Early-onset Dementia
STR: CJDGRCh37 Position: 4680026-4680073
GRCh38 Position: 4699380-4699427
Repeated Sequence: GGTGGTGGCTGGGGGCAGCCTCAT
Normal Number of Repeats: < 4
Pathogenic Number of Repeats: = or > 5
PRNP (prion protein)
EnsemblGeneIds (GRCh38): ENSG00000171867
EnsemblGeneIds (GRCh37): ENSG00000171867
OMIM: 176640, Gene2Phenotype
PRNP is in 0 panels
1 review
Bryony Thompson (Royal Melbourne Hospital)
NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X]
Normal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat.
Pathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype.
Sources: Expert listCreated: 31 Aug 2021, 2:46 a.m.
Mode of inheritance
MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
Phenotypes
Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440
Publications
Clinically RelevantInterruptions in the repeated sequence are reported as part of standard diagnostic practise
Details
- Name
- CJD
- Chromosome
- 20
- GRCh37 Coordinates
- 4680026-4680073
- GRCh38 Coordinates
- 4699380-4699427
- Repeated Sequence
- GGTGGTGGCTGGGGGCAGCCTCAT
- Normal Number of Repeats: <
- 4
- Pathogenic Number of Repeats: = or >
- 5
- Mode of Inheritance
- MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted
- Sources
-
- Expert Review Green
- Expert list
- Phenotypes
-
- Creutzfeldt-Jakob disease MIM#123400
- Gerstmann-Straussler disease MIM#137440
- OMIM
- 176640
- Clinvar variants
- Variants in PRNP
- Penetrance
- None
- Publications
History Filter Activity
Entity classified by Genomics England curator
Bryony Thompson (Royal Melbourne Hospital)Str: cjd has been classified as Green List (High Evidence).
Entity classified by Genomics England curator
Bryony Thompson (Royal Melbourne Hospital)Str: cjd has been classified as Green List (High Evidence).
Created, Added New Source, Set mode of inheritance, Set publications, Set Phenotypes
Bryony Thompson (Royal Melbourne Hospital)STR: CJD was added STR: CJD was added to Early-onset Dementia. Sources: Expert list Mode of inheritance for STR: CJD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Publications for STR: CJD were set to 2159587; 20301407 Phenotypes for STR: CJD were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440 Review for STR: CJD was set to GREEN STR: CJD was marked as clinically relevant