Entity Name Entity type Gene Symbol Sources(; separated) Level4 Level3 Level2 Model_Of_Inheritance Phenotypes Omim Orphanet HPO Publications Description Flagged GEL_Status UserRatings_Green_amber_red version ready Mode of pathogenicity EnsemblId(GRch37) EnsemblId(GRch38) HGNC Position Chromosome Position GRCh37 Start Position GRCh37 End Position GRCh38 Start Position GRCh38 End STR Repeated Sequence STR Normal Repeats STR Pathogenic Repeats Region Haploinsufficiency Score Region Triplosensitivity Score Region Required Overlap Percentage Region Variant Type Region Verbose Name ANXA11 gene ANXA11 Expert Review Green;Literature Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted amyotrophic lateral sclerosis type 23 MONDO:0027694 Cognitive impairment;HP:0100543 36458208;39755715;38896345;38896262 False 3 100;0;0 1.29 True Other ENSG00000122359 ENSG00000122359 HGNC:535 APP gene APP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alzheimer disease MONDO:0007088 Cognitive impairment;HP:0100543 20301340;1671712;1678058;1908231;1302033 False 3 100;0;0 1.29 True Other ENSG00000142192 ENSG00000142192 HGNC:620 ARSA gene ARSA Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Metachromatic leukodystrophy, MIM# 250100, adult-onset Cognitive impairment;HP:0100543 29486463;26890752;15710861 False 3 100;0;0 1.29 True ENSG00000100299 ENSG00000100299 HGNC:713 ATP13A2 gene ATP13A2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Kufor-Rakeb syndrome, MIM# 606693 Cognitive impairment;HP:0100543 False 3 100;0;0 1.29 True ENSG00000159363 ENSG00000159363 HGNC:30213 C19orf12 gene C19orf12 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodegeneration with brain iron accumulation 4, MIM# 614298 Cognitive impairment;HP:0100543 23278385;21981780;23269600 False 3 100;0;0 1.29 True ENSG00000131943 ENSG00000131943 HGNC:25443 CHCHD10 gene CHCHD10 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 2, MIM# 615911 Cognitive impairment;HP:0100543 24934289;31690696;30877432;32369233;28069311 False 3 100;0;0 1.29 True ENSG00000250479 ENSG00000250479 HGNC:15559 CHMP2B gene CHMP2B Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 7 (MIM#600795;MONDO:0010936) Cognitive impairment;HP:0100543 20301378;16041373 False 3 100;0;0 1.29 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000083937 ENSG00000083937 HGNC:24537 CLN6 gene CLN6 Expert Review Green;Literature Early-onset Dementia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, Kufs type, adult onset MIM#204300 Cognitive impairment;HP:0100543 30561534 False 3 100;0;0 1.29 True ENSG00000128973 ENSG00000128973 HGNC:2077 COL4A1 gene COL4A1 Expert Review Green;Literature Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Brain small vessel disease 1 with or without ocular anomalies MONDO:0008289;Microangiopathy and leukoencephalopathy, pontine, autosomal dominant MONDO:0032814" Cognitive impairment;HP:0100543 35699195;37272523;36300346;30413629 False 3 100;0;0 1.29 True ENSG00000187498 ENSG00000187498 HGNC:2202 CP gene CP Expert list;Expert Review Green Early-onset Dementia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hemosiderosis, systemic, due to aceruloplasminemia MIM#604290 Cognitive impairment;HP:0100543 7539672;https://doi.org/10.1093/qjmed/89.5.355;28874056;28012953 False 3 100;0;0 1.29 False ENSG00000047457 ENSG00000047457 HGNC:2295 CSF1R gene CSF1R Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders Unknown Cognitive impairment;HP:0100543 False 3 100;0;0 1.29 False ENSG00000182578 ENSG00000182578 HGNC:2433 CST3 gene CST3 Expert list;Expert Review Green Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cerebral amyloid angiopathy MIM#105150;leukodystrophy MONDO:0019046 Cognitive impairment;HP:0100543 22435454;8866434;2602413;8108423;38489591 False 3 50;50;0 1.29 True Other ENSG00000101439 ENSG00000101439 HGNC:2475 CTSF gene CTSF Expert list;Expert Review Green Early-onset Dementia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Ceroid lipofuscinosis, neuronal, 13, Kufs type 615362" Cognitive impairment;HP:0100543 PMID: 28749476;27668283;27524508 False 3 100;0;0 1.29 True ENSG00000174080 ENSG00000174080 HGNC:2531 CYP27A1 gene CYP27A1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebrotendinous xanthomatosis, MIM# 213700 Cognitive impairment;HP:0100543 False 3 100;0;0 1.29 True ENSG00000135929 ENSG00000135929 HGNC:2605 DCTN1 gene DCTN1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Perry syndrome, MIM# 168605 Cognitive impairment;HP:0100543 19136952 False 3 100;0;0 1.29 True ENSG00000204843 ENSG00000204843 HGNC:2711 DNAJC5 gene DNAJC5 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders Unknown Cognitive impairment;HP:0100543 False 3 100;0;0 1.29 False ENSG00000101152 ENSG00000101152 HGNC:16235 DNMT1 gene DNMT1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders Unknown Cognitive impairment;HP:0100543 False 3 0;100;0 1.29 False ENSG00000130816 ENSG00000130816 HGNC:2976 EPM2A gene EPM2A Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 2A (Lafora) MIM#254780 Cognitive impairment;HP:0100543 12019207 False 3 100;0;0 1.29 True ENSG00000112425 ENSG00000112425 HGNC:3413 FTL gene FTL Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration with brain iron accumulation 3, MIM# 606159 Cognitive impairment;HP:0100543 11438811;18854324;15099026;15173247 False 3 100;0;0 1.29 True ENSG00000087086 ENSG00000087086 HGNC:3999 FUS gene FUS Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 6, with or without frontotemporal dementia, MIM# 608030 Cognitive impairment;HP:0100543 32941707;32770214 False 3 100;0;0 1.29 True ENSG00000089280 ENSG00000089280 HGNC:4010 GLA gene GLA Expert Review Green;Literature Early-onset Dementia Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) "Fabry disease MONDO:0010526" Cognitive impairment;HP:0100543 36927868;38254927;9213072;23949010;32510623 False 3 100;0;0 1.29 True ENSG00000102393 ENSG00000102393 HGNC:4296 GRN gene GRN Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted frontotemporal dementia and/or amyotrophic lateral sclerosis MONDO:0030923 Cognitive impairment;HP:0100543 20301545;17436289 False 3 100;0;0 1.29 True ENSG00000030582 ENSG00000030582 HGNC:4601 HTRA1 gene HTRA1 Expert list;Expert Review Green Early-onset Dementia Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal CARASIL syndrome MIM#600142;Cerebral arteriopathy, autosomal dominant, with subcortical infarcts and leukoencephalopathy, type 2 MIM#616779 Cognitive impairment;HP:0100543 29895533;26063658;19387015 False 3 100;0;0 1.29 False ENSG00000166033 ENSG00000166033 HGNC:9476 ITM2B gene ITM2B Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cerebral amyloid angiopathy MONDO:0005620 Cognitive impairment;HP:0100543 10391242;10781099;20385796;33814452 False 3 100;0;0 1.29 True ENSG00000136156 ENSG00000136156 HGNC:6174 LRRK2 gene LRRK2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Cognitive impairment;HP:0100543 False 3 100;0;0 1.29 False ENSG00000188906 ENSG00000188906 HGNC:18618 MAPT gene MAPT Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Supranuclear palsy, progressive (MIM# 601104) AD;Supranuclear palsy, progressive atypical (MIM# 260540) AR Cognitive impairment;HP:0100543 20838030;11220749 False 3 100;0;0 1.29 True ENSG00000186868 ENSG00000186868 HGNC:6893 NHLRC1 gene NHLRC1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 2B (Lafora Disease) MIM#254780 Cognitive impairment;HP:0100543 28556688;34117373 False 3 100;0;0 1.29 True ENSG00000187566 ENSG00000187566 HGNC:21576 NOTCH3 gene NOTCH3 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 125310 Cognitive impairment;HP:0100543 31960911 False 3 100;0;0 1.29 True ENSG00000074181 ENSG00000074181 HGNC:7883 NPC1 gene NPC1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-Pick disease, type C1 (MIM#257220;MONDO:0009757) Cognitive impairment;HP:0100543 20301473;11182931 False 3 0;100;0 1.29 True ENSG00000141458 ENSG00000141458 HGNC:7897 NPC2 gene NPC2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-pick disease, type C2 MIM#607625 Cognitive impairment;HP:0100543 27792009;20525256 False 3 100;0;0 1.29 True ENSG00000119655 ENSG00000119655 HGNC:14537 OPTN gene OPTN Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Amyotrophic lateral sclerosis 12 with or without frontotemporal dementia (MIM#613435) Cognitive impairment;HP:0100543 31838784;20428114;20301623 False 3 100;0;0 1.29 True ENSG00000123240 ENSG00000123240 HGNC:17142 PANK2 gene PANK2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration with brain iron accumulation 1 (MIM#234200) Cognitive impairment;HP:0100543 24600523;23447832;19480328 False 3 100;0;0 1.29 True ENSG00000125779 ENSG00000125779 HGNC:15894 PARK7 gene PARK7 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cognitive impairment;HP:0100543 False 3 100;0;0 1.29 False ENSG00000116288 ENSG00000116288 HGNC:16369 PINK1 gene PINK1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cognitive impairment;HP:0100543 False 3 100;0;0 1.29 False ENSG00000158828 ENSG00000158828 HGNC:14581 PLA2G6 gene PLA2G6 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease 14, autosomal recessive, MIM# 612953 Cognitive impairment;HP:0100543 25634434;26836416;22406380;20938027 False 3 0;100;0 1.29 True ENSG00000184381 ENSG00000184381 HGNC:9039 PRKN gene PRKN Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease, juvenile, type 2 MIM#600116 Cognitive impairment;HP:0100543 False 3 100;0;0 1.29 True ENSG00000185345 ENSG00000185345 HGNC:8607 PRNP gene PRNP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Prion Disease (MIM#176640);Creutzfeldt-Jakob disease (MIM#123400) Cognitive impairment;HP:0100543 27910931;19571725, 20301407;6351815 False 3 100;0;0 1.29 True ENSG00000171867 ENSG00000171867 HGNC:9449 PSEN1 gene PSEN1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alzheimer disease, type 3 (MIM#607822;MONDO:0011913) Cognitive impairment;HP:0100543 22503161;20301340 False 3 100;0;0 1.29 True ENSG00000080815 ENSG00000080815 HGNC:9508 PSEN2 gene PSEN2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alzheimer disease-4 (MIM#606889) Cognitive impairment;HP:0100543 22503161;20301340;25323700;35491795 False 3 100;0;0 1.29 True ENSG00000143801 ENSG00000143801 HGNC:9509 RNF216 gene RNF216 Expert list;Expert Review Green Early-onset Dementia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia and hypogonadotropic hypogonadism MIM#212840 Cognitive impairment;HP:0100543 23656588;25841028;27995769 False 3 100;0;0 1.29 True ENSG00000011275 ENSG00000011275 HGNC:21698 SNCA gene SNCA Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dementia, Lewy body (MIM#127750);Parkinson disease 1 (MIM#168601);Parkinson disease 4 (MIM#605543) Cognitive impairment;HP:0100543 32849182;26858591;32740728 False 3 100;0;0 1.29 True ENSG00000145335 ENSG00000145335 HGNC:11138 SPG11 gene SPG11 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 11, autosomal recessive MIM#604360;Charcot-Marie-Tooth disease, axonal, type 2X MIM#616668;Amyotrophic lateral sclerosis 5, juvenile MIM#602099 Cognitive impairment;HP:0100543 False 3 100;0;0 1.29 False ENSG00000104133 ENSG00000104133 HGNC:11226 SPG21 gene SPG21 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mast syndrome, MIM# 248900 Cognitive impairment;HP:0100543 14564668;24451228;28752238;26978163 False 3 100;0;0 1.29 True ENSG00000090487 ENSG00000090487 HGNC:20373 STUB1 gene STUB1 Expert list;Expert Review Green Early-onset Dementia Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Spinocerebellar ataxia 48 MIM#618093;cognitive impairment;Spinocerebellar ataxia, autosomal recessive 16 MIM#615768" Cognitive impairment;HP:0100543 32713943 False 3 100;0;0 1.29 False ENSG00000103266 ENSG00000103266 HGNC:11427 TARDBP gene TARDBP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Amyotrophic lateral sclerosis 10, with or without FTD (MIM#612069) Cognitive impairment;HP:0100543 20301761;21803454 False 3 100;0;0 1.29 True ENSG00000120948 ENSG00000120948 HGNC:11571 TBK1 gene TBK1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 4, MIM# 616439 Cognitive impairment;HP:0100543 20301623 False 3 100;0;0 1.29 True ENSG00000183735 ENSG00000183735 HGNC:11584 TREM2 gene TREM2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2, MIM# 618193;{Alzhieimer disease 17, susceptibility to}, MIM# 615080 Cognitive impairment;HP:0100543 12080485;15883308 False 3 100;0;0 1.29 True ENSG00000095970 ENSG00000095970 HGNC:17761 TREX1 gene TREX1 Expert Review Green;Literature Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Retinal vasculopathy with cerebral leukoencephalopathy and systemic manifestations MONDO:0008641" Cognitive impairment;HP:0100543 29380913;35699195;36586737;35307828 False 3 100;0;0 1.29 True ENSG00000213689 ENSG00000213689 HGNC:12269 TTR gene TTR Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyloidosis, hereditary, transthyretin-related, MIM# 105210 Cognitive impairment;HP:0100543 20301373 False 3 100;0;0 1.29 True ENSG00000118271 ENSG00000118271 HGNC:12405 TUBA4A gene TUBA4A Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 22 with or without frontotemporal dementia, MIM# 616208 Cognitive impairment;HP:0100543 25374358;28069311;35327632;34169147;38884572;33760283;26675813 False 3 50;50;0 1.29 True ENSG00000127824 ENSG00000127824 HGNC:12407 TYROBP gene TYROBP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 1 (MIM#221770) Cognitive impairment;HP:0100543 20301376 False 3 100;0;0 1.29 True ENSG00000011600 ENSG00000011600 HGNC:12449 UBQLN2 gene UBQLN2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Amyotrophic lateral sclerosis 15, with or without frontotemporal dementia (MIM#300857) Cognitive impairment;HP:0100543 20301623;31319884;21857683;30348461 False 3 0;100;0 1.29 True ENSG00000188021 ENSG00000188021 HGNC:12509 VCP gene VCP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Inclusion body myopathy with early-onset Paget disease and frontotemporal dementia 1 (MIM#167320);Frontotemporal dementia and/or amyotrophic lateral sclerosis 6 (MIM#613954) Cognitive impairment;HP:0100543 15034582;30103325;21145000 False 3 100;0;0 1.29 True ENSG00000165280 ENSG00000165280 HGNC:12666 VPS13A gene VPS13A Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Choreoacanthocytosis MIM#200150 Cognitive impairment;HP:0100543 False 3 100;0;0 1.29 False ENSG00000197969 ENSG00000197969 HGNC:1908 VPS13C gene VPS13C Expert Review Green;Literature Early-onset Dementia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "autosomal recessive early-onset Parkinson disease 23 MONDO:0014796" Cognitive impairment;HP:0100543 33579389;37330543;34875562 False 3 100;0;0 1.29 True ENSG00000129003 ENSG00000129003 HGNC:23594 VPS35 gene VPS35 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown {Parkinson disease 17} MIM#614203;Cognitive decline Cognitive impairment;HP:0100543 False 3 0;0;0 1.29 False ENSG00000069329 ENSG00000069329 HGNC:13487 WDR45 gene WDR45 Expert list;Expert Review Green Early-onset Dementia Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Neurodegeneration with brain iron accumulation 5 MIM#300894 Cognitive impairment;HP:0100543 23435086 False 3 100;0;0 1.29 False ENSG00000196998 ENSG00000196998 HGNC:28912 XK gene XK Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females McLeod syndrome with or without chronic granulomatous disease (MIM#300842) Cognitive impairment;HP:0100543 12899725 False 3 100;0;0 1.29 True ENSG00000047597 ENSG00000047597 HGNC:12811 APOE gene APOE Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alzheimer disease 2, MIM# 104310 Cognitive impairment;HP:0100543 False 2 0;100;0 1.29 True ENSG00000130203 ENSG00000130203 HGNC:613 CCNF gene CCNF Expert list;Expert Review Amber Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 5, MIM# 619141 Cognitive impairment;HP:0100543 27080313 False 2 0;100;0 1.29 True ENSG00000162063 ENSG00000162063 HGNC:1591 COL4A2 gene COL4A2 Expert Review Amber;Literature Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Familial porencephaly MONDO:0020496 Cognitive impairment;HP:0100543 35699195;37272523;36300346 False 2 0;100;0 1.29 True ENSG00000134871 ENSG00000134871 HGNC:2203 CYLD gene CYLD Expert Review Amber;Literature Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amytrophic lateral sclerosis 8, MIM# 619132 Cognitive impairment;HP:0100543 32185393 False 2 0;50;50 1.29 True ENSG00000083799 ENSG00000083799 HGNC:2584 GBA gene GBA Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders Other {Lewy body dementia, susceptibility to} (MIM# 127750) Cognitive impairment;HP:0100543 23588557;32439597;31010158 False 2 0;100;0 1.29 True ENSG00000177628 ENSG00000177628 HGNC:4177 HNRNPA1 gene HNRNPA1 Expert Review Amber;Other Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Inclusion body myopathy with early-onset Paget disease without frontotemporal dementia 3 MIM#615424;Amyotrophic lateral sclerosis 20 MIM#615426 Cognitive impairment;HP:0100543 24612671;24119545;23455423 False 2 0;0;100 1.29 True ENSG00000135486 ENSG00000135486 HGNC:5031 HNRNPA2B1 gene HNRNPA2B1 Expert Review Amber;Literature Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Inclusion body myopathy with early-onset Paget disease with or without frontotemporal dementia 2 MIM#615422 Cognitive impairment;HP:0100543 23455423;30279180;29358076;26744327;23635965 False 2 0;100;0 1.29 True ENSG00000122566 ENSG00000122566 HGNC:5033 KIF5A gene KIF5A Expert Review Amber;Other Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis, susceptibility to, 25 MONDO:0060670 Cognitive impairment;HP:0100543 33077544;36604770 False 2 0;100;0 1.29 True Other ENSG00000155980 ENSG00000155980 HGNC:6323 MATR3 gene MATR3 Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 21 MIM#606070;frontotemporal dementia;multisystem proteinopathy Cognitive impairment;HP:0100543 24686783;30015619;28029397;33408686 False 2 0;100;0 1.29 True ENSG00000015479 ENSG00000015479 HGNC:6912 POLG gene POLG Expert Review Amber;Literature Early-onset Dementia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Mitochondrial DNA depletion syndrome 4a MONDO:0008758" Cognitive impairment;HP:0100543 15477547;14694057;16638794 False 2 0;100;0 1.29 True ENSG00000140521 ENSG00000140521 HGNC:9179 SQSTM1 gene SQSTM1 Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 3 (MIM#616437) Cognitive impairment;HP:0100543 22084127;22972638 False 2 0;100;0 1.29 True ENSG00000161011 ENSG00000161011 HGNC:11280 TAF15 gene TAF15 Expert list;Expert Review Amber Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Amyotrophic lateral sclerosis;Frontotemporal dementia Cognitive impairment;HP:0100543 28889094 False 2 0;100;0 1.29 False ENSG00000172660 ENSG00000270647 HGNC:11547 TIA1 gene TIA1 Expert Review Amber;Literature Early-onset Dementia Neurology and neurodevelopmental disorders Other Multisystem proteinopathy Cognitive impairment;HP:0100543 36861178;29599744;29457785 False 2 0;100;0 1.29 True ENSG00000116001 ENSG00000116001 HGNC:11802 CJD str PRNP Expert Review Green;Expert list Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440 Cognitive impairment;HP:0100543 2159587;20301407 False 3 100;0;0 1.29 True ENSG00000171867 ENSG00000171867 HGNC:9449 20 4680026 4680073 4699380 4699427 GGTGGTGGCTGGGGGCAGCCTCAT 4 5 DRPLA str ATN1 Expert Review Green;Expert list Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dentatorubral-pallidoluysian atrophy MIM#125370 Cognitive impairment;HP:0100543 29325606;20301664 False 3 100;0;0 1.29 True ENSG00000111676 ENSG00000111676 HGNC:3033 12 7045892 7045936 6936729 6936773 CAG 35 48 FTDALS str C9orf72 Expert Review Green;Expert list Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550 Cognitive impairment;HP:0100543 25577942;21944779;21944778 False 3 100;0;0 1.29 True ENSG00000147894 ENSG00000147894 HGNC:28337 9 27573427 27573544 27573529 27573546 GGGGCC 25 60 HDL2 str JPH3 Expert Review Green;Expert list Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Huntington disease-like 2 MIM#606438 Cognitive impairment;HP:0100543 20301701 False 3 100;0;0 1.29 False ENSG00000154118 ENSG00000154118 HGNC:14203 16 87637894 87637935 87604288 87604329 CTG 28 40 NIID str NOTCH2NL Expert Review Green;Literature Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuronal intranuclear inclusion disease MIM#603472;Oculopharyngodistal myopathy 3 MIM#619473;Tremor, hereditary essential, 6 MIM#618866 Cognitive impairment;HP:0100543 31178126;31332381;31819945;33887199;33943039;32250060;31332380;32852534;32989102;34333668 False 3 100;0;0 1.29 False ENSG00000213240 ENSG00000264343 HGNC:31862 1 145209324 145209344 149390803 149390829 GGC 40 60 SCA17 str TBP Expert Review Green;Expert list Early-onset Dementia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 17 MIM#607136 Cognitive impairment;HP:0100543 10484774;20301611 False 3 100;0;0 1.29 True ENSG00000112592 ENSG00000112592 HGNC:11588 6 170870996 170871109 170561908 170562021 CAG 40 49