, MIM# 604187 Neurodegeneration;HP:0002180 16489470;21623771;15452312;18853458;16476820 False 3 100;0;0 6.47 True ENSG00000155980 ENSG00000155980 HGNC:6323 KIF5A gene KIF5A Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Amyotrophic lateral sclerosis, susceptibility to, 25} MIM#617921 Neurodegeneration;HP:0002180 29342275;30301576;29566793 False 3 100;0;0 6.47 False ENSG00000155980 ENSG00000155980 HGNC:6323 KMT2B gene KMT2B Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia 28, childhood-onset , MIM#617284 Neurodegeneration;HP:0002180 PMID: 33816656 False 3 100;0;0 6.47 True ENSG00000272333 ENSG00000272333 HGNC:15840 LMNB1 gene LMNB1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Leukodystrophy, adult-onset, autosomal dominant MIM#169500 Neurodegeneration;HP:0002180 31695592 False 3 100;0;0 6.47 True ENSG00000113368 ENSG00000113368 HGNC:6637 LRRK2 gene LRRK2 Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000188906 ENSG00000188906 HGNC:18618 LRRK2 gene LRRK2 Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000188906 ENSG00000188906 HGNC:18618 LYST gene LYST Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Chediak-Higashi syndrome MONDO:0008963 Neurodegeneration;HP:0002180 23436631;23521865;20301751 False 3 100;0;0 6.47 True ENSG00000143669 ENSG00000143669 HGNC:1968 MAPT gene MAPT Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted late-onset Parkinson disease MONDO:0008199 Neurodegeneration;HP:0002180 20301678 False 3 100;0;0 6.47 True ENSG00000186868 ENSG00000186868 HGNC:6893 MAPT gene MAPT Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Supranuclear palsy, progressive (MIM# 601104) AD;Supranuclear palsy, progressive atypical (MIM# 260540) AR Neurodegeneration;HP:0002180 20838030;11220749 False 3 100;0;0 6.47 True ENSG00000186868 ENSG00000186868 HGNC:6893 MARS2 gene MARS2 Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 3, autosomal recessive, 611390 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 True ENSG00000247626 ENSG00000247626 HGNC:25133 MATR3 gene MATR3 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration;HP:0002180 19344878;24686783;35205163;34659085;34173818;26493020 False 3 100;0;0 6.47 False ENSG00000015479 ENSG00000015479 HGNC:6912 MECP2 gene MECP2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females MECP2-related disorders;Rett syndrome, MIM# 312750;Mental retardation, X-linked, syndromic 13, MIM# 300055 Neurodegeneration;HP:0002180 31970230;27050783 False 3 100;0;0 6.47 True ENSG00000169057 ENSG00000169057 HGNC:6990 MSTO1 gene MSTO1 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial myopathy and ataxia, 617675 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000125459 ENSG00000125459 HGNC:29678 NEK1 gene NEK1 Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis, susceptibility to, 24 MIM#617892 Neurodegeneration;HP:0002180 31768050;26945885;27455347;29929116 False 3 100;0;0 6.47 True ENSG00000137601 ENSG00000137601 HGNC:7744 NHLRC1 gene NHLRC1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 2B (Lafora Disease) MIM#254780 Neurodegeneration;HP:0002180 28556688;34117373 False 3 100;0;0 6.47 True ENSG00000187566 ENSG00000187566 HGNC:21576 NIPA1 gene NIPA1 Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 6, autosomal dominant, MIM# 600363;MONDO:0010878 Neurodegeneration;HP:0002180 14508710;15711826;32500351;25133278 False 3 100;0;0 6.47 True ENSG00000170113 ENSG00000170113 HGNC:17043 NOTCH1 gene NOTCH1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Genetic cerebral small vessel disease (MONDO:0018787), NOTCH1-related Neurodegeneration;HP:0002180 35947102 False 3 100;0;0 6.47 True Other ENSG00000148400 ENSG00000148400 HGNC:7881 NOTCH3 gene NOTCH3 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 125310 Neurodegeneration;HP:0002180 31960911 False 3 100;0;0 6.47 True ENSG00000074181 ENSG00000074181 HGNC:7883 NPC1 gene NPC1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-Pick disease, type C1 MONDO:0009757;ataxia Neurodegeneration;HP:0002180 10480349;17003072;25497598;33228797 False 3 100;0;0 6.47 True ENSG00000141458 ENSG00000141458 HGNC:7897 NPC1 gene NPC1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-Pick disease, type C1 (MIM#257220;MONDO:0009757) Neurodegeneration;HP:0002180 20301473;11182931 False 3 0;100;0 6.47 True ENSG00000141458 ENSG00000141458 HGNC:7897 NPC1 gene NPC1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Niemann-Pick disease, MIM# 257220;Parkinsonism Neurodegeneration;HP:0002180 24035292;30369906 False 3 100;0;0 6.47 True ENSG00000141458 ENSG00000141458 HGNC:7897 NPC2 gene NPC2 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann Pick C2, OMIM 607625;Parkinsonism Neurodegeneration;HP:0002180 PMID: 35695805 False 3 100;0;0 6.47 True ENSG00000119655 ENSG00000119655 HGNC:14537 NPC2 gene NPC2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-pick disease, type C2 MIM#607625 Neurodegeneration;HP:0002180 27792009;20525256 False 3 100;0;0 6.47 True ENSG00000119655 ENSG00000119655 HGNC:14537 NPTX1 gene NPTX1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted cerebellar ataxia MONDO#0000437, NPTX1-related Neurodegeneration;HP:0002180 34788392;35288776;35285082;35560436 False 3 100;0;0 6.47 True ENSG00000171246 ENSG00000171246 HGNC:7952 NR4A2 gene NR4A2 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Intellectual developmental disorder with language impairment and early-onset DOPA-responsive dystonia-parkinsonism, MIM# 619911 Neurodegeneration;HP:0002180 31922365 False 3 100;0;0 6.47 True ENSG00000153234 ENSG00000153234 HGNC:7981 NUS1 gene NUS1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Intellectual developmental disorder, autosomal dominant 55, with seizures, MIM# 617831;Parkinsonism;Developmental delay;Intellectual disability;Ataxia;Myoclonus" Neurodegeneration;HP:0002180 PMID: 32485575;30348779 False 3 100;0;0 6.47 True ENSG00000153989 ENSG00000153989 HGNC:21042 OPA3 gene OPA3 Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria, type III, MIM# 258501 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 True ENSG00000125741 ENSG00000125741 HGNC:8142 OPTN gene OPTN Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Amyotrophic lateral sclerosis 12 with or without frontotemporal dementia (MONDO: 0013264, MIM#613435) Neurodegeneration;HP:0002180 20428114;31838784;27493188 False 3 100;0;0 6.47 True ENSG00000123240 ENSG00000123240 HGNC:17142 OPTN gene OPTN Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Amyotrophic lateral sclerosis 12 with or without frontotemporal dementia (MIM#613435) Neurodegeneration;HP:0002180 31838784;20428114;20301623 False 3 100;0;0 6.47 True ENSG00000123240 ENSG00000123240 HGNC:17142 PANK2 gene PANK2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal pantothenate kinase-associated neurodegeneration MONDO:0009319 Neurodegeneration;HP:0002180 23447832;20301663 False 3 0;0;0 6.47 True ENSG00000125779 ENSG00000125779 HGNC:15894 PANK2 gene PANK2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration with brain iron accumulation 1 (MIM#234200) Neurodegeneration;HP:0002180 24600523;23447832;19480328 False 3 100;0;0 6.47 True ENSG00000125779 ENSG00000125779 HGNC:15894 PARK7 gene PARK7 Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000116288 ENSG00000116288 HGNC:16369 PARK7 gene PARK7 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal autosomal recessive early-onset Parkinson disease 7 MONDO:0011658 Neurodegeneration;HP:0002180 20301402 False 3 100;0;0 6.47 True ENSG00000116288 ENSG00000116288 HGNC:16369 PCYT2 gene PCYT2 Expert Review Green;Expert list;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 82, autosomal recessive, MIM# 618770;global developmental delay;regression;spastic parapesis or tetraparesis;epilepsy;progressive cerebral and cerebellar atrophy" Neurodegeneration;HP:0002180 31637422 False 3 100;0;0 6.47 True ENSG00000185813 ENSG00000185813 HGNC:8756 PDE8B gene PDE8B Expert Review Green;Expert Review Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Striatal degeneration, autosomal dominant, MIM#609161 Neurodegeneration;HP:0002180 20085714;26769607;26475694 False 3 100;0;0 6.47 True ENSG00000113231 ENSG00000113231 HGNC:8794 PDGFB gene PDGFB Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Basal ganglia calcification, idiopathic, 5, MIM# 615483 Neurodegeneration;HP:0002180 23913003 False 3 100;0;0 6.47 True ENSG00000100311 ENSG00000100311 HGNC:8800 PDGFRB gene PDGFRB Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Basal ganglia calcification, idiopathic, 4, MIM# 615007 Neurodegeneration;HP:0002180 23255827;30979360 False 3 100;0;0 6.47 True ENSG00000113721 ENSG00000113721 HGNC:8804 PDYN gene PDYN Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 23;Spinocerebellar ataxia 23, 610245 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000101327 ENSG00000101327 HGNC:8820 PEX7 gene PEX7 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 9B, MIM# 614879 Neurodegeneration;HP:0002180 25851898 False 3 100;0;0 6.47 True ENSG00000112357 ENSG00000112357 HGNC:8860 PFN1 gene PFN1 Expert Review Green;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Neurodegeneration;HP:0002180 False 3 67;33;0 6.47 False ENSG00000108518 ENSG00000108518 HGNC:8881 PGK1 gene PGK1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Phosphoglycerate kinase 1 deficiency, MIM# 300653;Haemolytic anaemia;Rhabdomyolysis;Myopathy;Juvenile Parkinsonism;OMIM 300653 Neurodegeneration;HP:0002180 PMID: 30975619 False 3 100;0;0 6.47 True ENSG00000102144 ENSG00000102144 HGNC:8896 PINK1 gene PINK1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease 6, early onset MIM#605909 Neurodegeneration;HP:0002180 28980524 False 3 100;0;0 6.47 True ENSG00000158828 ENSG00000158828 HGNC:14581 PINK1 gene PINK1 Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000158828 ENSG00000158828 HGNC:14581 PLA2G6 gene PLA2G6 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal autosomal recessive Parkinson disease 14 MONDO:0013060 Neurodegeneration;HP:0002180 20301718 False 3 100;0;0 6.47 True ENSG00000184381 ENSG00000184381 HGNC:9039 PLA2G6 gene PLA2G6 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease 14, autosomal recessive, MIM# 612953 Neurodegeneration;HP:0002180 25634434;26836416;22406380;20938027 False 3 0;100;0 6.47 True ENSG00000184381 ENSG00000184381 HGNC:9039 PLP1 gene PLP1 Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Spastic paraplegia 2, X-linked recessive, 312920 Neurodegeneration;HP:0002180 15627202;8012387 False 3 100;0;0 6.47 True ENSG00000123560 ENSG00000123560 HGNC:9086 PNPLA6 gene PNPLA6 Expert Review Green;Expert list;Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spastic paraplegia 39 (#612020), ataxia seen in some patients;Boucher-Neuhauser syndrome, 215470;Sapstic paraplegia 39, 612020;Oliver-McFarlane syndrome (#603197);Spinocerebellar ataxia, hypogonadotropic hypogonadism and chorioretinal dystrophy (Boucher-Neuhauser syndrome, #215470);Oliver-McFarlane syndrome, 275400 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000032444 ENSG00000032444 HGNC:16268 PNPLA6 gene PNPLA6 Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 39, autosomal recessive, 612020 Neurodegeneration;HP:0002180 18313024 False 3 100;0;0 6.47 True ENSG00000032444 ENSG00000032444 HGNC:16268 POLG gene POLG Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE);Mitochondrial recessive ataxia syndrome, 607459;Mitochondrial DNA depletion types 4A, 203700 and 4B, 613662;autosomal recessive progressive external opthalmoplegia, 258450;autosomal dominant progressive external ophthalmoplegia, 157640 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000140521 ENSG00000140521 HGNC:9179 POLG gene POLG Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted autosomal dominant progressive external ophthalmoplegia MONDO:0008003 Neurodegeneration;HP:0002180 20301791;15351195 False 3 100;0;0 6.47 True ENSG00000140521 ENSG00000140521 HGNC:9179 POLR3A gene POLR3A Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia Neurodegeneration;HP:0002180 31637490 False 3 100;0;0 6.47 True ENSG00000148606 ENSG00000148606 HGNC:30074 POLR3A gene POLR3A Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 7, with or without oligodontia and/or hypogonadotropic hypogonadism, MIM# 607694;POLR3A Leukoencephalopathy;Parkinsonism;Ocular and dental abnormality;Hypogonadism Neurodegeneration;HP:0002180 PMID: 33652360 False 3 100;0;0 6.47 True ENSG00000148606 ENSG00000148606 HGNC:30074 PPP2R5D gene PPP2R5D Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Early onset Parkinsonism;Houge-Janssens syndrome 1, MIM#616355 Neurodegeneration;HP:0002180 33338668;32743835 False 3 100;0;0 6.47 True ENSG00000112640 ENSG00000112640 HGNC:9312 PRDX3 gene PRDX3 Expert Review Green;Literature;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia (early onset, mild to moderate, progressive) Neurodegeneration;HP:0002180 33889951 False 3 100;0;0 6.47 True ENSG00000165672 ENSG00000165672 HGNC:9354 PRKCG gene PRKCG Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 14, MIM# 605361;Myoclonus;Parkinsonism Neurodegeneration;HP:0002180 PMID: 29603387 False 3 100;0;0 6.47 True ENSG00000126583 ENSG00000126583 HGNC:9402 PRKCG gene PRKCG Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 14 MIM#605361 Neurodegeneration;HP:0002180 25217572;18577575;31158466 False 3 100;0;0 6.47 True Other ENSG00000126583 ENSG00000126583 HGNC:9402 PRKN gene PRKN Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease, juvenile, type 2 MIM#600116 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 True ENSG00000185345 ENSG00000185345 HGNC:8607 PRKN gene PRKN Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal autosomal recessive juvenile Parkinson disease 2 MONDO:0010820 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 True ENSG00000185345 ENSG00000185345 HGNC:8607 PRKRA gene PRKRA Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal dystonia 16 MONDO:0012789 Neurodegeneration;HP:0002180 33502045 False 3 100;0;0 6.47 True ENSG00000180228 ENSG00000180228 HGNC:9438 PRNP gene PRNP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Prion Disease (MIM#176640);Creutzfeldt-Jakob disease (MIM#123400) Neurodegeneration;HP:0002180 27910931;19571725, 20301407;6351815 False 3 100;0;0 6.47 True ENSG00000171867 ENSG00000171867 HGNC:9449 PRNP gene PRNP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted inherited Creutzfeldt-Jakob disease MONDO:0007403;Gerstmann-Straussler-Scheinker syndrome MONDO:0007656 Neurodegeneration;HP:0002180 20301407 False 3 100;0;0 6.47 True ENSG00000171867 ENSG00000171867 HGNC:9449 PRNP gene PRNP Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Multiple allelic disorders reported;Huntington disease-like 1;Autosomal Dominant Ataxia;Gerstmann-Straussler disease;Insomnia, fatal familial;Creutzfeldt-Jakob disease Neurodegeneration;HP:0002180 2564168;34324063;20301407 False 3 100;0;0 6.47 True ENSG00000171867 ENSG00000171867 HGNC:9449 PRRT2 gene PRRT2 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Familial infantile convulsions with paroxysmal dyskinesia 1, 602066;CONVULSIONS, FAMILIAL INFANTILE, WITH PAROXYSMAL CHOREOATHETOSIS;episodic kinesigenic dyskinesia;dystonia and occasionally hemiplegic migraine and epilepsy;episodic kinesigenic dyskinesia, 128200;EPISODIC KINESIGENIC DYSKINESIA 1;SEIZURES, BENIGN FAMILIAL INFANTILE, 2 Neurodegeneration;HP:0002180 26598494;31193310;30501978;30713971 False 3 100;0;0 6.47 False ENSG00000167371 ENSG00000167371 HGNC:30500 PSAP gene PSAP Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Parkinson disease 24, autosomal dominant, susceptibility to, MIM# 619491 Neurodegeneration;HP:0002180 32201884 False 3 100;0;0 6.47 True ENSG00000197746 ENSG00000197746 HGNC:9498 PSEN1 gene PSEN1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alzheimer disease 3 MONDO:0011913 Neurodegeneration;HP:0002180 3548932;34843019;36825052 False 3 100;0;0 6.47 True ENSG00000080815 ENSG00000080815 HGNC:9508 PSEN1 gene PSEN1 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alzheimer disease, type 3, with spastic paraparesis and apraxia, MIM# 607822 Neurodegeneration;HP:0002180 33274538 False 3 100;0;0 6.47 True ENSG00000080815 ENSG00000080815 HGNC:9508 PSEN1 gene PSEN1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alzheimer disease, type 3 (MIM#607822;MONDO:0011913) Neurodegeneration;HP:0002180 22503161;20301340 False 3 100;0;0 6.47 True ENSG00000080815 ENSG00000080815 HGNC:9508 PSEN2 gene PSEN2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alzheimer disease-4 (MIM#606889) Neurodegeneration;HP:0002180 22503161;20301340;25323700;35491795 False 3 100;0;0 6.47 True ENSG00000143801 ENSG00000143801 HGNC:9509 PSMF1 gene PSMF1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Complex neurodevelopmental disorder with motor features, MONDO:0100516, PSMF1-related Neurodegeneration;HP:0002180 https://www.medrxiv.org/content/10.1101/2024.06.19.24308302v1 False 3 100;0;0 6.47 True ENSG00000125818 ENSG00000125818 HGNC:9571 PTRHD1 gene PTRHD1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with early-onset parkinsonism and behavioral abnormalities, MIM# 620747 Neurodegeneration;HP:0002180 27753167;27134041;30398675;29143421 False 3 100;0;0 6.47 True ENSG00000184924 ENSG00000184924 HGNC:33782 PTS gene PTS Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 True ENSG00000150787 ENSG00000150787 HGNC:9689 PUM1 gene PUM1 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 47, 617931 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000134644 ENSG00000134644 HGNC:14957 QDPR gene QDPR Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperphenylalaninemia, BH4-deficient, C, MIM#261630;Dehydropteridin reductase deficiency, Infantile-onset dystonia;Parkinsonism;Epilepsy;Autonomic dysfunction;Hyperphenylalaninemia Neurodegeneration;HP:0002180 PMID: 28413401 False 3 100;0;0 6.47 True ENSG00000151552 ENSG00000151552 HGNC:9752 RAB39B gene RAB39B Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Early-onset parkinsonism-intellectual disability syndrome MONDO:0010709 Neurodegeneration;HP:0002180 25434005;26399558;26739247 False 3 100;0;0 6.47 True ENSG00000155961 ENSG00000155961 HGNC:16499 REEP1 gene REEP1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 31, autosomal dominant MIM#610250 Neurodegeneration;HP:0002180 23108492;22703882 False 3 100;0;0 6.47 True ENSG00000068615 ENSG00000068615 HGNC:25786 REEP1 gene REEP1 Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 31, autosomal dominant, 610250;MONDO:0012453 Neurodegeneration;HP:0002180 16826527;19034539 False 3 100;0;0 6.47 True ENSG00000068615 ENSG00000068615 HGNC:25786 RFC1 gene RFC1 Expert Review Green;Expert list;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575 Neurodegeneration;HP:0002180 30926972;33103729;35883251;36478048;36289003 False 3 67;33;0 6.47 True ENSG00000035928 ENSG00000035928 HGNC:9969 RNF170 gene RNF170 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ataxia, sensory, 1, autosomal dominant, MIM# 608984 Neurodegeneration;HP:0002180 32943585;21115467 False 3 100;0;0 6.47 True ENSG00000120925 ENSG00000120925 HGNC:25358 RNF216 gene RNF216 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia and hypogonadotropic hypogonadism MIM#212840 Neurodegeneration;HP:0002180 23656588;25841028;27995769 False 3 100;0;0 6.47 True ENSG00000011275 ENSG00000011275 HGNC:21698 RNF216 gene RNF216 Expert list;Royal Melbourne Hospital;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia and hypogonadotrophic hypogonadism;Cerebellar ataxia and hypogonadotropic hypogonadism, 212840 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000011275 ENSG00000011275 HGNC:21698 RTN2 gene RTN2 Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 12, autosomal dominant, 604805;MONDO:0011489 Neurodegeneration;HP:0002180 22232211;27165006 False 3 100;0;0 6.47 True ENSG00000125744 ENSG00000125744 HGNC:10468 SACS gene SACS Expert list;Royal Melbourne Hospital;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia, Charlevoix-Saguenay type;Charlevoix-Saguenay spastic ataxia, 270550 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000151835 ENSG00000151835 HGNC:10519 SACS gene SACS Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia, Charlevoix-Saguenay type, 270550;MONDO:0010041 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 True ENSG00000151835 ENSG00000151835 HGNC:10519 SAMD9L gene SAMD9L Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 49, MIM# 619806;Ataxia-pancytopaenia syndrome, MIM# 159550 Neurodegeneration;HP:0002180 35310830;33884299;28570036 False 3 100;0;0 6.47 True ENSG00000177409 ENSG00000177409 HGNC:1349 SCN1A gene SCN1A Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dravet syndrome, MIM# 607208;Epilepsy, Paekinsonism Neurodegeneration;HP:0002180 PMID: 28186331;24850485 False 3 100;0;0 6.47 True ENSG00000144285 ENSG00000144285 HGNC:10585 SERAC1 gene SERAC1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome, MIM# 614739;Parkinsonism Neurodegeneration;HP:0002180 PMID: 29332177;16527507 False 3 100;0;0 6.47 True ENSG00000122335 ENSG00000122335 HGNC:21061 SETX gene SETX Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic Lateral Sclerosis 4, juvenile (MIM#602433) Neurodegeneration;HP:0002180 15106121;9497266 False 3 100;0;0 6.47 True ENSG00000107290 ENSG00000107290 HGNC:445 SETX gene SETX Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spinocerebellar ataxia type 1, 606002;ataxia with oculomotor apraxia type 2 (AOA2), juvenile amyotrophic lateral sclerosis (ALS4) and autosomal dominant ataxia;Ataxia-ocular apraxia-2 Neurodegeneration;HP:0002180 14770181;20301333 False 3 100;0;0 6.47 True ENSG00000107290 ENSG00000107290 HGNC:445 SIGMAR1 gene SIGMAR1 Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Neurodegeneration;HP:0002180 False 3 67;33;0 6.47 False ENSG00000147955 ENSG00000147955 HGNC:8157 SLC18A2 gene SLC18A2 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinsonism-dystonia, infantile, 2 , MIM# 618049;Brain dopamine-serotonin transport disease, Childhood-onset parkinsonism Neurodegeneration;HP:0002180 33983693;23363473;31240161;26497564 False 3 100;0;0 6.47 True ENSG00000165646 ENSG00000165646 HGNC:10935 SLC19A3 gene SLC19A3 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Thiamine metabolism dysfunction syndrome 2 (biotin- or thiamine-responsive encephalopathy type 2), MIM# 607483;Childhood onset Dystonia and Parkinsonism Neurodegeneration;HP:0002180 PMID: 24260777 False 3 100;0;0 6.47 True ENSG00000135917 ENSG00000135917 HGNC:16266 SLC1A3 gene SLC1A3 Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic ataxia, type 6 MIM#612656 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000079215 ENSG00000079215 HGNC:10941 SLC20A2 gene SLC20A2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Basal ganglia calcification, idiopathic, 1, MIM# 213600 Neurodegeneration;HP:0002180 22327515;23334463 False 3 100;0;0 6.47 True ENSG00000168575 ENSG00000168575 HGNC:10947 SLC25A15 gene SLC25A15 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperornithinemia-hyperammonemia-homocitrullinemia syndrome MIM#238970 Neurodegeneration;HP:0002180 16376511;22465082;28592010 False 3 100;0;0 6.47 True ENSG00000102743 ENSG00000102743 HGNC:10985 SLC30A10 gene SLC30A10 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal cirrhosis - dystonia - polycythemia - hypermanganesemia syndrome MONDO:0013208 Neurodegeneration;HP:0002180 22341971;22341972 False 3 100;0;0 6.47 True ENSG00000196660 ENSG00000196660 HGNC:25355 SLC39A14 gene SLC39A14 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypermanganesemia with dystonia 2 (MIM# 617013) Neurodegeneration;HP:0002180 27231142;32626807;29685658;30232769 False 3 100;0;0 6.47 True ENSG00000104635 ENSG00000104635 HGNC:20858 SLC52A2 gene SLC52A2 Expert Review Green;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000185803 ENSG00000185803 HGNC:30224 SLC52A3 gene SLC52A3 Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Amytrophic Lateral Sclerosis (ALS);Brown-Vialetto-van Laere syndrome 1 (MIM# 211530) Neurodegeneration;HP:0002180 26072523 False 3 100;0;0 6.47 True ENSG00000101276 ENSG00000101276 HGNC:16187 SLC6A3 gene SLC6A3 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinsonism-dystonia, infantile, 1, MIM# 613135 Neurodegeneration;HP:0002180 21112253 False 3 100;0;0 6.47 True ENSG00000142319 ENSG00000142319 HGNC:11049 SMN1 gene SMN1 Expert Review Green;Literature;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinal muscular atrophy-1, MIM# 253300 Neurodegeneration;HP:0002180 20301623 False 3 100;0;0 6.47 True ENSG00000172062 ENSG00000172062 HGNC:11117 SNCA gene SNCA Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dementia, Lewy body (MIM#127750);Parkinson disease 1 (MIM#168601);Parkinson disease 4 (MIM#605543) Neurodegeneration;HP:0002180 32849182;26858591;32740728 False 3 100;0;0 6.47 True ENSG00000145335 ENSG00000145335 HGNC:11138 SNCA gene SNCA Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dementia, Lewy body (MIM#127750);Parkinson disease 1 (MIM#168601);Parkinson disease 4 (MIM#605543) Neurodegeneration;HP:0002180 32849182;26858591;32740728 False 3 100;0;0 6.47 True ENSG00000145335 ENSG00000145335 HGNC:11138 SOD1 gene SOD1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Amyotrophic lateral sclerosis 1 (105400 AD, AR);Spastic tetraplegia and axial hypotonia, progressive (618598 AR) Neurodegeneration;HP:0002180 8625408;21545237;16503123 False 3 100;0;0 6.47 True ENSG00000142168 ENSG00000142168 HGNC:11179 SOX6 gene SOX6 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Tolchin-Le Caignec syndrome, MIM# 618971;Developmental delay;ID;ASD;ADHD;Parkinsonism;Syringomyelia" Neurodegeneration;HP:0002180 24453155;25127144 False 3 100;0;0 6.47 True ENSG00000110693 ENSG00000110693 HGNC:16421 SPART gene SPART Expert Review Green;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000133104 ENSG00000133104 HGNC:18514 SPAST gene SPAST Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spastic paraplegia 4, autosomal dominant, 182601 Neurodegeneration;HP:0002180 30476002;30006150 False 3 100;0;0 6.47 True ENSG00000021574 ENSG00000021574 HGNC:11233 SPAST gene SPAST Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration;HP:0002180 16765570;19364936 False 3 100;0;0 6.47 True ENSG00000021574 ENSG00000021574 HGNC:11233 SPG11 gene SPG11 Expert Review Green;Royal Melbourne Hospital;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Amyotrophic lateral sclerosis 5, juvenile, MIM# 602099 Neurodegeneration;HP:0002180 20110243 False 3 100;0;0 6.47 True ENSG00000104133 ENSG00000104133 HGNC:11226 SPG11 gene SPG11 Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 11, autosomal recessive MIM#604360;Charcot-Marie-Tooth disease, axonal, type 2X MIM#616668;Amyotrophic lateral sclerosis 5, juvenile MIM#602099 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000104133 ENSG00000104133 HGNC:11226 SPG11 gene SPG11 Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 11, autosomal recessive, MIM# 604360 Neurodegeneration;HP:0002180 18067136 False 3 100;0;0 6.47 True ENSG00000104133 ENSG00000104133 HGNC:11226 SPG11 gene SPG11 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal hereditary spastic paraplegia 11 MONDO:0011445 Neurodegeneration;HP:0002180 35036589;23121729;21381113;27217339 False 3 100;0;0 6.47 True ENSG00000104133 ENSG00000104133 HGNC:11226 SPG21 gene SPG21 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mast syndrome, MIM# 248900 Neurodegeneration;HP:0002180 14564668;24451228;28752238;26978163 False 3 100;0;0 6.47 True ENSG00000090487 ENSG00000090487 HGNC:20373 SPG21 gene SPG21 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mast syndrome, 248900;Spastic Paraplegia, autosomal recessive Neurodegeneration;HP:0002180 14564668;24451228;28752238;26978163 False 3 100;0;0 6.47 True ENSG00000090487 ENSG00000090487 HGNC:20373 SPG7 gene SPG7 Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 7, autosomal recessive, 607259;MONDO:0011803 Neurodegeneration;HP:0002180 22571692 False 3 100;0;0 6.47 True ENSG00000197912 ENSG00000197912 HGNC:11237 SPG7 gene SPG7 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 7 (#607259) complex forms of the disease. Actually associated with a range of phenotypes including adult-onset ataxia;Autosomal recessive spastic paraplegia 7, 607259 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000197912 ENSG00000197912 HGNC:11237 SPG7 gene SPG7 Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 7, autosomal recessive MIM#607259 Neurodegeneration;HP:0002180 16765570;19364936 False 3 100;0;0 6.47 True ENSG00000197912 ENSG00000197912 HGNC:11237 SPG7 gene SPG7 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 7, autosomal recessive, MIM# 607259;Ataxia;Progressive external opthalmoplegia;Parkinsonism" Neurodegeneration;HP:0002180 PMID: 31433872 False 3 100;0;0 6.47 True ENSG00000197912 ENSG00000197912 HGNC:11237 SPR gene SPR Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dopa-responsive dystonia due to sepiapterin reductase deficiency MONDO:0012994 Neurodegeneration;HP:0002180 22522443;11920285;14663042;16443856;21782285;32813147 False 3 0;100;0 6.47 True ENSG00000116096 ENSG00000116096 HGNC:11257 SPTBN2 gene SPTBN2 Expert Review Green;Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spinocerebellar ataxia 5, 600224;Spinocerebellar ataxia, autosomal recessive 14, 615386 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 True ENSG00000173898 ENSG00000173898 HGNC:11276 SPTLC1 gene SPTLC1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted juvenile amyotrophic lateral sclerosis MONDO:0017593 Neurodegeneration;HP:0002180 34059824;35900868;34459874 False 3 100;0;0 6.47 True Other ENSG00000090054 ENSG00000090054 HGNC:11277 STUB1 gene STUB1 Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spinocerebellar ataxia 48, MIM#618093 Neurodegeneration;HP:0002180 32337344;30381368;31126790 False 3 100;0;0 6.47 True ENSG00000103266 ENSG00000103266 HGNC:11427 STUB1 gene STUB1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar Ataxia 48, OMIM 618093;Parkinsonism Neurodegeneration;HP:0002180 30381368;32285148;32337344 False 3 100;0;0 6.47 True ENSG00000103266 ENSG00000103266 HGNC:11427 STUB1 gene STUB1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Spinocerebellar ataxia 48 MIM#618093;cognitive impairment;Spinocerebellar ataxia, autosomal recessive 16 MIM#615768" Neurodegeneration;HP:0002180 32713943 False 3 100;0;0 6.47 False ENSG00000103266 ENSG00000103266 HGNC:11427 STXBP1 gene STXBP1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 4, MIM# 612164;Juvenile onset Parkinsonism Neurodegeneration;HP:0002180 25418441;32643187;29929108 False 3 100;0;0 6.47 True ENSG00000136854 ENSG00000136854 HGNC:11444 SYNE1 gene SYNE1 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 8;Cerebellar Ataxia;Autosomal recessive spinocerebellar ataxia type 8 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000131018 ENSG00000131018 HGNC:17089 SYNJ1 gene SYNJ1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease 20, early-onset, MIM# 615530 Neurodegeneration;HP:0002180 23804563;23804577;27496670;33841314 False 3 100;0;0 6.47 True ENSG00000159082 ENSG00000159082 HGNC:11503 TARDBP gene TARDBP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 10, with or without FTD;Frontotemporal lobar degeneration, TARDBP-related (MIM#612069;MONDO: 0012790) Neurodegeneration;HP:0002180 20301761;18309045;19609911 False 3 100;0;0 6.47 True ENSG00000120948 ENSG00000120948 HGNC:11571 TARDBP gene TARDBP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Amyotrophic lateral sclerosis 10, with or without FTD (MIM#612069) Neurodegeneration;HP:0002180 20301761;21803454 False 3 100;0;0 6.47 True ENSG00000120948 ENSG00000120948 HGNC:11571 TBC1D24 gene TBC1D24 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 16, MIM# 615338;Intellectual disability;Parkinsonism;Seizures;Psychosis Neurodegeneration;HP:0002180 PMID: 28663785;21087195 False 3 100;0;0 6.47 True ENSG00000162065 ENSG00000162065 HGNC:29203 TBK1 gene TBK1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 4, MIM# 616439 Neurodegeneration;HP:0002180 20301623 False 3 100;0;0 6.47 True ENSG00000183735 ENSG00000183735 HGNC:11584 TBK1 gene TBK1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 4 (MIM#616439;MONDO:0011223) Neurodegeneration;HP:0002180 20301623;25803835 False 3 100;0;0 6.47 True ENSG00000183735 ENSG00000183735 HGNC:11584 TH gene TH Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Tyrosine hydroxylase deficiency MONDO:0100064 Neurodegeneration;HP:0002180 20301334;20301610 False 3 100;0;0 6.47 True ENSG00000180176 ENSG00000180176 HGNC:11782 TMEM240 gene TMEM240 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 21, 607454 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000205090 ENSG00000205090 HGNC:25186 TPP1 gene TPP1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 2, MIM# 204500;Parkinsonism Neurodegeneration;HP:0002180 PMID: 21940688 False 3 100;0;0 6.47 True ENSG00000166340 ENSG00000166340 HGNC:2073 TREM2 gene TREM2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2, MIM# 618193;{Alzhieimer disease 17, susceptibility to}, MIM# 615080 Neurodegeneration;HP:0002180 12080485;15883308 False 3 100;0;0 6.47 True ENSG00000095970 ENSG00000095970 HGNC:17761 TREX1 gene TREX1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Retinal vasculopathy with cerebral leukoencephalopathy and systemic manifestations MONDO:0008641" Neurodegeneration;HP:0002180 29380913;35699195;36586737;35307828 False 3 100;0;0 6.47 True ENSG00000213689 ENSG00000213689 HGNC:12269 TTBK2 gene TTBK2 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 11, 604432;Spinocerebellar ataxia 11 Neurodegeneration;HP:0002180 False 3 50;50;0 6.47 False ENSG00000128881 ENSG00000128881 HGNC:19141 TTPA gene TTPA Expert Review Green;NHS GMS;Expert list;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia with isolated vitamin E deficiency;Ataxia with Vitamin E Deficiency;Ataxia with isolated vitamin E deficiency, 277460 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000137561 ENSG00000137561 HGNC:12404 TTR gene TTR Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyloidosis, hereditary, transthyretin-related, MIM# 105210 Neurodegeneration;HP:0002180 20301373 False 3 100;0;0 6.47 True ENSG00000118271 ENSG00000118271 HGNC:12405 TUBA4A gene TUBA4A Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 22 with or without frontotemporal dementia, MIM# 616208 Neurodegeneration;HP:0002180 25374358;28069311;35327632;34169147;38884572;33760283;26675813 False 3 50;50;0 6.47 True ENSG00000127824 ENSG00000127824 HGNC:12407 TUBA4A gene TUBA4A Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary ataxia MONDO:0100309, TUBA4A-related Neurodegeneration;HP:0002180 38884572;37418012 False 3 100;0;0 6.47 True Other ENSG00000127824 ENSG00000127824 HGNC:12407 TUBA4A gene TUBA4A Expert Review Green;Royal Melbourne Hospital;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 22 with or without frontotemporal dementia, MIM# 616208 Neurodegeneration;HP:0002180 25374358;25893256;28069311;38463699;38884572;26675813 False 3 50;50;0 6.47 True ENSG00000127824 ENSG00000127824 HGNC:12407 TUBA4A gene TUBA4A Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary ataxia MONDO:0100309, TUBA4A-related Neurodegeneration;HP:0002180 38884572;37418012 False 3 100;0;0 6.47 True ENSG00000127824 ENSG00000127824 HGNC:12407 TWNK gene TWNK Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3 MIM#609286 Neurodegeneration;HP:0002180 24076137;22949510;22580846;19353676 False 3 100;0;0 6.47 True ENSG00000107815 ENSG00000107815 HGNC:1160 TYROBP gene TYROBP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 1 (MIM#221770) Neurodegeneration;HP:0002180 20301376 False 3 100;0;0 6.47 True ENSG00000011600 ENSG00000011600 HGNC:12449 UBAP1 gene UBAP1 Expert Review Green;Literature;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 80, autosomal dominant 618418 Neurodegeneration;HP:0002180 31696996;32934340 False 3 100;0;0 6.47 True Other ENSG00000165006 ENSG00000165006 HGNC:12461 UBQLN2 gene UBQLN2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Amyotrophic lateral sclerosis 15, with or without frontotemporal dementia (MIM#300857) Neurodegeneration;HP:0002180 20301623;31319884;21857683;30348461 False 3 0;100;0 6.47 True ENSG00000188021 ENSG00000188021 HGNC:12509 UBQLN2 gene UBQLN2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Amyotrophic lateral sclerosis type 15 (MONDO:0010459;MIM#300857) Neurodegeneration;HP:0002180 20301623;21857683 False 3 100;0;0 6.47 True ENSG00000188021 ENSG00000188021 HGNC:12509 UBTF gene UBTF Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672;Parkinsonism;Dystonia;Chorea;Brain atrophy Neurodegeneration;HP:0002180 PubMed: 28777933;29300972 False 3 100;0;0 6.47 True ENSG00000108312 ENSG00000108312 HGNC:12511 VAC14 gene VAC14 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Striatonigral degeneration, childhood-onset, MIM# 617054;Dystonia;Parkinsonism Neurodegeneration;HP:0002180 PMID: 31392254;28502045 False 3 100;0;0 6.47 True ENSG00000103043 ENSG00000103043 HGNC:25507 VAPB gene VAPB Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinal muscular atrophy, late-onset, Finkel type (MIM# 182980);Amyotrophic lateral sclerosis 8 Neurodegeneration;HP:0002180 20301623;15372378 False 3 100;0;0 6.47 True ENSG00000124164 ENSG00000124164 HGNC:12649 VCP gene VCP Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Inclusion body myopathy with Paget disease of bone and frontotemporal dementia MONDO:0000507 Neurodegeneration;HP:0002180 38283104;38145206 False 3 100;0;0 6.47 True Other ENSG00000165280 ENSG00000165280 HGNC:12666 VCP gene VCP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 6 (ALS) (MIM#613954) Neurodegeneration;HP:0002180 20301649;20301623;21145000 False 3 100;0;0 6.47 True ENSG00000165280 ENSG00000165280 HGNC:12666 VCP gene VCP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Inclusion body myopathy with early-onset Paget disease and frontotemporal dementia 1 (MIM#167320);Frontotemporal dementia and/or amyotrophic lateral sclerosis 6 (MIM#613954) Neurodegeneration;HP:0002180 15034582;30103325;21145000 False 3 100;0;0 6.47 True ENSG00000165280 ENSG00000165280 HGNC:12666 VPS13A gene VPS13A Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Choreoacanthocytosis MIM#200150 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 False ENSG00000197969 ENSG00000197969 HGNC:1908 VPS13A gene VPS13A Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal chorea-acanthocytosis MONDO:0008695 Neurodegeneration;HP:0002180 20301561;37636221 False 3 100;0;0 6.47 True ENSG00000197969 ENSG00000197969 HGNC:1908 VPS13C gene VPS13C Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease 23, autosomal recessive, early onset MIM#616840 Neurodegeneration;HP:0002180 26942284;30452786;28862745 False 3 100;0;0 6.47 True ENSG00000129003 ENSG00000129003 HGNC:23594 VPS13C gene VPS13C Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "autosomal recessive early-onset Parkinson disease 23 MONDO:0014796" Neurodegeneration;HP:0002180 33579389;37330543;34875562 False 3 100;0;0 6.47 True ENSG00000129003 ENSG00000129003 HGNC:23594 VPS13D gene VPS13D Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 4, 607317 Neurodegeneration;HP:0002180 False 3 100;0;0 6.47 True ENSG00000048707 ENSG00000048707 HGNC:23595 VPS35 gene VPS35 Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown {Parkinson disease 17} MIM#614203;Cognitive decline Neurodegeneration;HP:0002180 False 3 0;0;0 6.47 False ENSG00000069329 ENSG00000069329 HGNC:13487 VPS35 gene VPS35 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Parkinson disease 17, MIM# 614203 Neurodegeneration;HP:0002180 21763482;21763483;22801713;34704029 False 3 100;0;0 6.47 True ENSG00000069329 ENSG00000069329 HGNC:13487 WARS2 gene WARS2 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinsonism-dystonia 3, childhood-onset, MIM# 619738 Neurodegeneration;HP:0002180 PMID: 29120065;34890876;31970218 False 3 100;0;0 6.47 True ENSG00000116874 ENSG00000116874 HGNC:12730 WASHC5 gene WASHC5 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 8, autosomal dominant, 603563;MONDO:0011339 Neurodegeneration;HP:0002180 23455931;17160902;31814071;26572744 False 3 100;0;0 6.47 True ENSG00000164961 ENSG00000164961 HGNC:28984 WDR45 gene WDR45 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Neurodegeneration with brain iron accumulation 5 MIM#300894 Neurodegeneration;HP:0002180 23435086 False 3 100;0;0 6.47 False ENSG00000196998 ENSG00000196998 HGNC:28912 WDR45 gene WDR45 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) X-linked complex neurodevelopmental disorder MONDO:0100148 Neurodegeneration;HP:0002180 28211668 False 3 100;0;0 6.47 True ENSG00000196998 ENSG00000196998 HGNC:28912 XK gene XK Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females McLeod syndrome with or without chronic granulomatous disease (MIM#300842) Neurodegeneration;HP:0002180 12899725 False 3 100;0;0 6.47 True ENSG00000047597 ENSG00000047597 HGNC:12811 XPR1 gene XPR1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Basal ganglia calcification, idiopathic, 6, MIM# 616413 Neurodegeneration;HP:0002180 25938945 False 3 100;0;0 6.47 True ENSG00000143324 ENSG00000143324 HGNC:12827 XRCC1 gene XRCC1 Royal Melbourne Hospital;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ocular motor apraxia, axonal neuropathy, and progressive cerebellar ataxia;Autosomal recessive spinocerebellar ataxia 26, 617633 Neurodegeneration;HP:0002180 29472272;28002403 False 3 100;0;0 6.47 False ENSG00000073050 ENSG00000073050 HGNC:12828 ZFYVE26 gene ZFYVE26 Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 15, autosomal recessive, 270700;MONDO:0010044 Neurodegeneration;HP:0002180 31385551 False 3 100;0;0 6.47 True ENSG00000072121 ENSG00000072121 HGNC:20761 ZFYVE26 gene ZFYVE26 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 15, autosomal recessive, MIM# 270700;Spastic paraplegia and retinal degeneration;Kjellin syndrome;Parkinsonism" Neurodegeneration;HP:0002180 PMID: 33033739;21462267 False 3 100;0;0 6.47 True ENSG00000072121 ENSG00000072121 HGNC:20761 AFG3L2 gene AFG3L2 Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 28, MIM# 610246;optic atrophy;spastic ataxia;L-dopa-responsive parkinsonism Neurodegeneration;HP:0002180 30252181;36110148 False 2 33;33;33 6.47 True ENSG00000141385 ENSG00000141385 HGNC:315 ANG gene ANG Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic Lateral Sclerosis 9 (MONDO: 0012753;MIM#611895) Neurodegeneration;HP:0002180 17886298;16501576;18087731;20301623 False 2 100;0;0 6.47 True ENSG00000214274 ENSG00000214274 HGNC:483 APOE gene APOE Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alzheimer disease 2, MIM# 104310 Neurodegeneration;HP:0002180 False 2 0;100;0 6.47 True ENSG00000130203 ENSG00000130203 HGNC:613 APP gene APP Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alzheimer disease 1, familial, MIM# 104300 Neurodegeneration;HP:0002180 False 2 0;100;0 6.47 True ENSG00000142192 ENSG00000142192 HGNC:620 ATP2B4 gene ATP2B4 Expert Review Amber;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Pure and complicated hereditary spastic paraplegia Neurodegeneration;HP:0002180 29691679;25798335;25119969 False 2 0;100;0 6.47 True ENSG00000058668 ENSG00000058668 HGNC:817 BICD2 gene BICD2 Expert Review Amber;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spinal muscular atrophy, lower extremity-predominant, 2A, autosomal dominant, MIM#615290;Spinal muscular atrophy, lower extremity-predominant, 2B, autosomal dominant, MIM#618291 Neurodegeneration;HP:0002180 23664120;25497877;24482476 False 2 0;100;0 6.47 True ENSG00000185963 ENSG00000185963 HGNC:17208 CCDC88C gene CCDC88C Expert Review Amber;Royal Melbourne Hospital;GeneReviews;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown autosomal dominant spinocerebellar ataxia;?Spinocerebellar ataxia 40, 616053 Neurodegeneration;HP:0002180 25062847;30398676 False 2 33;67;0 6.47 True ENSG00000015133 ENSG00000015133 HGNC:19967 CCNF gene CCNF Expert Review Amber;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 5, MIM# 619141 Neurodegeneration;HP:0002180 27080313 False 2 0;100;0 6.47 True ENSG00000162063 ENSG00000162063 HGNC:1591 CCNF gene CCNF Expert Review Amber;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 5, MIM# 619141 Neurodegeneration;HP:0002180 29102476;31577344;27080313;28105640;31445393;28852778 False 2 0;100;0 6.47 True ENSG00000162063 ENSG00000162063 HGNC:1591 CHP1 gene CHP1 Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 9, autosomal recessive, OMIM #618438 Neurodegeneration;HP:0002180 29379881;32787936 False 2 50;50;0 6.47 True ENSG00000187446 ENSG00000187446 HGNC:17433 COASY gene COASY Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration with brain iron accumulation 6, MIM# 615643 Neurodegeneration;HP:0002180 28489334;24360804 False 2 0;100;0 6.47 True ENSG00000068120 ENSG00000068120 HGNC:29932 COL4A2 gene COL4A2 Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Familial porencephaly MONDO:0020496 Neurodegeneration;HP:0002180 35699195;37272523;36300346 False 2 0;100;0 6.47 True ENSG00000134871 ENSG00000134871 HGNC:2203 CYLD gene CYLD Expert Review Amber;Literature;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amytrophic lateral sclerosis 8, MIM# 619132 Neurodegeneration;HP:0002180 32666117;32666099;32185393 False 2 25;50;25 6.47 True Other ENSG00000083799 ENSG00000083799 HGNC:2584 CYLD gene CYLD Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amytrophic lateral sclerosis 8, MIM# 619132 Neurodegeneration;HP:0002180 32185393 False 2 0;50;50 6.47 True ENSG00000083799 ENSG00000083799 HGNC:2584 DDC gene DDC Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aromatic L-amino acid decarboxylase deficiency, MIM# 608643;Infantile-onset parkinsonism & dystonia;Bulbar dysfunction;Oculogyric crisis;Autonomic dysfunction;Intellectual disability Neurodegeneration;HP:0002180 PMID: 33983693 False 2 50;50;0 6.47 True ENSG00000132437 ENSG00000132437 HGNC:2719 DHDDS gene DHDDS Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Developmental delay and seizures with or without movement abnormalities, MIM# 617836;Myoclonic Epilepsy;Parkinsonism;Ataxia;Intellectual disability Neurodegeneration;HP:0002180 PMID: 34837344;29100083 False 2 50;50;0 6.47 True ENSG00000117682 ENSG00000117682 HGNC:20603 DNAJC7 gene DNAJC7 Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown amyotrophic lateral sclerosis Neurodegeneration;HP:0002180 31768050 False 2 33;67;0 6.47 True ENSG00000168259 ENSG00000168259 HGNC:12392 EPM2A gene EPM2A Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 2A (Lafora), MIM# 254780;Progressive Myoclonic Epilepsy;Parkinsonism Neurodegeneration;HP:0002180 27574708;28818698 False 2 50;50;0 6.47 True ENSG00000112425 ENSG00000112425 HGNC:3413 ERBB4 gene ERBB4 Expert Review Amber;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 19 MIM#615515 Neurodegeneration;HP:0002180 24119685;28889094 False 2 100;0;0 6.47 True ENSG00000178568 ENSG00000178568 HGNC:3432 FDXR gene FDXR Expert Review Amber;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Auditory neuropathy and optic atrophy, 617717;Neurodevelopmental disorder with mitochondrial abnormalities, optic atrophy, and developmental regression, MIM# 620887 Neurodegeneration;HP:0002180 30250212;28965846;29040572;33348459;37046037;37481223 False 2 0;50;50 6.47 True ENSG00000161513 ENSG00000161513 HGNC:3642 FIG4 gene FIG4 Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic Lateral Sclerosis Type 11 (MONDO: 0012945;MIM#612577) Neurodegeneration;HP:0002180 False 2 100;0;0 6.47 True ENSG00000112367 ENSG00000112367 HGNC:16873 GBA gene GBA Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Other {Lewy body dementia, susceptibility to} (MIM# 127750) Neurodegeneration;HP:0002180 23588557;32439597;31010158 False 2 0;100;0 6.47 True ENSG00000177628 ENSG00000177628 HGNC:4177 GJC2 gene GJC2 Expert Review Amber;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 2, 608804, AR;Spastic paraplegia 44, autosomal recessive 613206, AR Neurodegeneration;HP:0002180 19056803;23684670 False 2 0;100;0 6.47 True ENSG00000198835 ENSG00000198835 HGNC:17494 GLT8D1 gene GLT8D1 Expert Review Amber;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis Neurodegeneration;HP:0002180 30811981 False 2 50;50;0 6.47 True ENSG00000016864 ENSG00000016864 HGNC:24870 HNRNPA1 gene HNRNPA1 Expert Review Amber;Other Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Inclusion body myopathy with early-onset Paget disease without frontotemporal dementia 3 MIM#615424;Amyotrophic lateral sclerosis 20 MIM#615426 Neurodegeneration;HP:0002180 24612671;24119545;23455423 False 2 0;0;100 6.47 True ENSG00000135486 ENSG00000135486 HGNC:5031 HNRNPA2B1 gene HNRNPA2B1 Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Inclusion body myopathy with early-onset Paget disease with or without frontotemporal dementia 2 MIM#615422 Neurodegeneration;HP:0002180 23455423;30279180;29358076;26744327;23635965 False 2 0;100;0 6.47 True ENSG00000122566 ENSG00000122566 HGNC:5033 HNRNPA2B1 gene HNRNPA2B1 Expert Review Amber;ClinGen Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted amyotrophic lateral sclerosis MONDO:0004976 Neurodegeneration;HP:0002180 25299611 False 2 0;0;100 6.47 True ENSG00000122566 ENSG00000122566 HGNC:5033 HSPD1 gene HSPD1 Expert Review Amber;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spastic paraplegia 13, autosomal dominant, MIM# 605280 Neurodegeneration;HP:0002180 26900593;11898127;17420924 False 2 0;100;0 6.47 True ENSG00000144381 ENSG00000144381 HGNC:5261 KIF5A gene KIF5A Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 10, autosomal dominant MIM#604187 Neurodegeneration;HP:0002180 18853458 False 2 0;100;0 6.47 True ENSG00000155980 ENSG00000155980 HGNC:6323 KIF5A gene KIF5A Expert Review Amber;Other Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis, susceptibility to, 25 MONDO:0060670 Neurodegeneration;HP:0002180 33077544;36604770 False 2 0;100;0 6.47 True Other ENSG00000155980 ENSG00000155980 HGNC:6323 LGALSL gene LGALSL Expert Review Amber;ClinGen Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown amyotrophic lateral sclerosis MONDO:0004976 Neurodegeneration;HP:0002180 30940688 False 2 0;100;0 6.47 True ENSG00000119862 ENSG00000119862 HGNC:25012 LYST gene LYST Expert Review Amber;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal spastic paraplegia;Spastic paraplegia;Chediak-Higashi syndrome, 214500 Neurodegeneration;HP:0002180 26307451;24521565 False 2 0;100;0 6.47 True ENSG00000143669 ENSG00000143669 HGNC:1968 MATR3 gene MATR3 Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 21 MIM#606070;frontotemporal dementia;multisystem proteinopathy Neurodegeneration;HP:0002180 24686783;30015619;28029397;33408686 False 2 0;100;0 6.47 True ENSG00000015479 ENSG00000015479 HGNC:6912 MTCL1 gene MTCL1 Expert Review Amber;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal spinocerebellar ataxia Neurodegeneration;HP:0002180 30548255;28283581 False 2 0;100;0 6.47 True ENSG00000168502 ENSG00000168502 HGNC:29121 NHLRC1 gene NHLRC1 Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 2B (Lafora), MIM# 254780;Lafora disease;Progressive Myoclonic Epilepsy;Parkinsonism Neurodegeneration;HP:0002180 22425593;32301727 False 2 50;50;0 6.47 True ENSG00000187566 ENSG00000187566 HGNC:21576 PLD3 gene PLD3 Expert Review Amber;Royal Melbourne Hospital;GeneReviews Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown ?Spinocerebellar ataxia 46 Neurodegeneration;HP:0002180 30312375;30312384;29053796 False 2 0;100;0 6.47 False ENSG00000105223 ENSG00000105223 HGNC:17158 PNPLA6 gene PNPLA6 Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal PNPLA6-related spastic paraplegia with or without ataxia MONDO:0100149 Neurodegeneration;HP:0002180 32623594;36825042 False 2 0;100;0 6.47 True ENSG00000032444 ENSG00000032444 HGNC:16268 PNPT1 gene PNPT1 Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spinocerebellar ataxia 25, MIM# 608703" Neurodegeneration;HP:0002180 35411967;37935417 False 2 50;50;0 6.47 True ENSG00000138035 ENSG00000138035 HGNC:23166 POLG gene POLG Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Mitochondrial DNA depletion syndrome 4a MONDO:0008758" Neurodegeneration;HP:0002180 15477547;14694057;16638794 False 2 0;100;0 6.47 True ENSG00000140521 ENSG00000140521 HGNC:9179 PRPH gene PRPH Expert Review Amber;Expert Review Amber;Expert list;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal {Amyotrophic lateral sclerosis, susceptibility to}, 105400 Neurodegeneration;HP:0002180 20363051;15322088;15446584 False 2 0;100;0 6.47 True ENSG00000135406 ENSG00000135406 HGNC:9461 PRPS1 gene PRPS1 Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Adult-onset progressive ataxia, congenital strabismus, infantile-onset hearing loss, retinal dystrophy Neurodegeneration;HP:0002180 33898739;28967191 False 2 33;67;0 6.47 True ENSG00000147224 ENSG00000147224 HGNC:9462 PTPA gene PTPA Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Intellectual disability, MONDO: 36073231, PTPA-related;Parkisonism Neurodegeneration;HP:0002180 36073231;37448355 False 2 0;100;0 6.47 True ENSG00000119383 ENSG00000119383 HGNC:9308 RAB32 gene RAB32 Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Parkinson disease 26, autosomal dominant, susceptibility to}, MIM# 620923 Neurodegeneration;HP:0002180 38614108;38858457 False 2 0;50;50 6.47 True Other ENSG00000118508 ENSG00000118508 HGNC:9772 RNF13 gene RNF13 Expert Review Amber;Literature;Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Amyotrophic lateral sclerosis Neurodegeneration;HP:0002180 PMID: 35879052 False 2 50;50;0 6.47 True ENSG00000082996 ENSG00000082996 HGNC:10057 SDHA gene SDHA Expert Review Amber;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration with ataxia and late-onset optic atrophy, MIM# 619259 Neurodegeneration;HP:0002180 10976639;27683074 False 2 0;100;0 6.47 True ENSG00000073578 ENSG00000073578 HGNC:10680 SQSTM1 gene SQSTM1 Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 3 (MIM#616437) Neurodegeneration;HP:0002180 22084127;22972638 False 2 0;100;0 6.47 True ENSG00000161011 ENSG00000161011 HGNC:11280 SQSTM1 gene SQSTM1 Expert Review Amber;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Frontotemporal dementia and/or amyotrophic lateral sclerosis 3 MONDO:0014640" Neurodegeneration;HP:0002180 False 2 100;0;0 6.47 True ENSG00000161011 ENSG00000161011 HGNC:11280 SS18L1 gene SS18L1 Expert Review Amber;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted amyotrophic lateral sclerosis (MONDO:0004976) Neurodegeneration;HP:0002180 25888396;24360741;23708140;30976389 False 2 50;50;0 6.47 True ENSG00000184402 ENSG00000184402 HGNC:15592 TAF15 gene TAF15 Expert Review Amber;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Amyotrophic lateral sclerosis;Frontotemporal dementia Neurodegeneration;HP:0002180 28889094 False 2 0;100;0 6.47 False ENSG00000172660 ENSG00000270647 HGNC:11547 TAF15 gene TAF15 Expert Review Amber;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis Neurodegeneration;HP:0002180 21438137;22065782;27810362;28889094 False 2 0;100;0 6.47 True ENSG00000172660 ENSG00000270647 HGNC:11547 TDP1 gene TDP1 Expert Review Amber;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 1 , MIM# 607250 Neurodegeneration;HP:0002180 31182267;12244316 False 2 0;100;0 6.47 True ENSG00000042088 ENSG00000042088 HGNC:18884 TIA1 gene TIA1 Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Other Multisystem proteinopathy Neurodegeneration;HP:0002180 36861178;29599744;29457785 False 2 0;100;0 6.47 True ENSG00000116001 ENSG00000116001 HGNC:11802 TIA1 gene TIA1 Expert Review Amber;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Amyotrophic lateral sclerosis 26 with or without frontotemporal dementia 619133" Neurodegeneration;HP:0002180 29235362;29886022;29773329;29699721;29216908;24659297;29457785;28817800 False 2 0;100;0 6.47 True ENSG00000116001 ENSG00000116001 HGNC:11802 TRPC3 gene TRPC3 Expert Review Amber;Royal Melbourne Hospital;GeneReviews Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodegeneration;HP:0002180 25477146;26112884 False 2 0;100;0 6.47 True ENSG00000138741 ENSG00000138741 HGNC:12335 TUBB4A gene TUBB4A Expert Review Amber;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ataxia;Leukodystrophy, hypomyelinating, 612438 AD;Dystonia 4, torsion, autosomal dominant, 128101 Neurodegeneration;HP:0002180 23582646;24850488 False 2 0;100;0 6.47 True ENSG00000104833 ENSG00000104833 HGNC:20774 UBQLN4 gene UBQLN4 Expert Review Amber;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis Neurodegeneration;HP:0002180 28463112;30804504 False 2 0;100;0 6.47 False ENSG00000160803 ENSG00000160803 HGNC:1237 UQCRC1 gene UQCRC1 Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Parkinsonism with polyneuropathy, MIM# 619279 Neurodegeneration;HP:0002180 33141179;33248804 False 2 0;100;0 6.47 True ENSG00000010256 ENSG00000010256 HGNC:12585 VAMP1 gene VAMP1 Expert Review Amber;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic ataxia 1, autosomal dominant, 108600 Neurodegeneration;HP:0002180 22958904 False 2 0;100;0 6.47 True ENSG00000139190 ENSG00000139190 HGNC:12642 VAMP1 gene VAMP1 Expert Review Amber;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Autosomal dominant spastic ataxia 1, 108600;Spastic ataxia 1, autosomal dominant, 108600 Neurodegeneration;HP:0002180 22958904 False 2 0;100;0 6.47 True ENSG00000139190 ENSG00000139190 HGNC:12642 VRK1 gene VRK1 Expert Review Amber;Royal Melbourne Hospital;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Adult-onset spinal muscular atrophy without pontocerebellar hypoplasia;Distal hereditary motor neuropathy;dHMN/dSMA Neurodegeneration;HP:0002180 31560180;32242460;31178479;31837156;30847374;34169149;26583493 False 2 0;50;50 6.47 True ENSG00000100749 ENSG00000100749 HGNC:12718 ZFYVE26 gene ZFYVE26 Expert Review Amber;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spastic paraplegia 15, 270700 Neurodegeneration;HP:0002180 24367272;18394578 False 2 50;50;0 6.47 True ENSG00000072121 ENSG00000072121 HGNC:20761 AIFM1 gene AIFM1 Expert Review Red;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Neurodegeneration;HP:0002180 False 1 50;0;50 6.47 False ENSG00000156709 ENSG00000156709 HGNC:8768 ALPL gene ALPL Expert Review Red;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Hypophosphatasia, adult, MIM# 146300;Osteomalacia;Parkinsonism Neurodegeneration;HP:0002180 PMID: 32956941 False 1 50;0;50 6.47 True ENSG00000162551 ENSG00000162551 HGNC:438 ALS2 gene ALS2 Expert Review Red;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Neurodegeneration;HP:0002180 False 1 0;0;100 6.47 True ENSG00000003393 ENSG00000003393 HGNC:443 ANG gene ANG Expert Review Red;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Neurodegeneration;HP:0002180 False 1 0;0;100 6.47 True ENSG00000214274 ENSG00000214274 HGNC:483 ANG gene ANG Expert Review Red;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Parkinson disease MONDO:0005180 Neurodegeneration;HP:0002180 33875291;25386690 False 1 0;0;100 6.47 True ENSG00000214274 ENSG00000214274 HGNC:483 ARPP21 gene ARPP21 ClinGen Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted amyotrophic lateral sclerosis MONDO:0004976 Neurodegeneration;HP:0002180 30811981;31653410;35525134 False 1 0;0;100 6.47 False ENSG00000172995 ENSG00000172995 HGNC:16968 ASAH1 gene ASAH1 Expert Review Red;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinal muscular atrophy with progressive myoclonic epilepsy, 159950 Neurodegeneration;HP:0002180 False 1 50;0;50 6.47 True ENSG00000104763 ENSG00000104763 HGNC:735 ATP1A2 gene ATP1A2 Expert Review Red;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alternating hemiplegia of childhood 1, 104290;Familial hemiplegic migraine 2, 602481 Neurodegeneration;HP:0002180 False 1 0;0;100 6.47 True ENSG00000018625 ENSG00000018625 HGNC:800 ATP7A gene ATP7A Expert Review Red;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Spinal muscular atrophy, distal, X-linked 3, 300489 Neurodegeneration;HP:0002180 False 1 67;0;33 6.47 True ENSG00000165240 ENSG00000165240 HGNC:869 ATP7B gene ATP7B Expert Review Red;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Wilson disease 277900;Wilson disease, 277900 Neurodegeneration;HP:0002180 False 1 0;0;100 6.47 True ENSG00000123191 ENSG00000123191 HGNC:870 ATP7B gene ATP7B Expert Review Red;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Neurodegeneration;HP:0002180 False 1 0;0;100 6.47 True ENSG00000123191 ENSG00000123191 HGNC:870 BICD2 gene BICD2 Expert Review Red;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinal muscular atrophy, lower extremity-predominant, 2A, autosomal dominant, 615290;Spinal muscular atrophy, lower extremity-predominant, 2B, autosomal dominant, 618291 Neurodegeneration;HP:0002180 False 1 67;0;33 6.47 True ENSG00000185963 ENSG00000185963 HGNC:17208 CACNB4 gene CACNB4 Expert Review Red;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic ataxia type 5, 613855 Neurodegeneration;HP:0002180 10762541;27003325;9628818 False 1 0;50;50 6.47 True ENSG00000182389 ENSG00000182389 HGNC:1404 CHCHD10 gene CHCHD10 Expert Review Red;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted autosomal dominant mitochondrial myopathy with exercise intolerance MONDO:0014532 Neurodegeneration;HP:0002180 24934289 False 1 0;0;100 6.47 True ENSG00000250479 ENSG00000250479 HGNC:15559 COQ7 gene COQ7 Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary spastic paraplegia, COQ7-related (MONDO#0019064) Neurodegeneration;HP:0002180 PMID: 33215859 False 1 0;0;100 6.47 False ENSG00000167186 ENSG00000167186 HGNC:2244 DAO gene DAO Expert Review Red;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic Lateral Sclerosis Neurodegeneration;HP:0002180 29274788;29895397;20368421;29194436 False 1 0;0;100 6.47 True ENSG00000110887 ENSG00000110887 HGNC:2671 DCAF17 gene DCAF17 Expert Review Red;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Neurodegeneration;HP:0002180 False 1 0;0;100 6.47 True ENSG00000115827 ENSG00000115827 HGNC:25784 DNAJC13 gene DNAJC13 Expert Review Red;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration;HP:0002180 30788857;24218364;29309590;31082451;29887357;27270108 False 1 0;100;0 6.47 True ENSG00000138246 ENSG00000138246 HGNC:30343 DNM2 gene DNM2 Expert Review Red;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Complicated hereditary spastic paraplegia Neurodegeneration;HP:0002180 26517984 False 1 0;0;100 6.47 True ENSG00000079805 ENSG00000079805 HGNC:2974 DYNC1H1 gene DYNC1H1 Expert Review Red;Royal Melbourne Hospital;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinal muscular atrophy, lower extremity-predominant 1, AD, MIM# 158600 Neurodegeneration;HP:0002180 False 1 50;0;50 6.47 True ENSG00000197102 ENSG00000197102 HGNC:2961 EEF2 gene EEF2 Expert Review Red;Royal Melbourne Hospital;GeneReviews;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown ?Spinocerebellar ataxia 26 Neurodegeneration;HP:0002180 15732118;23001565 False 1 100;0;0 6.47 True ENSG00000167658 ENSG00000167658 HGNC:3214 ERLIN1 gene ERLIN1 Expert Review Red;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Amyotrophic lateral sclerosis Neurodegeneration;HP:0002180 29453415 False 1 0;0;100 6.47 True ENSG00000107566 ENSG00000107566 HGNC:16947 EWSR1 gene EWSR1 Expert Review Red;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis Neurodegeneration;HP:0002180 29731676;22454397 False 1 0;100;0 6.47 True ENSG00000182944 ENSG00000182944 HGNC:3508 EXOSC8 gene EXOSC8 Expert Review Red;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 1C, MIM# 616081 Neurodegeneration;HP:0002180 24989451 False 1 0;0;100 6.47 True ENSG00000120699 ENSG00000120699 HGNC:17035 FA2H gene FA2H Expert Review Red;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 35, autosomal recessive, MIM# 612319 Neurodegeneration;HP:0002180 False 1 0;0;100 6.47 True ENSG00000103089 ENSG00000103089 HGNC:21197 FIG4 gene FIG4 Expert Review Red;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Neurodegeneration;HP:0002180 False 1 0;0;100 6.47 True ENSG00000112367 ENSG00000112367 HGNC:16873 FUS gene FUS Expert Review Red;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "tremor, hereditary essential, 4 MONDO:0013888" Neurodegeneration;HP:0002180 22863194;23834483;23825177;38626532 False 1 0;0;100 6.47 True ENSG00000089280 ENSG00000089280 HGNC:4010 GCH1 gene GCH1 Expert Review Red;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Neurodegeneration;HP:0002180 False 1 0;0;100 6.47 True ENSG00000131979 ENSG00000131979 HGNC:4193 GIGYF2 gene GIGYF2 Expert Review Red;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Parkinson disease 11} , OMIM # 607688 Neurodegeneration;HP:0002180 18358451;33239198;25279164;20060621;19250854;26152800;19449032 False 1 0;50;50 6.47 True ENSG00000204120 ENSG00000204120 HGNC:11960 GNE gene GNE Expert Review Green;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Amyotrophic lateral sclerosis Neurodegeneration;HP:0002180 29086072 False 1 50;0;50 6.47 False ENSG00000159921 ENSG00000159921 HGNC:23657 GSN gene GSN Expert Review Red;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyloidosis, Finnish type MIM#105120 Neurodegeneration;HP:0002180 False 1 0;0;100 6.47 True ENSG00000148180 ENSG00000148180 HGNC:4620 HEXA gene HEXA Expert Review Red;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GM2 Gangliosidosis;Tay-Sachs disease;Parkinsonism;OMIM 272800 Neurodegeneration;HP:0002180 PMID: 33069254 False 1 50;0;50 6.47 True ENSG00000213614 ENSG00000213614 HGNC:4878 HTRA2 gene HTRA2 Expert Review Red;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Neurodegeneration;HP:0002180 False 1 0;0;100 6.47 True ENSG00000115317 ENSG00000115317 HGNC:14348 IFRD1 gene IFRD1 Expert Review Red;Expert Review;Expert Review Red;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 18 MIM#607458 Neurodegeneration;HP:0002180 29362493;28601596;19409521 False 1 0;0;100 6.47 True ENSG00000006652 ENSG00000006652 HGNC:5456 IGHMBP2 gene IGHMBP2 Expert Review Red;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuronopathy, distal hereditary motor, type VI 604320 Neurodegeneration;HP:0002180 False 1 50;0;50 6.47 True ENSG00000132740 ENSG00000132740 HGNC:5542 LAS1L gene LAS1L Expert Review Green;Expert Review Red;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females congenital lethal motor neuron disease Neurodegeneration;HP:0002180 24647030 False 1 50;0;50 6.47 True ENSG00000001497 ENSG00000001497 HGNC:25726 MME gene MME Expert Review Green;Royal Melbourne Hospital;GeneReviews;Expert Review Red;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ?Spinocerebellar ataxia type 43, 617018 Neurodegeneration;HP:0002180 27583304 False 1 50;0;50 6.47 False ENSG00000196549 ENSG00000196549 HGNC:7154 NEFH gene NEFH Expert Review Red;ClinGen Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted amyotrophic lateral sclerosis MONDO:0004976 Neurodegeneration;HP:0002180 False 1 0;0;100 6.47 True ENSG00000100285 ENSG00000100285 HGNC:7737 NOL3 gene NOL3 Expert Review Red;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Myoclonus, familial cortical Neurodegeneration;HP:0002180 22926851 False 1 0;0;100 6.47 True ENSG00000140939 ENSG00000140939 HGNC:7869 NR4A2 gene NR4A2 Expert Review Red;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Neurodegeneration;HP:0002180 False 1 0;0;100 6.47 True ENSG00000153234 ENSG00000153234 HGNC:7981 OPA3 gene OPA3 Expert Review Red;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Neurodegeneration;HP:0002180 False 1 0;0;100 6.47 True ENSG00000125741 ENSG00000125741 HGNC:8142 PLEKHG5 gene PLEKHG5 Expert Review Red;Royal Melbourne Hospital;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinal muscular atrophy, distal, autosomal recessive, 4, MIM# 611067 Neurodegeneration;HP:0002180 17564964 False 1 0;0;100 6.47 True ENSG00000171680 ENSG00000171680 HGNC:29105 PODXL gene PODXL Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown juvenile-onset Parkinson disease Neurodegeneration;HP:0002180 26864383;20706633 False 1 0;100;0 6.47 False ENSG00000128567 ENSG00000128567 HGNC:9171 PPIA gene PPIA Expert Review Red;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted amyotrophic lateral sclerosis, MONDO:0004976, PPIA-associated Neurodegeneration;HP:0002180 34972208 False 1 0;0;100 6.47 True ENSG00000196262 ENSG00000196262 HGNC:9253 PSEN2 gene PSEN2 Expert Review Red;Other Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Parkinsonism;Alzheimer disease-4 MIM#606889 Neurodegeneration;HP:0002180 22118943;26422362;18427071;29692703 False 1 0;0;100 6.47 True ENSG00000143801 ENSG00000143801 HGNC:9509 RIC3 gene RIC3 Expert Review Red;Other Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Parkinson disease Neurodegeneration;HP:0002180 27055476;28153381;28606768;32794657 False 1 0;0;100 6.47 True ENSG00000166405 ENSG00000166405 HGNC:30338 SEPSECS gene SEPSECS Expert Review Red;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia type 2D, 613811;cerebellar ataxia and cognitive impairment Neurodegeneration;HP:0002180 29464431 False 1 50;0;50 6.47 True ENSG00000109618 ENSG00000109618 HGNC:30605 SETX gene SETX Expert Review Red;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Neurodegeneration;HP:0002180 False 1 0;0;100 6.47 False ENSG00000107290 ENSG00000107290 HGNC:445 SLC33A1 gene SLC33A1 Expert Review Red;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 42, autosomal dominant;Congenital cataracts, hearing loss, and neurodegeneration 614482, AR:Spastic paraplegia 42, autosomal dominant, 612539 AD Neurodegeneration;HP:0002180 27935820;19061983 False 1 0;0;100 6.47 True ENSG00000169359 ENSG00000169359 HGNC:95 SLC52A1 gene SLC52A1 Expert Review Red;Expert Review Red;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Riboflavin deficiency, MIM#615026 Neurodegeneration;HP:0002180 29122468;17689999 False 1 0;0;100 6.47 True ENSG00000132517 ENSG00000132517 HGNC:30225 SNCB gene SNCB Expert Review Red;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dementia, Lewy body, MIM#127750 Neurodegeneration;HP:0002180 15365127;20697047 False 1 0;0;100 6.47 True ENSG00000074317 ENSG00000074317 HGNC:11140 SOD1 gene SOD1 Expert Review Red;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Neurodegeneration;HP:0002180 False 1 0;0;100 6.47 False ENSG00000142168 ENSG00000142168 HGNC:11179 SPART gene SPART Expert Review Red;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Neurodegeneration;HP:0002180 False 1 0;0;100 6.47 False ENSG00000133104 ENSG00000133104 HGNC:18514 SYT14 gene SYT14 Expert Review Red;Royal Melbourne Hospital;GeneReviews;Expert Review Red;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ?Spinocerebellarataxia,autosomalrecessive11,614229 Neurodegeneration;HP:0002180 21835308 False 1 0;0;100 6.47 False ENSG00000143469 ENSG00000143469 HGNC:23143 TET2 gene TET2 Expert Review Red;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dementia Neurodegeneration;HP:0002180 32330418;31943063 False 1 0;0;100 6.47 True ENSG00000168769 ENSG00000168769 HGNC:25941 TGM6 gene TGM6 Expert Review Red;Expert Review Red;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 35, 613908;Spinocerebellar ataxia 35 Neurodegeneration;HP:0002180 25253745;21106500;28934387;22554020;30670339;29053796;23206699 False 1 0;0;100 6.47 True ENSG00000166948 ENSG00000166948 HGNC:16255 TH gene TH Expert Review Red;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Neurodegeneration;HP:0002180 False 1 0;0;100 6.47 False ENSG00000180176 ENSG00000180176 HGNC:11782 TMEM230 gene TMEM230 Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Parkinson disease 21, MIM#616361 Neurodegeneration;HP:0002180 30804554;27270108;28115417;28017548;30804555;30804556;31323517 False 1 0;100;0 6.47 False ENSG00000089063 ENSG00000089063 HGNC:15876 TRIP4 gene TRIP4 Expert Review Red;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinal muscular atrophy with congenital bone fractures 1, MIM# 616866 Neurodegeneration;HP:0002180 26924529 False 1 0;0;100 6.47 True ENSG00000103671 ENSG00000103671 HGNC:12310 TRPV4 gene TRPV4 Expert Review Red;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinal muscular atrophy, distal, congenital nonprogressive, 600175 Neurodegeneration;HP:0002180 False 1 50;0;50 6.47 True ENSG00000111199 ENSG00000111199 HGNC:18083 TSEN54 gene TSEN54 Expert list;Expert Review Red;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown adult-onset cerebellar ataxia Neurodegeneration;HP:0002180 24938831 False 1 0;0;100 6.47 False ENSG00000182173 ENSG00000182173 HGNC:27561 TSPOAP1 gene TSPOAP1 Expert Review Red;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia 22, MIM# 620453 Neurodegeneration;HP:0002180 33539324 False 1 0;50;50 6.47 True ENSG00000005379 ENSG00000005379 HGNC:16831 TUBB4A gene TUBB4A Expert Review Red;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration;HP:0002180 False 1 0;0;100 6.47 True ENSG00000104833 ENSG00000104833 HGNC:20774 UBA1 gene UBA1 Expert Review Red;Expert Review Green;Expert list;Royal Melbourne Hospital;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Spinal muscular atrophy, X-linked 2, infantile, MIM# 301830 Neurodegeneration;HP:0002180 18179898;32181232;31932168;29034082;27699224;26028276;23518311 False 1 50;0;50 6.47 True ENSG00000130985 ENSG00000130985 HGNC:12469 UCHL1 gene UCHL1 Expert Review Red;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Neurodegeneration;HP:0002180 False 1 0;0;100 6.47 False ENSG00000154277 ENSG00000154277 HGNC:12513 VAPB gene VAPB Expert Review Red;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Amyotrophic lateral sclerosis 8 MIM#608627;Spinal muscular atrophy, late-onset, Finkel type MIM#182980 Neurodegeneration;HP:0002180 False 1 0;0;100 6.47 False ENSG00000124164 ENSG00000124164 HGNC:12649 VWA3B gene VWA3B Expert Review Red;Royal Melbourne Hospital;GeneReviews Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ?Spinocerebellar ataxia, autosomal recessive 22 Neurodegeneration;HP:0002180 26157035 False 1 0;0;100 6.47 False ENSG00000168658 ENSG00000168658 HGNC:28385 WASL gene WASL Expert Review Red;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson's disease, MONDO:0005180, WASL-related Neurodegeneration;HP:0002180 PMID: 33571872 False 1 50;0;50 6.47 True ENSG00000106299 ENSG00000106299 HGNC:12735 ZFYVE27 gene ZFYVE27 Expert Review Red;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 33, autosomal dominant, MIM#610244 Neurodegeneration;HP:0002180 29980238;18606302;16826525 False 1 0;0;100 6.47 True ENSG00000155256 ENSG00000155256 HGNC:26559 ATXN1_CAG str ATXN1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar Ataxia type 1;Parkinsonism;OMIM 164400 Neurodegeneration;HP:0002180 " PMID: 24602359" False 3 100;0;0 6.47 True ENSG00000124788 ENSG00000124788 HGNC:10548 6 16327867 16327953 16327636 16327722 CAG 36 45 CANVAS str RFC1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575 Neurodegeneration;HP:0002180 30926972 False 3 100;0;0 6.47 False ENSG00000035928 ENSG00000035928 HGNC:9969 4 39350045 39350103 39348425 39348483 AAGGG 0 400 CJD str PRNP Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440 Neurodegeneration;HP:0002180 2159587;20301407 False 3 100;0;0 6.47 True ENSG00000171867 ENSG00000171867 HGNC:9449 20 4680026 4680073 4699380 4699427 GGTGGTGGCTGGGGGCAGCCTCAT 4 5 DRPLA str ATN1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dentatorubral-pallidoluysian atrophy MIM#125370 Neurodegeneration;HP:0002180 29325606;20301664 False 3 100;0;0 6.47 True ENSG00000111676 ENSG00000111676 HGNC:3033 12 7045892 7045936 6936729 6936773 CAG 35 48 DRPLA str ATN1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dentatorubral-pallidoluysian atrophy MIM#125370 Neurodegeneration;HP:0002180 29325606;20301664 False 3 100;0;0 6.47 False ENSG00000111676 ENSG00000111676 HGNC:3033 12 7045892 7045936 6936729 6936773 CAG 35 48 EPM1 str CSTB Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800 Neurodegeneration;HP:0002180 29325606;20301321 False 3 100;0;0 6.47 False ENSG00000160213 ENSG00000160213 HGNC:2482 21 45196325 45196360 43776444 43776479 CCCCGCCCCGCG 3 30 FRDA str FXN Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Friedreich ataxia MIM#229300 Neurodegeneration;HP:0002180 20301458 False 3 100;0;0 6.47 False ENSG00000165060 ENSG00000165060 HGNC:3951 9 71652203 71652220 69037287 69037304 GAA 33 66 FTDALS str C9orf72 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550 Neurodegeneration;HP:0002180 25577942;21944779;21944778;31779815 False 3 100;0;0 6.47 True ENSG00000147894 ENSG00000147894 HGNC:28337 9 27573427 27573544 27573529 27573546 GGGGCC 25 60 FTDALS str C9orf72 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550 Neurodegeneration;HP:0002180 25577942;21944779;21944778 False 3 100;0;0 6.47 True ENSG00000147894 ENSG00000147894 HGNC:28337 9 27573427 27573544 27573529 27573546 GGGGCC 25 60 FTDALS str C9orf72 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550 Neurodegeneration;HP:0002180 25577942;21944779;21944778 False 3 100;0;0 6.47 True ENSG00000147894 ENSG00000147894 HGNC:28337 9 27573427 27573544 27573529 27573546 GGGGCC 25 60 FXTAS str FMR1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Fragile X tremor/ataxia syndrome MIM#300623 Neurodegeneration;HP:0002180 27340021;28176767;20301558;23765048;25227148;11445641 False 3 100;0;0 6.47 True ENSG00000102081 ENSG00000102081 HGNC:3775 X 146993569 146993628 147912051 147912110 CGG 44 55 FXTAS str FMR1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Fragile X tremor/ataxia syndrome MIM#300623 Neurodegeneration;HP:0002180 23765048;25227148 False 3 100;0;0 6.47 False ENSG00000102081 ENSG00000102081 HGNC:3775 X 146993569 146993628 147912051 147912110 CGG 44 55 HD str HTT Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Huntington disease MIM#143100 Neurodegeneration;HP:0002180 20301482;29325606 False 3 100;0;0 6.47 False ENSG00000197386 ENSG00000197386 HGNC:4851 4 3076604 3076666 3074877 3074939 CAG 26 40 HDL2 str JPH3 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Huntington disease-like 2 MIM#606438 Neurodegeneration;HP:0002180 20301701 False 3 100;0;0 6.47 False ENSG00000154118 ENSG00000154118 HGNC:14203 16 87637894 87637935 87604288 87604329 CTG 28 40 LRP12-ALS_CGG str LRP12 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Amyotrophic lateral sclerosis MONDO:0004976;Amyotrophic lateral sclerosis 28, MIM# 620452" Neurodegeneration;HP:0002180 37339631 False 3 100;0;0 6.47 True ENSG00000147650 ENSG00000147650 HGNC:31708 8 105601201 105601227 104588973 104588999 CGG 50 61 NIID str NOTCH2NL Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuronal intranuclear inclusion disease MIM#603472;Oculopharyngodistal myopathy 3 MIM#619473;Tremor, hereditary essential, 6 MIM#618866 Neurodegeneration;HP:0002180 31178126;31332381;31819945;33887199;33943039;32250060;31332380;32852534;32989102;34333668 False 3 100;0;0 6.47 True ENSG00000213240 ENSG00000264343 HGNC:31862 1 145209324 145209344 149390803 149390829 GGC 40 60 NIID str NOTCH2NL Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuronal intranuclear inclusion disease MIM#603472;Oculopharyngodistal myopathy 3 MIM#619473;Tremor, hereditary essential, 6 MIM#618866 Neurodegeneration;HP:0002180 31178126;31332381;31819945;33887199;33943039;32250060;31332380;32852534;32989102;34333668 False 3 100;0;0 6.47 False ENSG00000213240 ENSG00000264343 HGNC:31862 1 145209324 145209344 149390803 149390829 GGC 40 60 SBMA str AR Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Spinal and bulbar muscular atrophy of Kennedy MIM#313200 Neurodegeneration;HP:0002180 20301508;29325606 False 3 100;0;0 6.47 True ENSG00000169083 ENSG00000169083 HGNC:644 X 66765160 66765225 67545318 67545383 CAG 34 38 SCA1 str ATXN1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 1 MIM#164400 Neurodegeneration;HP:0002180 29325606;20301363 False 3 100;0;0 6.47 False ENSG00000124788 ENSG00000124788 HGNC:10548 6 16327918 16327953 16327687 16327722 CAG 35 39 SCA10 str ATXN10 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 10 MIM#603516 Neurodegeneration;HP:0002180 20301354 False 3 0;0;0 6.47 False ENSG00000130638 ENSG00000130638 HGNC:10549 22 46191235 46191304 45795355 45795424 ATTCT 32 800 SCA12 str PPP2R2B Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 12 MIM#604326 Neurodegeneration;HP:0002180 27864267;33811808 False 3 100;0;0 6.47 True ENSG00000156475 ENSG00000156475 HGNC:9305 5 146258292 146258321 146878729 146878758 CAG 32 51 SCA17 str TBP Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 17 MIM#607136 Neurodegeneration;HP:0002180 20301611;29325606 False 3 100;0;0 6.47 False ENSG00000112592 ENSG00000112592 HGNC:11588 6 170870996 170871109 170561908 170562021 CAG 40 49 SCA17 str TBP Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 17 MIM#607136 Neurodegeneration;HP:0002180 10484774;20301611 False 3 100;0;0 6.47 True ENSG00000112592 ENSG00000112592 HGNC:11588 6 170870996 170871109 170561908 170562021 CAG 40 49 SCA2 str ATXN2 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 2 MIM#183090 Neurodegeneration;HP:0002180 29325606;20301452 False 3 100;0;0 6.47 False ENSG00000204842 ENSG00000204842 HGNC:10555 12 112036755 112036823 111598951 111599019 CAG 31 35 SCA2 str ATXN2 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 2 MIM#183090 Neurodegeneration;HP:0002180 20301452 False 3 100;0;0 6.47 True ENSG00000204842 ENSG00000204842 HGNC:10555 12 112036755 112036823 111598951 111599016 CAG 31 35 SCA27B str FGF14 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia type 27B MONDO:0012247;Spinocerebellar ataxia 50;late-onset cerebellar ataxias (LOCAs) Neurodegeneration;HP:0002180 37165652;36516086;36493768 False 3 100;0;0 6.47 True ENSG00000102466 ENSG00000102466 HGNC:3671 13 102813926 102814076 102161576 102161726 GAA 249 300 SCA3 str ATXN3 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Machado-Joseph disease MIM#109150;Spinocerebellar ataxia type 3 Neurodegeneration;HP:0002180 20301375;29325606 False 3 100;0;0 6.47 False ENSG00000066427 ENSG00000066427 HGNC:7106 14 92537355 92537396 92071011 92071052 CAG 44 60 SCA31 str BEAN1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 31 MIM#117210 Neurodegeneration;HP:0002180 19878914;31755042 False 3 100;0;0 6.47 False ENSG00000166546 ENSG00000166546 HGNC:24160 16 66524301 66524302 66490398 66490399 TGGAA 22 80 SCA36 str NOP56 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 36 MIM#614153 Neurodegeneration;HP:0002180 21683323 False 3 100;0;0 6.47 False ENSG00000101361 ENSG00000101361 HGNC:15911 20 2633380 2633403 2652734 2652757 GGCCTG 14 650 SCA37 str DAB1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 37 MIM#615945 Neurodegeneration;HP:0002180 28686858;31145571 False 3 100;0;0 6.47 False ENSG00000173406 ENSG00000173406 HGNC:2661 1 57832716 57832797 57367044 57367121 ATTTC 0 31 SCA4_ZFHX3_GGC str ZFHX3 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted spinocerebellar ataxia type 4 MONDO:0010847 Neurodegeneration;HP:0002180 38035881;38197134 False 3 100;0;0 6.47 True ENSG00000140836 ENSG00000140836 HGNC:777 16 72821594 72821657 72787695 72787758 GGC 30 48 SCA6 str CACNA1A Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 6 MIM#183086;Episodic ataxia, type 2 MIM#108500 Neurodegeneration;HP:0002180 20301319;29325606 False 3 100;0;0 6.47 False ENSG00000141837 ENSG00000141837 HGNC:1388 19 13318673 13318691 13207859 13207897 CAG 18 20 SCA7 str ATXN7 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 7 MIM#164500 Neurodegeneration;HP:0002180 29325606;20301433 False 3 100;0;0 6.47 False ENSG00000163635 ENSG00000163635 HGNC:10560 3 63898362 63898391 63912686 63912715 CAG 27 37 SCA8 str ATXN8OS Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 8 MIM#608768 Neurodegeneration;HP:0002180 20301445 False 3 100;0;0 6.47 False ENSG00000230223 ENSG00000230223 HGNC:10561 13 70713486 70713560 70139354 70139428 CTG 50 80 XDP str TAF1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia-Parkinsonism, X-linked MIM#314250 Neurodegeneration;HP:0002180 17273961;29229810 False 3 100;0;0 6.47 True ENSG00000147133 ENSG00000147133 HGNC:11535 X 70672905 70672979 71453055 71453129 CCCTCT 13 30 CANVAS_ACAGG str RFC1 Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome;fasciculations;elevated serum creatine kinase levels;denervation Neurodegeneration;HP:0002180 33103729 False 2 0;100;0 6.47 True ENSG00000035928 ENSG00000035928 HGNC:9969 4 39350045 39350103 39348425 39348483 ACAGG 0 400