Entity Name	Entity type	Gene Symbol	Sources(; separated)	Level4	Level3	Level2	Model_Of_Inheritance	Phenotypes	Omim	Orphanet	HPO	Publications	Description	Flagged	GEL_Status	UserRatings_Green_amber_red	version	ready	Mode of pathogenicity	EnsemblId(GRch37)	EnsemblId(GRch38)	HGNC	Position Chromosome	Position GRCh37 Start	Position GRCh37 End	Position GRCh38 Start	Position GRCh38 End	STR Repeated Sequence	STR Normal Repeats	STR Pathogenic Repeats	Region Haploinsufficiency Score	Region Triplosensitivity Score	Region Required Overlap Percentage	Region Variant Type	Region Verbose Name
ANXA11	gene	ANXA11	Expert Review Green;Literature	Early-onset Dementia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	amyotrophic lateral sclerosis type 23 MONDO:0027694			Cognitive impairment;HP:0100543	36458208;39755715;38896345;38896262		False	3	100;0;0	1.29	True	Other	ENSG00000122359	ENSG00000122359	HGNC:535													
APP	gene	APP	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Alzheimer disease MONDO:0007088			Cognitive impairment;HP:0100543	20301340;1671712;1678058;1908231;1302033		False	3	100;0;0	1.29	True	Other	ENSG00000142192	ENSG00000142192	HGNC:620													
ARSA	gene	ARSA	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Metachromatic leukodystrophy, MIM# 250100, adult-onset			Cognitive impairment;HP:0100543	29486463;26890752;15710861		False	3	100;0;0	1.29	True		ENSG00000100299	ENSG00000100299	HGNC:713													
ATP13A2	gene	ATP13A2	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Kufor-Rakeb syndrome, MIM# 606693			Cognitive impairment;HP:0100543			False	3	100;0;0	1.29	True		ENSG00000159363	ENSG00000159363	HGNC:30213													
C19orf12	gene	C19orf12	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodegeneration with brain iron accumulation 4, MIM# 614298			Cognitive impairment;HP:0100543	23278385;21981780;23269600		False	3	100;0;0	1.29	True		ENSG00000131943	ENSG00000131943	HGNC:25443													
CHCHD10	gene	CHCHD10	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal dementia and/or amyotrophic lateral sclerosis 2, MIM# 615911			Cognitive impairment;HP:0100543	24934289;31690696;30877432;32369233;28069311		False	3	100;0;0	1.29	True		ENSG00000250479	ENSG00000250479	HGNC:15559													
CHMP2B	gene	CHMP2B	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal dementia and/or amyotrophic lateral sclerosis 7 (MIM#600795;MONDO:0010936)			Cognitive impairment;HP:0100543	20301378;16041373		False	3	100;0;0	1.29	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000083937	ENSG00000083937	HGNC:24537													
CLN6	gene	CLN6	Expert Review Green;Literature	Early-onset Dementia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, Kufs type, adult onset MIM#204300			Cognitive impairment;HP:0100543	30561534		False	3	100;0;0	1.29	True		ENSG00000128973	ENSG00000128973	HGNC:2077													
COL4A1	gene	COL4A1	Expert Review Green;Literature	Early-onset Dementia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Brain small vessel disease 1 with or without ocular anomalies	MONDO:0008289;Microangiopathy and leukoencephalopathy, pontine, autosomal dominant	MONDO:0032814"			Cognitive impairment;HP:0100543	35699195;37272523;36300346;30413629		False	3	100;0;0	1.29	True		ENSG00000187498	ENSG00000187498	HGNC:2202													
CP	gene	CP	Expert list;Expert Review Green	Early-onset Dementia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hemosiderosis, systemic, due to aceruloplasminemia MIM#604290			Cognitive impairment;HP:0100543	7539672;https://doi.org/10.1093/qjmed/89.5.355;28874056;28012953		False	3	100;0;0	1.29	False		ENSG00000047457	ENSG00000047457	HGNC:2295													
CSF1R	gene	CSF1R	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	Unknown				Cognitive impairment;HP:0100543			False	3	100;0;0	1.29	False		ENSG00000182578	ENSG00000182578	HGNC:2433													
CST3	gene	CST3	Expert list;Expert Review Green	Early-onset Dementia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cerebral amyloid angiopathy MIM#105150;leukodystrophy MONDO:0019046			Cognitive impairment;HP:0100543	22435454;8866434;2602413;8108423;38489591		False	3	50;50;0	1.29	True	Other	ENSG00000101439	ENSG00000101439	HGNC:2475													
CTSF	gene	CTSF	Expert list;Expert Review Green	Early-onset Dementia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Ceroid lipofuscinosis, neuronal, 13, Kufs type	615362"			Cognitive impairment;HP:0100543	PMID: 28749476;27668283;27524508		False	3	100;0;0	1.29	True		ENSG00000174080	ENSG00000174080	HGNC:2531													
CYP27A1	gene	CYP27A1	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebrotendinous xanthomatosis, MIM# 213700			Cognitive impairment;HP:0100543			False	3	100;0;0	1.29	True		ENSG00000135929	ENSG00000135929	HGNC:2605													
DCTN1	gene	DCTN1	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Perry syndrome, MIM# 168605			Cognitive impairment;HP:0100543	19136952		False	3	100;0;0	1.29	True		ENSG00000204843	ENSG00000204843	HGNC:2711													
DNAJC5	gene	DNAJC5	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	Unknown				Cognitive impairment;HP:0100543			False	3	100;0;0	1.29	False		ENSG00000101152	ENSG00000101152	HGNC:16235													
DNMT1	gene	DNMT1	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	Unknown				Cognitive impairment;HP:0100543			False	3	0;100;0	1.29	False		ENSG00000130816	ENSG00000130816	HGNC:2976													
EPM2A	gene	EPM2A	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 2A (Lafora) MIM#254780			Cognitive impairment;HP:0100543	12019207		False	3	100;0;0	1.29	True		ENSG00000112425	ENSG00000112425	HGNC:3413													
FTL	gene	FTL	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodegeneration with brain iron accumulation 3, MIM# 606159			Cognitive impairment;HP:0100543	11438811;18854324;15099026;15173247		False	3	100;0;0	1.29	True		ENSG00000087086	ENSG00000087086	HGNC:3999													
FUS	gene	FUS	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Amyotrophic lateral sclerosis 6, with or without frontotemporal dementia, MIM# 608030			Cognitive impairment;HP:0100543	32941707;32770214		False	3	100;0;0	1.29	True		ENSG00000089280	ENSG00000089280	HGNC:4010													
GLA	gene	GLA	Expert Review Green;Literature	Early-onset Dementia		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	"Fabry disease	MONDO:0010526"			Cognitive impairment;HP:0100543	36927868;38254927;9213072;23949010;32510623		False	3	100;0;0	1.29	True		ENSG00000102393	ENSG00000102393	HGNC:4296													
GRN	gene	GRN	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	frontotemporal dementia and/or amyotrophic lateral sclerosis MONDO:0030923			Cognitive impairment;HP:0100543	20301545;17436289		False	3	100;0;0	1.29	True		ENSG00000030582	ENSG00000030582	HGNC:4601													
HTRA1	gene	HTRA1	Expert list;Expert Review Green	Early-onset Dementia		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	CARASIL syndrome MIM#600142;Cerebral arteriopathy, autosomal dominant, with subcortical infarcts and leukoencephalopathy, type 2 MIM#616779			Cognitive impairment;HP:0100543	29895533;26063658;19387015		False	3	100;0;0	1.29	False		ENSG00000166033	ENSG00000166033	HGNC:9476													
ITM2B	gene	ITM2B	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cerebral amyloid angiopathy MONDO:0005620			Cognitive impairment;HP:0100543	10391242;10781099;20385796;33814452		False	3	100;0;0	1.29	True		ENSG00000136156	ENSG00000136156	HGNC:6174													
LRRK2	gene	LRRK2	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown				Cognitive impairment;HP:0100543			False	3	100;0;0	1.29	False		ENSG00000188906	ENSG00000188906	HGNC:18618													
MAPT	gene	MAPT	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Supranuclear palsy, progressive (MIM# 601104) AD;Supranuclear palsy, progressive atypical (MIM# 260540) AR			Cognitive impairment;HP:0100543	20838030;11220749		False	3	100;0;0	1.29	True		ENSG00000186868	ENSG00000186868	HGNC:6893													
NHLRC1	gene	NHLRC1	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 2B (Lafora Disease) MIM#254780			Cognitive impairment;HP:0100543	28556688;34117373		False	3	100;0;0	1.29	True		ENSG00000187566	ENSG00000187566	HGNC:21576													
NOTCH3	gene	NOTCH3	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 125310			Cognitive impairment;HP:0100543	31960911		False	3	100;0;0	1.29	True		ENSG00000074181	ENSG00000074181	HGNC:7883													
NPC1	gene	NPC1	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Niemann-Pick disease, type C1 (MIM#257220;MONDO:0009757)			Cognitive impairment;HP:0100543	20301473;11182931		False	3	0;100;0	1.29	True		ENSG00000141458	ENSG00000141458	HGNC:7897													
NPC2	gene	NPC2	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Niemann-pick disease, type C2 MIM#607625			Cognitive impairment;HP:0100543	27792009;20525256		False	3	100;0;0	1.29	True		ENSG00000119655	ENSG00000119655	HGNC:14537													
OPTN	gene	OPTN	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Amyotrophic lateral sclerosis 12 with or without frontotemporal dementia (MIM#613435)			Cognitive impairment;HP:0100543	31838784;20428114;20301623		False	3	100;0;0	1.29	True		ENSG00000123240	ENSG00000123240	HGNC:17142													
PANK2	gene	PANK2	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration with brain iron accumulation 1 (MIM#234200)			Cognitive impairment;HP:0100543	24600523;23447832;19480328		False	3	100;0;0	1.29	True		ENSG00000125779	ENSG00000125779	HGNC:15894													
PARK7	gene	PARK7	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal				Cognitive impairment;HP:0100543			False	3	100;0;0	1.29	False		ENSG00000116288	ENSG00000116288	HGNC:16369													
PINK1	gene	PINK1	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal				Cognitive impairment;HP:0100543			False	3	100;0;0	1.29	False		ENSG00000158828	ENSG00000158828	HGNC:14581													
PLA2G6	gene	PLA2G6	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease 14, autosomal recessive, MIM# 612953			Cognitive impairment;HP:0100543	25634434;26836416;22406380;20938027		False	3	0;100;0	1.29	True		ENSG00000184381	ENSG00000184381	HGNC:9039													
PRKN	gene	PRKN	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease, juvenile, type 2 MIM#600116			Cognitive impairment;HP:0100543			False	3	100;0;0	1.29	True		ENSG00000185345	ENSG00000185345	HGNC:8607													
PRNP	gene	PRNP	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Prion Disease (MIM#176640);Creutzfeldt-Jakob disease (MIM#123400)			Cognitive impairment;HP:0100543	27910931;19571725, 20301407;6351815		False	3	100;0;0	1.29	True		ENSG00000171867	ENSG00000171867	HGNC:9449													
PSEN1	gene	PSEN1	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Alzheimer disease, type 3 (MIM#607822;MONDO:0011913)			Cognitive impairment;HP:0100543	22503161;20301340		False	3	100;0;0	1.29	True		ENSG00000080815	ENSG00000080815	HGNC:9508													
PSEN2	gene	PSEN2	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Alzheimer disease-4 (MIM#606889)			Cognitive impairment;HP:0100543	22503161;20301340;25323700;35491795		False	3	100;0;0	1.29	True		ENSG00000143801	ENSG00000143801	HGNC:9509													
RNF216	gene	RNF216	Expert list;Expert Review Green	Early-onset Dementia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia and hypogonadotropic hypogonadism MIM#212840			Cognitive impairment;HP:0100543	23656588;25841028;27995769		False	3	100;0;0	1.29	True		ENSG00000011275	ENSG00000011275	HGNC:21698													
SNCA	gene	SNCA	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dementia, Lewy body (MIM#127750);Parkinson disease 1 (MIM#168601);Parkinson disease 4 (MIM#605543)			Cognitive impairment;HP:0100543	32849182;26858591;32740728		False	3	100;0;0	1.29	True		ENSG00000145335	ENSG00000145335	HGNC:11138													
SPG11	gene	SPG11	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 11, autosomal recessive MIM#604360;Charcot-Marie-Tooth disease, axonal, type 2X MIM#616668;Amyotrophic lateral sclerosis 5, juvenile MIM#602099			Cognitive impairment;HP:0100543			False	3	100;0;0	1.29	False		ENSG00000104133	ENSG00000104133	HGNC:11226													
SPG21	gene	SPG21	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mast syndrome, MIM# 248900			Cognitive impairment;HP:0100543	14564668;24451228;28752238;26978163		False	3	100;0;0	1.29	True		ENSG00000090487	ENSG00000090487	HGNC:20373													
STUB1	gene	STUB1	Expert list;Expert Review Green	Early-onset Dementia		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	"Spinocerebellar ataxia 48 MIM#618093;cognitive impairment;Spinocerebellar ataxia, autosomal recessive 16	MIM#615768"			Cognitive impairment;HP:0100543	32713943		False	3	100;0;0	1.29	False		ENSG00000103266	ENSG00000103266	HGNC:11427													
TARDBP	gene	TARDBP	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Amyotrophic lateral sclerosis 10, with or without FTD (MIM#612069)			Cognitive impairment;HP:0100543	20301761;21803454		False	3	100;0;0	1.29	True		ENSG00000120948	ENSG00000120948	HGNC:11571													
TBK1	gene	TBK1	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal dementia and/or amyotrophic lateral sclerosis 4, MIM# 616439			Cognitive impairment;HP:0100543	20301623		False	3	100;0;0	1.29	True		ENSG00000183735	ENSG00000183735	HGNC:11584													
TREM2	gene	TREM2	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2, MIM# 618193;{Alzhieimer disease 17, susceptibility to}, MIM# 615080			Cognitive impairment;HP:0100543	12080485;15883308		False	3	100;0;0	1.29	True		ENSG00000095970	ENSG00000095970	HGNC:17761													
TREX1	gene	TREX1	Expert Review Green;Literature	Early-onset Dementia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Retinal vasculopathy with cerebral leukoencephalopathy and systemic manifestations	MONDO:0008641"			Cognitive impairment;HP:0100543	29380913;35699195;36586737;35307828		False	3	100;0;0	1.29	True		ENSG00000213689	ENSG00000213689	HGNC:12269													
TTR	gene	TTR	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Amyloidosis, hereditary, transthyretin-related, MIM# 105210			Cognitive impairment;HP:0100543	20301373		False	3	100;0;0	1.29	True		ENSG00000118271	ENSG00000118271	HGNC:12405													
TUBA4A	gene	TUBA4A	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Amyotrophic lateral sclerosis 22 with or without frontotemporal dementia, MIM# 616208			Cognitive impairment;HP:0100543	25374358;28069311;35327632;34169147;38884572;33760283;26675813		False	3	50;50;0	1.29	True		ENSG00000127824	ENSG00000127824	HGNC:12407													
TYROBP	gene	TYROBP	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 1 (MIM#221770)			Cognitive impairment;HP:0100543	20301376		False	3	100;0;0	1.29	True		ENSG00000011600	ENSG00000011600	HGNC:12449													
UBQLN2	gene	UBQLN2	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Amyotrophic lateral sclerosis 15, with or without frontotemporal dementia (MIM#300857)			Cognitive impairment;HP:0100543	20301623;31319884;21857683;30348461		False	3	0;100;0	1.29	True		ENSG00000188021	ENSG00000188021	HGNC:12509													
VCP	gene	VCP	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Inclusion body myopathy with early-onset Paget disease and frontotemporal dementia 1 (MIM#167320);Frontotemporal dementia and/or amyotrophic lateral sclerosis 6 (MIM#613954)			Cognitive impairment;HP:0100543	15034582;30103325;21145000		False	3	100;0;0	1.29	True		ENSG00000165280	ENSG00000165280	HGNC:12666													
VPS13A	gene	VPS13A	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Choreoacanthocytosis MIM#200150			Cognitive impairment;HP:0100543			False	3	100;0;0	1.29	False		ENSG00000197969	ENSG00000197969	HGNC:1908													
VPS13C	gene	VPS13C	Expert Review Green;Literature	Early-onset Dementia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"autosomal recessive early-onset Parkinson disease 23	MONDO:0014796"			Cognitive impairment;HP:0100543	33579389;37330543;34875562		False	3	100;0;0	1.29	True		ENSG00000129003	ENSG00000129003	HGNC:23594													
VPS35	gene	VPS35	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	{Parkinson disease 17} MIM#614203;Cognitive decline			Cognitive impairment;HP:0100543			False	3	0;0;0	1.29	False		ENSG00000069329	ENSG00000069329	HGNC:13487													
WDR45	gene	WDR45	Expert list;Expert Review Green	Early-onset Dementia		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Neurodegeneration with brain iron accumulation 5 MIM#300894			Cognitive impairment;HP:0100543	23435086		False	3	100;0;0	1.29	False		ENSG00000196998	ENSG00000196998	HGNC:28912													
XK	gene	XK	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Dementia		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	McLeod syndrome with or without chronic granulomatous disease (MIM#300842)			Cognitive impairment;HP:0100543	12899725		False	3	100;0;0	1.29	True		ENSG00000047597	ENSG00000047597	HGNC:12811													
CJD	str	PRNP	Expert Review Green;Expert list	Early-onset Dementia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440			Cognitive impairment;HP:0100543	2159587;20301407		False	3	100;0;0	1.29	True		ENSG00000171867	ENSG00000171867	HGNC:9449	20	4680026	4680073	4699380	4699427	GGTGGTGGCTGGGGGCAGCCTCAT	4	5					
DRPLA	str	ATN1	Expert Review Green;Expert list	Early-onset Dementia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dentatorubral-pallidoluysian atrophy MIM#125370			Cognitive impairment;HP:0100543	29325606;20301664		False	3	100;0;0	1.29	True		ENSG00000111676	ENSG00000111676	HGNC:3033	12	7045892	7045936	6936729	6936773	CAG	35	48					
FTDALS	str	C9orf72	Expert Review Green;Expert list	Early-onset Dementia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550			Cognitive impairment;HP:0100543	25577942;21944779;21944778		False	3	100;0;0	1.29	True		ENSG00000147894	ENSG00000147894	HGNC:28337	9	27573427	27573544	27573529	27573546	GGGGCC	25	60					
HDL2	str	JPH3	Expert Review Green;Expert list	Early-onset Dementia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Huntington disease-like 2 MIM#606438			Cognitive impairment;HP:0100543	20301701		False	3	100;0;0	1.29	False		ENSG00000154118	ENSG00000154118	HGNC:14203	16	87637894	87637935	87604288	87604329	CTG	28	40					
NIID	str	NOTCH2NL	Expert Review Green;Literature	Early-onset Dementia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neuronal intranuclear inclusion disease MIM#603472;Oculopharyngodistal myopathy 3 MIM#619473;Tremor, hereditary essential, 6 MIM#618866			Cognitive impairment;HP:0100543	31178126;31332381;31819945;33887199;33943039;32250060;31332380;32852534;32989102;34333668		False	3	100;0;0	1.29	False		ENSG00000213240	ENSG00000264343	HGNC:31862	1	145209324	145209344	149390803	149390829	GGC	40	60					
SCA17	str	TBP	Expert Review Green;Expert list	Early-onset Dementia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 17 MIM#607136			Cognitive impairment;HP:0100543	10484774;20301611		False	3	100;0;0	1.29	True		ENSG00000112592	ENSG00000112592	HGNC:11588	6	170870996	170871109	170561908	170562021	CAG	40	49					
