Entity Name Entity type Gene Symbol Sources(; separated) Level4 Level3 Level2 Model_Of_Inheritance Phenotypes Omim Orphanet HPO Publications Description Flagged GEL_Status UserRatings_Green_amber_red version ready Mode of pathogenicity EnsemblId(GRch37) EnsemblId(GRch38) HGNC Position Chromosome Position GRCh37 Start Position GRCh37 End Position GRCh38 Start Position GRCh38 End STR Repeated Sequence STR Normal Repeats STR Pathogenic Repeats Region Haploinsufficiency Score Region Triplosensitivity Score Region Required Overlap Percentage Region Variant Type Region Verbose Name AAGAB gene AAGAB Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Keratoderma, palmoplantar, punctate type IA (MIM#148600) 30451279;26608363 False 3 100;0;0 1.2304 True ENSG00000103591 ENSG00000103591 HGNC:25662 AARS gene AARS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Epileptic encephalopathy, early infantile, 29, MIM# 616339;Charcot-Marie-Tooth disease, axonal, type 2N, MIM# 613287;Spastic paraplegia 85, autosomal recessive, MIM# 619686;Ataxia, sensory, 1, autosomal dominant, MIM# 608984;Leukoencephalopathy, hereditary diffuse, with spheroids 2, MIM# 619661 31775912;28493438;25817015;20045102;22009580;22206013;30373780;26032230;33909043 False 3 100;0;0 1.2304 True ENSG00000090861 ENSG00000090861 HGNC:20 AARS2 gene AARS2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 8 MIM#614096;Leukoencephalopathy, progressive, with ovarian failure MIM#615889;MONDO:0013570 30706699;27839525;21549344;25058219;24808023 False 3 100;0;0 1.2304 True ENSG00000124608 ENSG00000124608 HGNC:21022 ABAT gene ABAT Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal GABA-transaminase deficiency, MIM# 613163;mtDNA depletion syndrome (MDS) 25738457;27903293;28411234;27596361;20052547;10407778;6148708 False 3 100;0;0 1.2304 True ENSG00000183044 ENSG00000183044 HGNC:23 ABCA1 gene ABCA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Tangier disease, MIM# 205400;HDL deficiency, familial, 1, MIM# 604091 10431237;10431236 False 3 100;0;0 1.2304 True ENSG00000165029 ENSG00000165029 HGNC:29 ABCA12 gene ABCA12 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ichthyosis, congenital, autosomal recessive 4A (MIM#601277);Ichthyosis, congenital, autosomal recessive 4B (harlequin) (MIM#242500) 31168818;19664001;31489029 False 3 100;0;0 1.2304 True ENSG00000144452 ENSG00000144452 HGNC:14637 ABCA2 gene ABCA2 Expert Review;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Intellectual developmental disorder with poor growth and with or without seizures or ataxia, 618808 30237576;29302074;31047799 False 3 100;0;0 1.2304 True ENSG00000107331 ENSG00000107331 HGNC:32 ABCA3 gene ABCA3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Surfactant metabolism dysfunction, pulmonary, 3, MIM# 610921 15044640 False 3 100;0;0 1.2304 True ENSG00000167972 ENSG00000167972 HGNC:33 ABCA4 gene ABCA4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cone-rod dystrophy 3, 604116;Fundus flavimaculatus, 248200;Retinal dystrophy, early-onset severe, 248200;Retinitis pigmentosa 19, 601718;Stargardt disease 1, 248200 9054934;30480703;29847635;29971439;16103129;30643219 False 3 100;0;0 1.2304 True ENSG00000198691 ENSG00000198691 HGNC:34 ABCB11 gene ABCB11 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cholestasis, progressive familial intrahepatic 2, MIM# 601847;Cholestasis, benign recurrent intrahepatic, 2, MIM# 605479 16871584;23141890;9806540;15300568;11172067 False 3 100;0;0 1.2304 True ENSG00000073734 ENSG00000073734 HGNC:42 ABCB4 gene ABCB4 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Cholestasis, progressive familial intrahepatic 3 MIM#602347;disorder of bile acid metabolism;Gallbladder disease 1 (MIM#600803) 8666348;17726488;18482588;28924228;32376413 False 3 100;0;0 1.2304 True ENSG00000005471 ENSG00000005471 HGNC:45 ABCB6 gene ABCB6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Pseudohyperkalemia, familial, 2, due to red cell leak, MIM# 609153;Microphthalmia, isolated, with coloboma 7, MIM# 614497;Dyschromatosis universalis hereditaria 3, MIM# 615402 23180570;22226084;24281366 False 3 100;0;0 1.2304 True ENSG00000115657 ENSG00000115657 HGNC:47 ABCB7 gene ABCB7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Anaemia, sideroblastic, with ataxia, MIM# 301310 10196363;10196363;33157103;31772327;31511561;26242992 False 3 100;0;0 1.2304 True ENSG00000131269 ENSG00000131269 HGNC:48 ABCC2 gene ABCC2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Dubin-Johnson syndrome, MIM# 237500 False 3 100;0;0 1.2304 True ENSG00000023839 ENSG00000023839 HGNC:53 ABCC6 gene ABCC6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Arterial calcification, generalized, of infancy, 2, MIM# 614473;Pseudoxanthoma elasticum, MIM# 264800;Pseudoxanthoma elasticum, forme fruste, MIM#177850 11536079;28102862;33005041;34355424 False 3 100;0;0 1.2304 True ENSG00000091262 ENSG00000091262 HGNC:57 ABCC8 gene ABCC8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Diabetes mellitus, noninsulin-dependent MIM#125853;Diabetes mellitus, permanent neonatal 3, with or without neurologic features MIM#618857;Diabetes mellitus, transient neonatal 2 MIM#610374;Hyperinsulinemic hypoglycemia, familial, 1 MIM#256450;Hypoglycemia of infancy, leucine-sensitive MIM#240800 PMID: 21054355;32027066;32376986 False 3 100;0;0 1.2304 True ENSG00000006071 ENSG00000006071 HGNC:59 ABCC9 gene ABCC9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hypertrichotic osteochondrodysplasia, MIM# 239850;Cantu syndrome;Intellectual disability and myopathy syndrome, MIM# 619719 31575858;22610116;22608503 False 3 100;0;0 1.2304 True ENSG00000069431 ENSG00000069431 HGNC:60 ABCD1 gene ABCD1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Adrenoleukodystrophy MIM#300100 False 3 100;0;0 1.2304 True ENSG00000101986 ENSG00000101986 HGNC:61 ABCD4 gene ABCD4 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Methylmalonic aciduria and homocystinuria, cblJ type MIM#614857 22922874;31113616;30651581;28572511;33729671 False 3 100;0;0 1.2304 True ENSG00000119688 ENSG00000119688 HGNC:68 ABCG5 gene ABCG5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Sitosterolaemia 2, MIM# 618666 34304999;33907061;32546081;23556150 False 3 100;0;0 1.2304 True ENSG00000138075 ENSG00000138075 HGNC:13886 ABCG8 gene ABCG8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Sitosterolemia 1, MIM#210250 11099417 False 3 100;0;0 1.2304 True ENSG00000143921 ENSG00000143921 HGNC:13887 ABHD12 gene ABHD12 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and cataract MIM#612674 20797687;24697911 False 3 100;0;0 1.2304 True ENSG00000100997 ENSG00000100997 HGNC:15868 ABHD16A gene ABHD16A Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 86, autosomal recessive, MIM# 619735;Intellectual Disability;Corpus callosum abnormalities PMID: 34587489 False 3 100;0;0 1.2304 True ENSG00000204427 ENSG00000204427 HGNC:13921 ABHD5 gene ABHD5 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Chanarin-Dorfman syndrome MIM#275630;neutral lipid storage disease with ichthyosis;non-bullous congenital ichthyosiform erythroderma 30795549 False 3 100;0;0 1.2304 True ENSG00000011198 ENSG00000011198 HGNC:21396 ABL1 gene ABL1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Congenital heart defects and skeletal malformations syndrome MIM#617602 PMID: 28288113;30855488;32643838 False 3 50;50;0 1.2304 True Other ENSG00000097007 ENSG00000097007 HGNC:76 ACAD8 gene ACAD8 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Isobutyryl-CoA dehydrogenase deficiency MIM#611283 PMID: 34544473;12359132;17304052 False 3 100;0;0 1.2304 True ENSG00000151498 ENSG00000151498 HGNC:87 ACAD9 gene ACAD9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 20 MIM#611126 30025539 False 3 100;0;0 1.2304 True ENSG00000177646 ENSG00000177646 HGNC:21497 ACADM gene ACADM Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Acyl-CoA dehydrogenase, medium chain, deficiency of, MIM# 201450 False 3 100;0;0 1.2304 True ENSG00000117054 ENSG00000117054 HGNC:89 ACADSB gene ACADSB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal 2-methylbutyrylglycinuria MIM#610006 PMID: 25778941;17945527 False 3 100;0;0 1.2304 True ENSG00000196177 ENSG00000196177 HGNC:91 ACADVL gene ACADVL Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal VLCAD deficiency, MIM# 201475 False 3 100;0;0 1.2304 True ENSG00000072778 ENSG00000072778 HGNC:92 ACAN gene ACAN Expert list;Expert Review Green Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Short stature and advanced bone age, with or without early-onset osteoarthritis and/or osteochondritis dissecans, OMIM# 165800;Spondyloepimetaphyseal dysplasia, aggrecan type 612813" 24762113;27870580;19110214;30124491;28331218;20137779 False 3 100;0;0 1.2304 True ENSG00000157766 ENSG00000157766 HGNC:319 ACAT1 gene ACAT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Alpha-methylacetoacetic aciduria, MIM#203750;Beta-ketothiolase deficiency MONDO:0008760 False 3 100;0;0 1.2304 True ENSG00000075239 ENSG00000075239 HGNC:93 ACBD5 gene ACBD5 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Retinal dystrophy with leukodystrophy, MIM# 618863 27799409;23105016;33427402 False 3 50;50;0 1.2304 True ENSG00000107897 ENSG00000107897 HGNC:23338 ACBD6 gene ACBD6 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with progressive movement abnormalities, MIM# 620785 36457943;21937992;35446914 False 3 100;0;0 1.2304 True ENSG00000230124 ENSG00000230124 HGNC:23339 ACD gene ACD Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal telomere syndrome MONDO:0100137;dyskeratosis congenita, autosomal dominant 6 MONDO:0014690;Hoyeraal-Hreidarsson syndrome MONDO:0018045 27807141;31515401;30995915;27528712;25205116;24316971;30064976;33446513;25233904 False 3 50;0;50 1.2304 True ENSG00000102977 ENSG00000102977 HGNC:25070 ACE gene ACE Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Renal tubular dysgenesis, MIM# 267430 16116425;22095942 False 3 100;0;0 1.2304 True ENSG00000159640 ENSG00000159640 HGNC:2707 ACER3 gene ACER3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Leukodystrophy 32816236;26792856 False 3 100;0;0 1.2304 True ENSG00000078124 ENSG00000078124 HGNC:16066 ACO2 gene ACO2 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Infantile cerebellar-retinal degeneration, MIM#614559;Optic atrophy 9, MIM# 616289 22405087;25351951;30689204;32519519;25351951;34056600 False 3 100;0;0 1.2304 True ENSG00000100412 ENSG00000100412 HGNC:118 ACOX1 gene ACOX1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Peroxisomal acyl-CoA oxidase deficiency, MIM# 264470;Mitchell syndrome, MIM# 618960 32169171;17458872 False 3 100;0;0 1.2304 True ENSG00000161533 ENSG00000161533 HGNC:119 ACOX2 gene ACOX2 Expert Review;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Bile acid synthesis defect, congenital, 6, 617308 27647924;27884763;29287774;35395098 False 3 100;0;0 1.2304 True ENSG00000168306 ENSG00000168306 HGNC:120 ACP4 gene ACP4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Amelogenesis imperfecta, type IJ MIM#617297 28513613;27843125;33552707 False 3 100;0;0 1.2304 True ENSG00000142513 ENSG00000142513 HGNC:14376 ACP5 gene ACP5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spondyloenchondrodysplasia with immune dysregulation, OMIM# 607944 26854080;26951490;21217755;26789720;2363422;21217752 False 3 100;0;0 1.2304 True ENSG00000102575 ENSG00000102575 HGNC:124 ACSL4 gene ACSL4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Mental retardation, X-linked 63, MIM# 300387 XLD 11889465;12525535 False 3 100;0;0 1.2304 True ENSG00000068366 ENSG00000068366 HGNC:3571 ACTA1 gene ACTA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Congenital myopathy 2C, severe infantile, autosomal dominant, MIM# 620278;Myopathy, actin, congenital, with cores, MIM#161800;Myopathy, actin, congenital, with excess of thin myofilaments, MIM#161800;Myopathy, congenital, with fiber-type disproportion 1, MIM#255310;Nemaline myopathy 3, MIM#161800;?Myopathy, scapulohumeroperoneal 19562689;15236405 False 3 100;0;0 1.2304 True ENSG00000143632 ENSG00000143632 HGNC:129 ACTB gene ACTB Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Baraitser-Winter syndrome 1 243310;Thrombocytopenia 8, with dysmorphic features and developmental delay, MIM# 620475;ACTB-related neurodevelopment disorder 29220674 False 3 100;0;0 1.2304 True Other ENSG00000075624 ENSG00000075624 HGNC:132 ACTC1 gene ACTC1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Atrial septal defect 5 MIM#612794;Cardiomyopathy, dilated, 1R MIM#613424;Cardiomyopathy, hypertrophic, 11 MIM#612098;ACTC1 related distal arthrogryposis MONDO:0019942 PMID: 36945405 False 3 100;0;0 1.2304 True ENSG00000159251 ENSG00000159251 HGNC:143 ACTG1 gene ACTG1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Baraitser-Winter syndrome 2 MIM#614583;Deafness, autosomal dominant 20/26 MIM#604717 PMID: 29620237 False 3 100;0;0 1.2304 True Other ENSG00000184009 ENSG00000184009 HGNC:144 ACTG2 gene ACTG2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Visceral myopathy, MIM#155310;Megacystis-microcolon-intestinal hypoperistalsis syndrome 5, MIM# 619431" False 3 100;0;0 1.2304 True ENSG00000163017 ENSG00000163017 HGNC:145 ACTL6A gene ACTL6A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, ACTL6A-related 28649782;31994175 False 3 100;0;0 1.2304 True ENSG00000136518 ENSG00000136518 HGNC:24124 ACTL6B gene ACTL6B Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Epileptic encephalopathy, early infantile, 76, MIM# 618468;Intellectual developmental disorder with severe speech and ambulation defects, MIM# 618470" 31134736;31031012;30656450;30237576 False 3 100;0;0 1.2304 True ENSG00000077080 ENSG00000077080 HGNC:160 ACTL9 gene ACTL9 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Spermatogenic failure 53, MIM#619258;Fertilization failure;male infertility PMID: 33626338 False 3 100;0;0 1.2304 True ENSG00000181786 ENSG00000181786 HGNC:28494 ACTN1 gene ACTN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Bleeding disorder, platelet-type, 15, MIM# 615193 23434115 False 3 100;0;0 1.2304 True ENSG00000072110 ENSG00000072110 HGNC:163 ACTN2 gene ACTN2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myopathy, distal, 6, adult onset MIM#618655;Cardiomyopathy, hypertrophic, 23, with or without LVNC MIM#612158;Cardiomyopathy, dilated, 1AA, with or without LVNC MIM#612158;Myopathy, congenital with structured cores and Z-line abnormalities MIM#618654 PMID: 34802252;27287556 False 3 67;33;0 1.2304 True ENSG00000077522 ENSG00000077522 HGNC:164 ACTN4 gene ACTN4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Glomerulosclerosis, focal segmental, 1, MIM#603278 26740551;22351778;10700177;26301083 False 3 100;0;0 1.2304 True Other ENSG00000130402 ENSG00000130402 HGNC:166 ACVR1 gene ACVR1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Fibrodysplasia ossificans progressiva, MIM# 135100;Congenital heart disease 16642017;29089047 False 3 100;0;0 1.2304 True ENSG00000115170 ENSG00000115170 HGNC:171 ACVRL1 gene ACVRL1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Telangiectasia, hereditary hemorrhagic, type 2 MIM#600376 PMID: 16542389 False 3 100;0;0 1.2304 True ENSG00000139567 ENSG00000139567 HGNC:175 ACY1 gene ACY1 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Aminoacylase 1 deficiency, MIM# 609924 16274666;16465618;17562838;24117009 False 3 100;0;0 1.2304 True ENSG00000243989 ENSG00000243989 HGNC:177 ADA gene ADA Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Severe combined immunodeficiency due to ADA deficiency, MIM# 102700;MONDO:0007064 3007108;3475710;8178821;8227344;2783588;3684597;1680289 False 3 100;0;0 1.2304 True ENSG00000196839 ENSG00000196839 HGNC:186 ADA2 gene ADA2 Expert Review Green;Literature;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Vasculitis, autoinflammation, immunodeficiency, and haematologic defects syndrome, MIM# 615688 24552284;24552285;33791889 False 3 100;0;0 1.2304 True ENSG00000093072 ENSG00000093072 HGNC:1839 ADAM17 gene ADAM17 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Inflammatory neonatal-onset skin and bowel disease, MIM#614328 22010916;25804906;21041656;22236242 False 3 0;100;0 1.2304 True ENSG00000151694 ENSG00000151694 HGNC:195 ADAM22 gene ADAM22 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 61 (MIM#617933) 27066583;30237576;35373813 False 3 50;50;0 1.2304 True ENSG00000008277 ENSG00000008277 HGNC:201 ADAM9 gene ADAM9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cone-rod dystrophy 9 MIM#612775 PMID: 25091951;19409519 False 3 100;0;0 1.2304 True ENSG00000168615 ENSG00000168615 HGNC:216 ADAMTS10 gene ADAMTS10 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Weill-Marchesani syndrome 1, recessive, MIM#277600 15368195;18567016;19836009 False 3 100;0;0 1.2304 True ENSG00000142303 ENSG00000142303 HGNC:13201 ADAMTS13 gene ADAMTS13 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Thrombotic thrombocytopenic purpura, hereditary, MIM# 274150 11586351;30312976 False 3 100;0;0 1.2304 True ENSG00000160323 ENSG00000160323 HGNC:1366 ADAMTS15 gene ADAMTS15 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Arthrogryposis, distal, type 12, MIM# 620545 PMID: 35962790 False 3 100;0;0 1.2304 True ENSG00000166106 ENSG00000166106 HGNC:16305 ADAMTS17 gene ADAMTS17 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Weill-Marchesani 4 syndrome, recessive, MIM# 613195 19836009;22486325;24940034;30712880 False 3 100;0;0 1.2304 True ENSG00000140470 ENSG00000140470 HGNC:17109 ADAMTS18 gene ADAMTS18 Expert Review Green;Other Mendeliome BIALLELIC, autosomal or pseudoautosomal microcornea-myopic chorioretinal atrophy (MONDO:0014195) https://search.clinicalgenome.org/CCID:004057 False 3 100;0;0 1.2304 True ENSG00000140873 ENSG00000140873 HGNC:17110 ADAMTS19 gene ADAMTS19 Expert Review;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Cardiac valvular dysplasia 2, MIM# 620067 31844321;32323311 False 3 50;50;0 1.2304 True ENSG00000145808 ENSG00000145808 HGNC:17111 ADAMTS2 gene ADAMTS2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ehlers-Danlos syndrome, dermatosparaxis type (MIM# 225410) 30071989;26765342;28306229 False 3 100;0;0 1.2304 True ENSG00000087116 ENSG00000087116 HGNC:218 ADAMTS3 gene ADAMTS3 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Hennekam lymphangiectasia-lymphedema syndrome 3 (618154) 28985353;30450763 False 3 100;0;0 1.2304 True ENSG00000156140 ENSG00000156140 HGNC:219 ADAMTSL2 gene ADAMTSL2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Geleophysic dysplasia 1, MIM# 231050;Dermatosparaxic Ehlers Danlos syndrome 33369194;26879370;21415077 False 3 100;0;0 1.2304 True ENSG00000197859 ENSG00000197859 HGNC:14631 ADAMTSL4 gene ADAMTSL4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ectopia lentis, isolated, autosomal recessive, MIM# 225100 19200529;20564469;20141359;21051722 False 3 100;0;0 1.2304 True ENSG00000143382 ENSG00000143382 HGNC:19706 ADAR gene ADAR Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 6, MIM# 615010;Dyschromatosis symmetrica hereditaria, MIM# 127400 False 3 100;0;0 1.2304 True ENSG00000160710 ENSG00000160710 HGNC:225 ADARB1 gene ADARB1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with hypotonia, microcephaly, and seizures, 618862;Intellectual disability;microcephaly;seizures 32220291;32719099 False 3 100;0;0 1.2304 True ENSG00000197381 ENSG00000197381 HGNC:226 ADAT3 gene ADAT3 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mental retardation, autosomal recessive 36, MIM#615286 23620220;26842963;29796286 False 3 100;0;0 1.2304 True ENSG00000213638 ENSG00000213638 HGNC:25151 ADCY5 gene ADCY5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Dyskinesia, familial, with facial myokymia, MIM# 606703;MONDO:0011707;Hyperkinetic movement disorder with dyskinesia, myoclonus, chorea, and dystonia-2 (HYDMCD2), MIM#619647;Neurodevelopmental disorder with hyperkinetic movements and dyskinesia (NEDHYD), MIM#619651 22782511;24700542;33051786;32647899;33704598;34631954;28971144;30975617 False 3 100;0;0 1.2304 True ENSG00000173175 ENSG00000173175 HGNC:236 ADCY6 gene ADCY6 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Lethal congenital contracture syndrome 8, OMIM # 616287;MONDO:0014570 24319099;26257172;31846058;33820833 False 3 100;0;0 1.2304 True ENSG00000174233 ENSG00000174233 HGNC:237 ADD1 gene ADD1 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Neurodevelopmental disorder MONDO:0700092, ADD1-related PMID: 34906466 False 3 100;0;0 1.2304 True ENSG00000087274 ENSG00000087274 HGNC:243 ADD3 gene ADD3 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Cerebral palsy, spastic quadriplegic, 3, MIM#617008 29768408;23836506 False 3 100;0;0 1.2304 True ENSG00000148700 ENSG00000148700 HGNC:245 ADGRG1 gene ADGRG1 Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Polymicrogyria, bilateral frontoparietal, MIM#606854 16240336;33299078;24531968 False 3 100;0;0 1.2304 True ENSG00000205336 ENSG00000205336 HGNC:4512 ADGRG6 gene ADGRG6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Lethal congenital contracture syndrome 9;OMIM #616503 30549416;26004201 False 3 100;0;0 1.2304 True ENSG00000112414 ENSG00000112414 HGNC:13841 ADGRL1 gene ADGRL1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Developmental delay, behavioral abnormalities, and neuropsychiatric disorders, MIM# 620065 PMID: 35907405 False 3 100;0;0 1.2304 True ENSG00000072071 ENSG00000072071 HGNC:20973 ADGRV1 gene ADGRV1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Febrile seizures, familial, 4 MIM#604352;Usher syndrome, type 2C MIM#60547;Usher syndrome, type 2C, GPR98/PDZD7 digenic MIM#605472 False 3 100;0;0 1.2304 True ENSG00000164199 ENSG00000164199 HGNC:17416 ADH5 gene ADH5 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal AMED syndrome, digenic, MIM# 619151;Aplastic anaemia;myelodysplasia;short stature 33147438 False 3 100;0;0 1.2304 True ENSG00000197894 ENSG00000197894 HGNC:253 ADK gene ADK Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypermethioninemia due to adenosine kinase deficiency, MIM# 614300 21963049;17120046;33309011 False 3 100;0;0 1.2304 True ENSG00000156110 ENSG00000156110 HGNC:257 ADNP gene ADNP Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Helsmoortel-van der Aa syndrome MIM#615873;MONDO:0014379 24531329;25057125;25533962;29724491;29911927 False 3 100;0;0 1.2304 True ENSG00000101126 ENSG00000101126 HGNC:15766 ADPRHL2 gene ADPRHL2 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodegeneration, childhood-onset, stress-induced, with variable ataxia and seizures, MIM#618170 30100084;30401461 False 3 100;0;0 1.2304 True ENSG00000116863 ENSG00000116863 HGNC:21304 ADSL gene ADSL Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Adenylosuccinase deficiency MIM#103050 1302001;22180458;18524658;27626380 False 3 100;0;0 1.2304 True ENSG00000239900 ENSG00000239900 HGNC:291 ADSSL1 gene ADSSL1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Myopathy, distal, 5, MIM#617030 26506222 False 3 100;0;0 1.2304 True ENSG00000185100 ENSG00000185100 HGNC:20093 AEBP1 gene AEBP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ehlers-Danlos syndrome, classic-like, 2, MIM# 618000 29606302;30668708;30548383;30759870 False 3 100;0;0 1.2304 True ENSG00000106624 ENSG00000106624 HGNC:303 AFF2 gene AFF2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Intellectual disability, X-linked, FRAXE type, MIM#309548 8334699;21739600 False 3 100;0;0 1.2304 True ENSG00000155966 ENSG00000155966 HGNC:3776 AFF3 gene AFF3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted KINSSHIP syndrome, MIM# 619297 31388108;33961779 False 3 100;0;0 1.2304 True ENSG00000144218 ENSG00000144218 HGNC:6473 AFF4 gene AFF4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted CHOPS syndrome, MIM#616368;MONDO:0014609 25730767;33248856;31630891;31058441 False 3 100;0;0 1.2304 True ENSG00000072364 ENSG00000072364 HGNC:17869 AFG3L2 gene AFG3L2 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic ataxia 5, autosomal recessive (MIM#614487);Spinocerebellar ataxia 28 (MIM#610246);Optic atrophy 12, MIM# 618977 20725928;29181157;26539208;30252181;30389403;32219868;32600459;32548275 False 3 100;0;0 1.2304 True ENSG00000141385 ENSG00000141385 HGNC:315 AGA gene AGA Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Aspartylglucosaminuria, MIM# 208400;MONDO:0008830 1703489;1904874;8064811;8946839 False 3 100;0;0 1.2304 True ENSG00000038002 ENSG00000038002 HGNC:318 AGBL5 gene AGBL5 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Retinitis pigmentosa 75, MIM# 617023" 26720455;26355662;30925032 False 3 100;0;0 1.2304 True ENSG00000084693 ENSG00000084693 HGNC:26147 AGK gene AGK Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Sengers syndrome, MIM#212350;Cataract 38 MIM#614691 22415731;25208612;22415731;25208612 False 3 100;0;0 1.2304 True ENSG00000006530 ENSG00000006530 HGNC:21869 AGL gene AGL Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease IIIa and IIIb, MIM#232400 False 3 100;0;0 1.2304 True ENSG00000162688 ENSG00000162688 HGNC:321 AGMO gene AGMO Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092, AGMO-related 31555905 False 3 100;0;0 1.2304 True ENSG00000187546 ENSG00000187546 HGNC:33784 AGO1 gene AGO1 Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with language delay and behavioral abnormalities, with or without seizures, MIM# 620292 35060114;30213762;22495306;23020937;25363768;25356899;27620904;29346770;28135719 False 3 100;0;0 1.2304 True ENSG00000092847 ENSG00000092847 HGNC:3262 AGO2 gene AGO2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Lessel-Kreienkamp syndrome (LESKRES), MIM#619149;Intellectual disability 33199684 False 3 100;0;0 1.2304 True ENSG00000123908 ENSG00000123908 HGNC:3263 AGPAT2 gene AGPAT2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Lipodystrophy, congenital generalized, type 1 MIM#608594 32876150;11967537 False 3 100;0;0 1.2304 True ENSG00000169692 ENSG00000169692 HGNC:325 AGPS gene AGPS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Rhizomelic chondrodysplasia punctata, type 3, MIM# 600121 9553082;8611652;21990100 False 3 100;0;0 1.2304 True ENSG00000018510 ENSG00000018510 HGNC:327 AGR2 gene AGR2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Recurrent respiratory infections and failure to thrive with or without diarrhea (RIFTD), MIM#620233 34952832 False 3 100;0;0 1.2304 True ENSG00000106541 ENSG00000106541 HGNC:328 AGRN gene AGRN Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 8, with pre- and postsynaptic defects, MIM# 615120 19631309;22205389;32221959 False 3 100;0;0 1.2304 True ENSG00000188157 ENSG00000188157 HGNC:329 AGT gene AGT Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Renal tubular dysgenesis, MIM# 267430 16116425;34234805;33163725 False 3 100;0;0 1.2304 True ENSG00000135744 ENSG00000135744 HGNC:333 AGTPBP1 gene AGTPBP1 Expert Review Green;NHS GMS Mendeliome BIALLELIC, autosomal or pseudoautosomal Early onset cerebellar atrophy, developmental delay, and feeding and respiratory difficulties, severe motor neuronopathy;Neurodegeneration, childhood-onset, with cerebellar atrophy, 618276 30420557 False 3 100;0;0 1.2304 True ENSG00000135049 ENSG00000135049 HGNC:17258 AGTR1 gene AGTR1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Renal tubular dysgenesis, MIM# 267430 16116425 False 3 100;0;0 1.2304 True ENSG00000144891 ENSG00000144891 HGNC:336 AGXT gene AGXT Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hyperoxaluria, primary, type 1, MIM# 259900;MONDO:0009823 2039493;19479957 False 3 100;0;0 1.2304 True ENSG00000172482 ENSG00000172482 HGNC:341 AHCY gene AHCY Expert list;Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypermethioninemia with deficiency of S-adenosylhomocysteine hydrolase, MIM#613752 28779239;26095522;20852937;15024124;27626380;30121674 False 3 100;0;0 1.2304 True ENSG00000101444 ENSG00000101444 HGNC:343 AHDC1 gene AHDC1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Xia-Gibbs syndrome, MIM# 615829;AHDC1-related intellectual disability, obstructive sleep apnoea, mild dysmorphism syndrome MONDO:0014358 24791903;27148574;30152016 False 3 100;0;0 1.2304 True ENSG00000126705 ENSG00000126705 HGNC:25230 AHI1 gene AHI1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 3, MIM#608629 25616960 False 3 100;0;0 1.2304 True ENSG00000135541 ENSG00000135541 HGNC:21575 AICDA gene AICDA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency with hyper-IgM, type 2, MIM# 605258 11007475 False 3 100;0;0 1.2304 True ENSG00000111732 ENSG00000111732 HGNC:13203 AIFM1 gene AIFM1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Combined oxidative phosphorylation deficiency 6, 300816;Cowchock syndrome, 310490;Deafness, X-linked 5, 300614;Spondyloepimetaphyseal dysplasia, X-linked, with hypomyelinating leukodystrophy, 300232 28842795 False 3 100;0;0 1.2304 True ENSG00000156709 ENSG00000156709 HGNC:8768 AIMP1 gene AIMP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 3, MIM# 260600 21092922;24958424;33402283;32531460;30486714;30477741 False 3 100;0;0 1.2304 True ENSG00000164022 ENSG00000164022 HGNC:10648 AIP gene AIP Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Pituitary adenoma predisposition MIM#102200 16728643;17360484;26187128 False 3 100;0;0 1.2304 True ENSG00000110711 ENSG00000110711 HGNC:358 AIPL1 gene AIPL1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Leber congenital amaurosis 4, 604393;Cone-rod dystrophy, 604393;Retinitis pigmentosa, juvenile, 604393 10615133 False 3 100;0;0 1.2304 True ENSG00000129221 ENSG00000129221 HGNC:359 AIRE gene AIRE Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Autoimmune polyendocrinopathy syndrome , type I, with or without reversible metaphyseal dysplasia, MIM#240300 False 3 100;0;0 1.2304 True Other ENSG00000160224 ENSG00000160224 HGNC:360 AJAP1 gene AJAP1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted neurodevelopmental disorder, MONDO:0700092 38985877 False 3 100;0;0 1.2304 True ENSG00000196581 ENSG00000196581 HGNC:30801 AK1 gene AK1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Haemolytic anaemia due to adenylate kinase deficiency, MIM# 612631 2542324;9432020;10233365;34321014 False 3 100;0;0 1.2304 True ENSG00000106992 ENSG00000106992 HGNC:361 AK2 gene AK2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Reticular dysgenesis, MIM# 267500;MONDO:0009973 19043416;19043417 False 3 100;0;0 1.2304 True ENSG00000004455 ENSG00000004455 HGNC:362 AKR1D1 gene AKR1D1 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bile acid synthesis defect, congenital, 2, MIM# 235555 12970144;20522910 False 3 100;0;0 1.2304 True ENSG00000122787 ENSG00000122787 HGNC:388 AKT1 gene AKT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cowden syndrome 6, MIM#615109;Proteus syndrome, MIM#176920 23246288 False 3 50;50;0 1.2304 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000142208 ENSG00000142208 HGNC:391 AKT2 gene AKT2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Hypoinsulinemic hypoglycemia and body hemihypertrophy, MONDO:0009416;Hypoinsulinemic hypoglycemia with hemihypertrophy, OMIM:240900;Diabetes mellitus, type II , MIM#125853" 24285683;21979934;28502730;15166380;19164855 False 3 100;0;0 1.2304 True ENSG00000105221 ENSG00000105221 HGNC:392 AKT3 gene AKT3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 2 MIM#615937 PMID: 22729224 False 3 100;0;0 1.2304 True Other ENSG00000117020 ENSG00000117020 HGNC:393 AL117258.1 gene AL117258.1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Heterotaxy MONDO:0018677, congenital heart defects 34903892 False 3 100;0;0 1.2304 True - ENSG00000283654 HGNC:53647 ALAD gene ALAD Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Porphyria, acute hepatic , MIM#612740 16343966;30724374;2063868;1569184;15303011 False 3 100;0;0 1.2304 True ENSG00000148218 ENSG00000148218 HGNC:395 ALAS2 gene ALAS2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Anaemia, sideroblastic, 1, MIM# 300751;Protoporphyria, erythropoietic, X-linked, MIM# 300752 10029606;7949148;10029606;25615817 False 3 100;0;0 1.2304 True ENSG00000158578 ENSG00000158578 HGNC:397 ALB gene ALB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Familial dysalbuminaemic hyperthyroxinaemia;[Dysalbuminemic hyperthyroxinemia], 615999;Analbuminemia, MIM# 616000 29163366;24646103;8064810;27834068;32635414 False 3 100;0;0 1.2304 True ENSG00000163631 ENSG00000163631 HGNC:399 ALDH18A1 gene ALDH18A1 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Cutis laxa, autosomal recessive, type IIIA MIM#219150;Spastic paraplegia 9A, autosomal dominant MIM#601162;Spastic paraplegia 9B, autosomal recessive MIM#616586;Cutis laxa, autosomal dominant 3 MIM#616603;disorders of ornithine or proline metabolism 32221810;11092761;29754261;26026163 False 3 100;0;0 1.2304 True ENSG00000059573 ENSG00000059573 HGNC:9722 ALDH1A2 gene ALDH1A2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Diaphragmatic hernia 4, with cardiovascular defects, MIM# 620025 33565183;10192400 False 3 67;0;33 1.2304 True ENSG00000128918 ENSG00000128918 HGNC:15472 ALDH1A3 gene ALDH1A3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microphthalmia, isolated 8, MIM# 615113 23312594;23591992;30200890;28890889;26873617;24777706 False 3 100;0;0 1.2304 True ENSG00000184254 ENSG00000184254 HGNC:409 ALDH3A2 gene ALDH3A2 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Sjogren-Larsson syndrome MIM#270200;spasticity;ichthyosis;intellectual disability 31273323 False 3 100;0;0 1.2304 True ENSG00000072210 ENSG00000072210 HGNC:403 ALDH4A1 gene ALDH4A1 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hyperprolinemia, type II MIM#239510;disorders of ornithine or proline metabolism 9700195;34037900;31884946 False 3 100;0;0 1.2304 True ENSG00000159423 ENSG00000159423 HGNC:406 ALDH5A1 gene ALDH5A1 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Succinic semialdehyde dehydrogenase deficiency, MIM# 271980 9683595;14635103;32402538 False 3 100;0;0 1.2304 True ENSG00000112294 ENSG00000112294 HGNC:408 ALDH6A1 gene ALDH6A1 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Methylmalonate semialdehyde dehydrogenase deficiency MIM#614105;disorder of valine and pyrimidine metabolism 32151545;10947204;21863277;23835272 False 3 100;0;0 1.2304 True ENSG00000119711 ENSG00000119711 HGNC:7179 ALDH7A1 gene ALDH7A1 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Epilepsy, pyridoxine-dependent, MIM# 266100 32969477 False 3 100;0;0 1.2304 True ENSG00000164904 ENSG00000164904 HGNC:877 ALDOA gene ALDOA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease XII , MIM#611881 7331996;8598869;25392908 False 3 100;0;0 1.2304 True ENSG00000149925 ENSG00000149925 HGNC:414 ALDOB gene ALDOB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Fructose intolerance, hereditary, 229600 3083321 False 3 100;0;0 1.2304 True ENSG00000136872 ENSG00000136872 HGNC:417 ALG1 gene ALG1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Ik, MIM# 608540 26931382 False 3 100;0;0 1.2304 True ENSG00000033011 ENSG00000033011 HGNC:18294 ALG11 gene ALG11 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Ip, MIM# 613661 30676690 False 3 100;0;0 1.2304 True ENSG00000253710 ENSG00000253710 HGNC:32456 ALG12 gene ALG12 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Ig, MIM# 607143 31481313 False 3 100;0;0 1.2304 True ENSG00000182858 ENSG00000182858 HGNC:19358 ALG13 gene ALG13 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Congenital disorder of glycosylation, type Is (MIM# 300884) 23033978;23934111;24781210;24896178;25732998;26138355;26482601;28940310;32238909 False 3 100;0;0 1.2304 True ENSG00000101901 ENSG00000101901 HGNC:30881 ALG14 gene ALG14 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 15, without tubular aggregates 616227;Intellectual developmental disorder with epilepsy, behavioral abnormalities, and coarse facies (IDDEBF), MIM#619031;Myopathy, epilepsy, and progressive cerebral atrophy, MIM# 619036;Disorder of N-glycosylation 30221345;23404334;28733338 False 3 100;0;0 1.2304 True ENSG00000172339 ENSG00000172339 HGNC:28287 ALG3 gene ALG3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Id, MIM# 601110 31067009 False 3 100;0;0 1.2304 True ENSG00000214160 ENSG00000214160 HGNC:23056 ALG5 gene ALG5 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Polycystic kidney disease 7, MIM# 620056 35896117 False 3 100;0;0 1.2304 True ENSG00000120697 ENSG00000120697 HGNC:20266 ALG6 gene ALG6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Ic (MIM#603147) 10914684;27498540 False 3 100;0;0 1.2304 True ENSG00000088035 ENSG00000088035 HGNC:23157 ALG8 gene ALG8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Congenital disorder of glycosylation, type Ih, MIM# 608104;Polycystic liver disease 3 with or without kidney cysts, MIM# 617874" 26066342;28375157;15235028;35716054 False 3 100;0;0 1.2304 True ENSG00000159063 ENSG00000159063 HGNC:23161 ALG9 gene ALG9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Il, MIM#608776;Gillessen-Kaesbach-Nishimura syndrome, MIM# 263210;Polycystic kidney disease;ALG9-associated autosomal dominant polycystic kidney disease MONDO:0700000 28932688;25966638;26453364;30676690 False 3 100;0;0 1.2304 True ENSG00000086848 ENSG00000086848 HGNC:15672 ALK gene ALK Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Neuroblastoma, susceptibility to, 3} 613014;Spastic-dystonic diplegia 32989326;18724359 False 3 100;0;0 1.2304 True ENSG00000171094 ENSG00000171094 HGNC:427 ALKBH8 gene ALKBH8 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Intellectual developmental disorder, autosomal recessive 71, MIM#618504 31079898 False 3 100;0;0 1.2304 True ENSG00000137760 ENSG00000137760 HGNC:25189 ALMS1 gene ALMS1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Alstrom syndrome MIM#203800 PMID: 17594715 False 3 100;0;0 1.2304 True ENSG00000116127 ENSG00000116127 HGNC:428 ALOX12B gene ALOX12B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ichthyosis, congenital, autosomal recessive 2, MIM# 242100 16116617;11773004 False 3 100;0;0 1.2304 True ENSG00000179477 ENSG00000179477 HGNC:430 ALOXE3 gene ALOXE3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ichthyosis, congenital, autosomal recessive 3, MIM#606545 16116617;31046801;26370990 False 3 100;0;0 1.2304 True ENSG00000179148 ENSG00000179148 HGNC:13743 ALPK1 gene ALPK1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Periodic fever, aphthous stomatitis, pharyngitis and adenitis (PFAPA) syndrome;Retinal dystrophy, optic nerve edema, splenomegaly, anhidrosis, and migraine headache (ROSAH) syndrome, MIM#614979 31053777;30967659;31939038 False 3 100;0;0 1.2304 True ENSG00000073331 ENSG00000073331 HGNC:20917 ALPK3 gene ALPK3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Cardiomyopathy, familial hypertrophic 27, MIM# 618052 26846950;27106955;32480058 False 3 100;0;0 1.2304 True ENSG00000136383 ENSG00000136383 HGNC:17574 ALPL gene ALPL Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Hypophosphatasia, adult 146300 (AD, AR);Hypophosphatasia, childhood 241510 AR;Hypophosphatasia, infantile 241500 AR;Odontohypophosphatasia 146300 AD, AR 19500388;23688511 False 3 100;0;0 1.2304 True Other ENSG00000162551 ENSG00000162551 HGNC:438 ALS2 gene ALS2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Infantile onset ascending spastic paralysis (MIM#607225);Juvenile amyotrophic lateral sclerosis 2 (MIM#205100);Juvenile primary lateral sclerosis (MIM#606353) PMID: 30128655;33409823 False 3 100;0;0 1.2304 True ENSG00000003393 ENSG00000003393 HGNC:443 ALX1 gene ALX1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Frontonasal dysplasia 3, MIM#613456 27324866;20451171;23059813 False 3 100;0;0 1.2304 True ENSG00000180318 ENSG00000180318 HGNC:1494 ALX3 gene ALX3 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Frontonasal dysplasia 1, MIM#136760 19409524 False 3 100;0;0 1.2304 True ENSG00000156150 ENSG00000156150 HGNC:449 ALX4 gene ALX4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Frontonasal dysplasia 2 MIM# 613451;Parietal foramina 2 MIM# 609597;{Craniosynostosis 5, susceptibility to} MIM#615529 22829454;34586326 False 3 100;0;0 1.2304 True ENSG00000052850 ENSG00000052850 HGNC:450 AMACR gene AMACR Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bile acid synthesis defect, congenital, 4, MIM# 214950;Alpha-methylacyl-CoA racemase deficiency, MIM# 614307 31951345;24735479;12512044;10655068;34267495;33047465 False 3 100;0;0 1.2304 True ENSG00000242110 ENSG00000242110 HGNC:451 AMBN gene AMBN Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Amelogenesis imperfecta, type IF MIM#616270 24858907;26502894;31402633;30174330 False 3 100;0;0 1.2304 True ENSG00000178522 ENSG00000178522 HGNC:452 AMBRA1 gene AMBRA1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neural tube defects, susceptibility to, MONDO:0020705, AMBRA1-related 17589504;32333458 False 3 100;0;0 1.2304 True ENSG00000110497 ENSG00000110497 HGNC:25990 AMELX gene AMELX Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Amelogenesis imperfecta, type 1E, MIM# 301200 17189466;22243263;7599636;23251683;1483698 1916828;9188994;15111628;11201048;26502894;7782077;11922869;28130977;8406474;11839357;25117480;19610109 False 3 100;0;0 1.2304 True ENSG00000125363 ENSG00000125363 HGNC:461 AMER1 gene AMER1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Osteopathia striata with cranial sclerosis, MIM# 300373 20209645;19079258 False 3 100;0;0 1.2304 True ENSG00000184675 ENSG00000184675 HGNC:26837 AMFR gene AMFR Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 89, autosomal recessive, MIM# 620379 37119330 False 3 100;0;0 1.2304 True ENSG00000159461 ENSG00000159461 HGNC:463 AMH gene AMH Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Persistent Mullerian duct syndrome, type I (MIM#261550) 32172781 False 3 100;0;0 1.2304 True ENSG00000104899 ENSG00000104899 HGNC:464 AMHR2 gene AMHR2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Persistent Mullerian duct syndrome, type II MIM#261550 34810374 False 3 100;0;0 1.2304 True ENSG00000135409 ENSG00000135409 HGNC:465 AMMECR1 gene AMMECR1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Midface hypoplasia, hearing impairment, elliptocytosis, and nephrocalcinosis, MIM# 300990 27811305;28089922;29193635 False 3 100;0;0 1.2304 True ENSG00000101935 ENSG00000101935 HGNC:467 AMN gene AMN Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Imerslund-Grasbeck syndrome 2, MIM# 618882 12590260;15024727;17285242;24156255;26040326 False 3 100;0;0 1.2304 True ENSG00000166126 ENSG00000166126 HGNC:14604 AMOTL1 gene AMOTL1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Orofacial clefting syndrome, MONDO:0015335, AMOTL1 -related 33026150;36751037 False 3 50;0;50 1.2304 True ENSG00000166025 ENSG00000166025 HGNC:17811 AMPD2 gene AMPD2 Expert Review Green;Other;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 9, MIM#615809 23911318;27066553 False 3 100;0;0 1.2304 True ENSG00000116337 ENSG00000116337 HGNC:469 AMT gene AMT Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Glycine encephalopathy MIM#605899;disorder of glycine metabolism 8188235;10873393;11592811 False 3 100;0;0 1.2304 True ENSG00000145020 ENSG00000145020 HGNC:473 ANAPC1 gene ANAPC1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Rothmund Thomson syndrome type 1, OMIM 618625 PMID: 31303264 False 3 100;0;0 1.2304 True ENSG00000153107 ENSG00000153107 HGNC:19988 ANGPT2 gene ANGPT2 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Lymphatic malformation-10, MIM#619369;Primary lymphoedema;Hydrops 32908006;34876502 False 3 100;0;0 1.2304 True ENSG00000091879 ENSG00000091879 HGNC:485 ANGPTL3 gene ANGPTL3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypobetalipoproteinemia, familial, 2 MIM#605019 23150577;20942659;22155345;22062970 False 3 100;0;0 1.2304 True ENSG00000132855 ENSG00000132855 HGNC:491 ANGPTL6 gene ANGPTL6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cerebral aneurysm 29304371 False 3 50;0;50 1.2304 True ENSG00000130812 ENSG00000130812 HGNC:23140 ANK1 gene ANK1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Spherocytosis, type 1 MIM#182900 8640229 False 3 100;0;0 1.2304 True ENSG00000029534 ENSG00000029534 HGNC:492 ANK2 gene ANK2 Expert Review;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Long QT syndrome 4, MIM# 600919;Complex neurodevelopmental disorder, MONDO:0100038 31983240;22542183;25363768;27479843;28554332;30564305;30755392;31981491;33004838;33057194 False 3 100;0;0 1.2304 True ENSG00000145362 ENSG00000145362 HGNC:493 ANK3 gene ANK3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mental retardation, autosomal recessive, 37 615493;Intellectual disability, autosomal dominant;coloboma MONDO#0001476, ANK3-related 23390136;28687526;34218362;35034853 False 3 50;50;0 1.2304 True ENSG00000151150 ENSG00000151150 HGNC:494 ANKH gene ANKH Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Chondrocalcinosis 2 MIM#118600;Craniometaphyseal dysplasia MIM#123000 32366894 False 3 100;0;0 1.2304 True ENSG00000154122 ENSG00000154122 HGNC:15492 ANKLE2 gene ANKLE2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephaly 16, primary, autosomal recessive, MIM# 616681 25259927;30214071;31735666 False 3 100;0;0 1.2304 True ENSG00000176915 ENSG00000176915 HGNC:29101 ANKRD11 gene ANKRD11 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted KBG syndrome, MIM # 148050 31191201;31337854 False 3 100;0;0 1.2304 True ENSG00000167522 ENSG00000167522 HGNC:21316 ANKRD17 gene ANKRD17 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Chopra-Amiel-Gordan syndrome, MIM# 619504;Intellectual disability;dysmorphic features 33909992 False 3 50;50;0 1.2304 True ENSG00000132466 ENSG00000132466 HGNC:23575 ANKRD26 gene ANKRD26 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Thrombocytopaenia 2, MIM# 188000 21211618 False 3 100;0;0 1.2304 True ENSG00000107890 ENSG00000107890 HGNC:29186 ANKRD31 gene ANKRD31 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Premature ovarian failure, MONDO:0019852, ANKRD31-related 34794894;34257419;31003867 False 3 100;0;0 1.2304 True ENSG00000145700 ENSG00000145700 HGNC:26853 ANKS6 gene ANKS6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Nephronophthisis 16, MIM# 615382;MONDO:0014158 23793029;31678577;31635528;26039630;24610927 False 3 100;0;0 1.2304 True ENSG00000165138 ENSG00000165138 HGNC:26724 ANO10 gene ANO10 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 10, MIM#613728 21092923;25182700 False 3 100;0;0 1.2304 True ENSG00000160746 ENSG00000160746 HGNC:25519 ANO3 gene ANO3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia 24, MIM#615034;familial form of cranio-cervical dystonia 33388357 False 3 100;0;0 1.2304 True ENSG00000134343 ENSG00000134343 HGNC:14004 ANO4 gene ANO4 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted neurodevelopmental disorder MONDO:0700092, ANO4-related 38744284 False 3 100;0;0 1.2304 True ENSG00000151572 ENSG00000151572 HGNC:23837 ANO5 gene ANO5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Gnathodiaphyseal dysplasia MIM#166260;Miyoshi muscular dystrophy 3 MIM#613319;Muscular dystrophy, limb-girdle, autosomal recessive 12 MIM#611307 32112655 False 3 100;0;0 1.2304 True ENSG00000171714 ENSG00000171714 HGNC:27337 ANO6 gene ANO6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Scott syndrome, MIM# 262890;MONDO:0009885 21107324;11895776;27879994;27634832 False 3 100;0;0 1.2304 True ENSG00000177119 ENSG00000177119 HGNC:25240 ANOS1 gene ANOS1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Hypogonadotropic hypogonadism 1 with or without anosmia (Kallmann syndrome 1), MIM# 308700 1594017;8504298;8989261 False 3 100;0;0 1.2304 True ENSG00000011201 ENSG00000011201 HGNC:6211 ANTXR1 gene ANTXR1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal GAPO syndrome, MIM# 230740 23602711;25045128;31425299;30575274;29436111;28870703 False 3 100;0;0 1.2304 True ENSG00000169604 ENSG00000169604 HGNC:21014 ANTXR2 gene ANTXR2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hyaline fibromatosis syndrome, MIM# 228600;MONDO:0009229 12973667;14508707 False 3 100;0;0 1.2304 True ENSG00000163297 ENSG00000163297 HGNC:21732 AP1B1 gene AP1B1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Keratitis-ichthyosis-deafness syndrome, autosomal recessive, MIM# 242150 31630788;31630791 False 3 100;0;0 1.2304 True ENSG00000100280 ENSG00000100280 HGNC:554 AP1G1 gene AP1G1 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Usmani-Riazuddin syndrome, autosomal dominant, MIM# 619467;Usmani-Riazuddin syndrome, autosomal recessive, MIM# 619548;Neurodevelopmental disorder (NDD);Intellectual Disability;Epilepsy 34102099 False 3 100;0;0 1.2304 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000166747 ENSG00000166747 HGNC:555 AP1S1 gene AP1S1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal MEDNIK syndrome 609313;non-syndromic congenital intestinal failure 32306098 False 3 50;50;0 1.2304 True ENSG00000106367 ENSG00000106367 HGNC:559 AP1S2 gene AP1S2 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Pettigrew syndrome, MIM# 304340 17186471;17617514;19377476;30714330;23756445 False 3 100;0;0 1.2304 True ENSG00000182287 ENSG00000182287 HGNC:560 AP2M1 gene AP2M1 Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Intellectual developmental disorder 60 with seizures, MIM# 618587" 31104773 False 3 100;0;0 1.2304 True ENSG00000161203 ENSG00000161203 HGNC:564 AP2S1 gene AP2S1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypocalciuric hypercalcaemia, type III, MIM# 600740;MONDO:0010926;Developmental disorder 33057194;23222959;33729479;33168530;3204769;31723423;29479578 False 3 100;0;0 1.2304 True ENSG00000042753 ENSG00000042753 HGNC:565 AP3B1 gene AP3B1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hermansky-Pudlak syndrome 2, MIM# 608233;MONDO:0011997 10024875;11809908;14566336 False 3 100;0;0 1.2304 True ENSG00000132842 ENSG00000132842 HGNC:566 AP3B2 gene AP3B2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 48, MIM# 617276 27431290;27866705;32705489 False 3 100;0;0 1.2304 True ENSG00000103723 ENSG00000103723 HGNC:567 AP3D1 gene AP3D1 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Hermansky-Pudlak syndrome 10, MIM# 617050;Oculocutaneous albinism;Severe neutropaenia;Recurrent infections;Seizures;Hearing loss;Neurodevelopmental delay" 26744459;9697856 False 3 100;0;0 1.2304 True ENSG00000065000 ENSG00000065000 HGNC:568 AP4B1 gene AP4B1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 47, autosomal recessive, MIM# 614066 21620353;22290197;24700674;24781758 False 3 100;0;0 1.2304 True ENSG00000134262 ENSG00000134262 HGNC:572 AP4E1 gene AP4E1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 51, autosomal recessive, MIM# 613744 20972249;21620353;21937992 False 3 100;0;0 1.2304 True ENSG00000081014 ENSG00000081014 HGNC:573 AP4M1 gene AP4M1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 50, autosomal recessive, MIM# 612936 19559397;21937992;21937992;32979048;31915823;29096665;28464862;25496299 False 3 100;0;0 1.2304 True ENSG00000221838 ENSG00000221838 HGNC:574 AP4S1 gene AP4S1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 52, autosomal recessive, MIM# 614067 21620353;25552650;32979048;32216065;31915823;30283821;27444738 False 3 100;0;0 1.2304 True ENSG00000100478 ENSG00000100478 HGNC:575 AP5Z1 gene AP5Z1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 48, autosomal recessive, MIM# 613647;MONDO:0013342 26085577;33543803;27606357 False 3 100;0;0 1.2304 True ENSG00000242802 ENSG00000242802 HGNC:22197 APC2 gene APC2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Cortical dysplasia, complex, with other brain malformations 10, MIM#618677 31585108 False 3 100;0;0 1.2304 True ENSG00000115266 ENSG00000115266 HGNC:24036 APCDD1 gene APCDD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypotrichosis 1, MIM#605389 22512811 False 3 50;50;0 1.2304 True ENSG00000154856 ENSG00000154856 HGNC:15718 APOA1 gene APOA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Amyloidosis, hereditary systemic 3, MIM# 620657;Amyloidosis, 3 or more types MIM#105200;Hypoalphalipoproteinemia, primary, 2 MIM#618463;Hypoalphalipoproteinemia, primary, 2, intermediate MIM#619836" False 3 100;0;0 1.2304 True ENSG00000118137 ENSG00000118137 HGNC:600 APOA4 gene APOA4 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary amyloidosis, MONDO:0018634, APOA4-related 38096951 False 3 100;0;0 1.2304 True ENSG00000110244 ENSG00000110244 HGNC:602 APOA5 gene APOA5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Hyperchylomicronemia, late-onset MIM#144650;{Hypertriglyceridemia, susceptibility to} MIM#145750 PMID: 19447388;16200213;11588264 False 3 100;0;0 1.2304 True ENSG00000110243 ENSG00000110243 HGNC:17288 APOC2 gene APOC2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hyperlipoproteinemia, type Ib MIM#207750 PMID: 32562799;26044956;32292609;32280258 False 3 100;0;0 1.2304 True ENSG00000234906 ENSG00000234906 HGNC:609 APOPT1 gene APOPT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 17, MIM#619061 25175347 False 3 100;0;0 1.2304 True ENSG00000256053 ENSG00000256053 HGNC:20492 APRT gene APRT Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Adenine phosphoribosyltransferase deficiency MIM#614723 PMID:3680503;2227934;7915931;1353080 False 3 100;0;0 1.2304 True ENSG00000198931 ENSG00000198931 HGNC:626 APTX gene APTX Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ataxia, early-onset, with oculomotor apraxia and hypoalbuminaemia MIM#208920 30986824;26256098;11586299 False 3 100;0;0 1.2304 True ENSG00000137074 ENSG00000137074 HGNC:15984 AQP2 gene AQP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Diabetes insipidus, nephrogenic, MIM#125800 7537761;11536078 False 3 100;0;0 1.2304 True ENSG00000167580 ENSG00000167580 HGNC:634 AQP5 gene AQP5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Palmoplantar keratoderma, Bothnian type MIM#600231 PMID: 35014096;23830519 False 3 100;0;0 1.2304 True ENSG00000161798 ENSG00000161798 HGNC:638 AR gene AR Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Hypospadias 1, X-linked MIM#30063;Androgen insensitivity MIM#300068;Androgen insensitivity, partial, with or without breast cancer MIM#312300;Spinal and bulbar muscular atrophy of Kennedy MIM#313200 PMID: 22334387 False 3 100;0;0 1.2304 True ENSG00000169083 ENSG00000169083 HGNC:644 ARCN1 gene ARCN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Short stature, rhizomelic, with microcephaly, micrognathia, and developmental delay (MIM#617164) 27476655;33154040 False 3 100;0;0 1.2304 True ENSG00000095139 ENSG00000095139 HGNC:649 ARF1 gene ARF1 Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Periventricular nodular heterotopia 8, MIM# 618185" 28868155;34353862;36345169 False 3 100;0;0 1.2304 True ENSG00000143761 ENSG00000143761 HGNC:652 ARF3 gene ARF3 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, ARF3-related 34346499;36369169 False 3 50;50;0 1.2304 True ENSG00000134287 ENSG00000134287 HGNC:654 ARFGEF1 gene ARFGEF1 Expert Review;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental delay, impaired speech, and behavioral abnormalities, MIM# 619964 34113008 False 3 100;0;0 1.2304 True ENSG00000066777 ENSG00000066777 HGNC:15772 ARFGEF2 gene ARFGEF2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Periventricular heterotopia with microcephaly (MIM#608097) 25160555;26126837;23812912 False 3 100;0;0 1.2304 True ENSG00000124198 ENSG00000124198 HGNC:15853 ARFGEF3 gene ARFGEF3 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia, MONDO:0044807, ARFGEF3-related PMID: 33098801 False 3 50;50;0 1.2304 True ENSG00000112379 ENSG00000112379 HGNC:21213 ARG1 gene ARG1 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Argininaemia MIM#207800;Urea cycle disorders and inherited hyperammonaemias;disorder of arginine metabolism 2365823;1598908;29726057 False 3 100;0;0 1.2304 True ENSG00000118520 ENSG00000118520 HGNC:663 ARHGAP29 gene ARHGAP29 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Clefting disorder, MONDO:0000358, ARHGAP29-related 27350171;23008150 False 3 100;0;0 1.2304 True ENSG00000137962 ENSG00000137962 HGNC:30207 ARHGAP31 gene ARHGAP31 Expert Review Green;Genetic Health Queensland;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Adams-Oliver syndrome 1, MIM#100300 PMID: 33655927;29924900 False 3 50;50;0 1.2304 True ENSG00000031081 ENSG00000031081 HGNC:29216 ARHGAP35 gene ARHGAP35 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypogonadotropic hypogonadism, MONDO:0015770, ARHGAP35-related;neurodevelopmental disorder, ARHGAP35-related MONDO#0700092;Developmental defect of the eye (MONDO:0020145), ARHGAP35-related 33057194;36450800;36178483 False 3 75;25;0 1.2304 True ENSG00000160007 ENSG00000160007 HGNC:4591 ARHGDIA gene ARHGDIA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Nephrotic syndrome, type 8 MIM#615244 PMID: 23867502;35060086 False 3 100;0;0 1.2304 True ENSG00000141522 ENSG00000141522 HGNC:678 ARHGEF18 gene ARHGEF18 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Retinitis pigmentosa 78 MIM#617433 PMID: 28132693 False 3 100;0;0 1.2304 True ENSG00000104880 ENSG00000104880 HGNC:17090 ARHGEF9 gene ARHGEF9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Epileptic encephalopathy, early infantile, 8, MIM# 300607 31942680;30048823;29130122;28620718 False 3 100;0;0 1.2304 True ENSG00000131089 ENSG00000131089 HGNC:14561 ARID1A gene ARID1A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Coffin-Siris syndrome 2 (MIM#614607) 23929686;22426308;25168959 False 3 50;50;0 1.2304 True ENSG00000117713 ENSG00000117713 HGNC:11110 ARID1B gene ARID1B Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Coffin-Siris syndrome 1 MIM#135900 False 3 50;50;0 1.2304 True ENSG00000049618 ENSG00000049618 HGNC:18040 ARID2 gene ARID2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Coffin-Siris syndrome 6, MIM#617808 30838730;26238514 False 3 100;0;0 1.2304 True ENSG00000189079 ENSG00000189079 HGNC:18037 ARIH1 gene ARIH1 Expert Review Green;Other Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Thoracic aortic aneurysm, MONDO:0005396, ARIH1-related 29689197;32102558 False 3 100;0;0 1.2304 True ENSG00000166233 ENSG00000166233 HGNC:689 ARL13B gene ARL13B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 8, MIM# 612291 18674751;25138100;26092869;27894351;29255182;17488627 False 3 100;0;0 1.2304 True ENSG00000169379 ENSG00000169379 HGNC:25419 ARL2BP gene ARL2BP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Retinitis pigmentosa with or without situs inversus MIM#615434 PMID: 23849777;27790702;29718757 False 3 100;0;0 1.2304 True ENSG00000102931 ENSG00000102931 HGNC:17146 ARL3 gene ARL3 Expert list;Expert Review Green Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Joubert syndrome 35 MIM#618161;Retinitis pigmentosa 83 MIM#618173 30269812;16565502;26964041;30932721 False 3 100;0;0 1.2304 True ENSG00000138175 ENSG00000138175 HGNC:694 ARL6 gene ARL6 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 3, MIM# 600151;Retinitis pigmentosa 55, MIM# 613575 15258860;32361989;31888296;25402481;31736247;19858128 False 3 50;0;50 1.2304 True ENSG00000113966 ENSG00000113966 HGNC:13210 ARL6IP1 gene ARL6IP1 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 61, autosomal recessive MIM#615685 24482476;31272422;30980493;28471035 False 3 100;0;0 1.2304 True ENSG00000170540 ENSG00000170540 HGNC:697 ARMC4 gene ARMC4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 23, MIM# 615451 31765523;23849778 False 3 100;0;0 1.2304 True ENSG00000169126 ENSG00000169126 HGNC:25583 ARMC9 gene ARMC9 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 30, MIM#617622 28625504 False 3 100;0;0 1.2304 True ENSG00000135931 ENSG00000135931 HGNC:20730 ARPC1B gene ARPC1B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Platelet abnormalities with eosinophilia and immune-mediated inflammatory disease 617718 28368018;33679784 False 3 100;0;0 1.2304 True ENSG00000130429 ENSG00000130429 HGNC:704 ARPC4 gene ARPC4 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental delay, language impairment, and ocular abnormalities, MIM# 620141 35047857 False 3 100;0;0 1.2304 True ENSG00000241553 ENSG00000241553 HGNC:707 ARPC5 gene ARPC5 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 133 with autoimmunity and autoinflammation, MIM# 620565 37349293;37382373 False 3 100;0;0 1.2304 True ENSG00000162704 ENSG00000162704 HGNC:708 ARR3 gene ARR3 Expert Review Green;Literature Mendeliome Other Myopia 26, X-linked, female-limited MIM#301010 27829781;35001458 False 3 100;0;0 1.2304 True ENSG00000120500 ENSG00000120500 HGNC:710 ARSA gene ARSA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Metachromatic leukodystrophy, MIM#250100 False 3 100;0;0 1.2304 True ENSG00000100299 ENSG00000100299 HGNC:713 ARSB gene ARSB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mucopolysaccharidosis type VI (Maroteaux-Lamy), MIM# 253200;MONDO:0009661 11668612 False 3 100;0;0 1.2304 True ENSG00000113273 ENSG00000113273 HGNC:714 ARSE gene ARSE Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Chondrodysplasia punctata, X-linked recessive, MIM# 302950 False 3 100;0;0 1.2304 True ENSG00000157399 ENSG00000157399 HGNC:719 ARSG gene ARSG Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Usher syndrome, type IV, MIM# 618144 29300381;20679209;25452429;26975023;32455177;33300174 False 3 33;0;67 1.2304 True ENSG00000141337 ENSG00000141337 HGNC:24102 ARSK gene ARSK Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Mucopolysaccharidosis MONDO:0019249, ARSK-related 34916232;32856704 False 3 100;0;0 1.2304 True ENSG00000164291 ENSG00000164291 HGNC:25239 ARV1 gene ARV1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal DEVELOPMENTAL AND EPILEPTIC ENCEPHALOPATHY 38 MIM#61720;Dilated cardiomyopathy 35227294, 27270415, 25558065 False 3 100;0;0 1.2304 True ENSG00000173409 ENSG00000173409 HGNC:29561 ARX gene ARX Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Epileptic encephalopathy, early infantile, 1 MIM#308350;Hydranencephaly with abnormal genitalia MIM#300215;Lissencephaly, X-linked 2 MIM#300215;Mental retardation, X-linked 29 and others MIM#300419;Partington syndrome MIM#309510;Proud syndrome MIM#300004 14722918;19738637;32519823;28150386;21496008 False 3 100;0;0 1.2304 True ENSG00000004848 ENSG00000004848 HGNC:18060 ASAH1 gene ASAH1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spinal muscular atrophy with progressive myoclonic epilepsy, MIM# 159950;Farber lipogranulomatosis, MIM# 228000 False 3 100;0;0 1.2304 True ENSG00000104763 ENSG00000104763 HGNC:735 ASCC1 gene ASCC1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spinal muscular atrophy with congenital bone fractures 2, MIM#616867 30327447;12077347;26924529;31880396;26503956 False 3 100;0;0 1.2304 True ENSG00000138303 ENSG00000138303 HGNC:24268 ASCC3 gene ASCC3 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Intellectual developmental disorder, autosomal recessive 81, MIM# 620700 21937992;35047834 False 3 100;0;0 1.2304 True ENSG00000112249 ENSG00000112249 HGNC:18697 ASH1L gene ASH1L Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Mental retardation, autosomal dominant 52, MIM#617796 23033978;25961944;28394464;28191889;27824329 False 3 100;0;0 1.2304 True ENSG00000116539 ENSG00000116539 HGNC:19088 ASL gene ASL Expert list;Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Argininosuccinic aciduria MIM#207900;Urea cycle disorders and inherited hyperammonaemias;disorder of amino acid metabolism 2263616;12384776 False 3 100;0;0 1.2304 True ENSG00000126522 ENSG00000126522 HGNC:746 ASNS gene ASNS Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Asparagine synthetase deficiency, MIM#615574 24139043 False 3 100;0;0 1.2304 True ENSG00000070669 ENSG00000070669 HGNC:753 ASPA gene ASPA Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Canavan disease MIM#271900;disorder of amino acid metabolism 8252036;8023850 False 3 100;0;0 1.2304 True ENSG00000108381 ENSG00000108381 HGNC:756 ASPH gene ASPH Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Traboulsi syndrome , MIM#601552;Exertional heat illness;malignant hyperthermia susceptibility, MONDO:0018493, ASPH-related 24768550;30194805;34018898;35697689 False 3 50;50;0 1.2304 True ENSG00000198363 ENSG00000198363 HGNC:757 ASPM gene ASPM Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephaly 5, primary, autosomal recessive, MIM#608716 29243349 False 3 100;0;0 1.2304 True ENSG00000066279 ENSG00000066279 HGNC:19048 ASPRV1 gene ASPRV1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ichthyosis, lamellar, autosomal dominant, MIM# 146750;palmoplantar keratoderma;lamellar ichthyosis PMID: 32516568 False 3 100;0;0 1.2304 True ENSG00000244617 ENSG00000244617 HGNC:26321 ASS1 gene ASS1 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Citrullinemia MIM#215700;Urea cycle disorders and inherited hyperammonaemias;disorder of amino acid metabolism 19006241 False 3 100;0;0 1.2304 True ENSG00000130707 ENSG00000130707 HGNC:758 ASTN1 gene ASTN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cerebral malformation, MONDO:0016054, ASTN1-related 29706646;27431290;26539891 False 3 100;0;0 1.2304 True ENSG00000152092 ENSG00000152092 HGNC:773 ASXL1 gene ASXL1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Bohring-Opitz syndrome , MIM#605039 29446906;21706002 False 3 100;0;0 1.2304 True ENSG00000171456 ENSG00000171456 HGNC:18318 ASXL2 gene ASXL2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Shashi-Pena syndrome, MIM# 617190 27693232;33751773 False 3 100;0;0 1.2304 True ENSG00000143970 ENSG00000143970 HGNC:23805 ASXL3 gene ASXL3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Bainbridge-Ropers syndrome (OMIM # 615485) 28100473;27901041;23383720 False 3 100;0;0 1.2304 True ENSG00000141431 ENSG00000141431 HGNC:29357 ATAD1 gene ATAD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hyperekplexia 4, MIM#618011 28180185;29390050;29659736 False 3 100;0;0 1.2304 True ENSG00000138138 ENSG00000138138 HGNC:25903 ATAD3A gene ATAD3A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Harel-Yoon syndrome, MIM# 617183;Pontocerebellar hypoplasia, hypotonia, and respiratory insufficiency syndrome, neonatal lethal (PHRINL SYNDROME) 618810 27640307;32004445;28549128 False 3 100;0;0 1.2304 True ENSG00000197785 ENSG00000197785 HGNC:25567 ATCAY gene ATCAY Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ataxia, cerebellar, Cayman type, MIM# 601238;MONDO:0011025 14556008;29449188;23226316;26343454 False 3 100;0;0 1.2304 True ENSG00000167654 ENSG00000167654 HGNC:779 ATF6 gene ATF6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Achromatopsia 7, MIM#616517 26063662;26029869 False 3 100;0;0 1.2304 True ENSG00000118217 ENSG00000118217 HGNC:791 ATG4D gene ATG4D Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092, ATG4D-related PMID: 36765070 False 3 100;0;0 1.2304 True ENSG00000130734 ENSG00000130734 HGNC:20789 ATG7 gene ATG7 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, SCAR31, MIM#619422 34161705 False 3 100;0;0 1.2304 True ENSG00000197548 ENSG00000197548 HGNC:16935 ATIC gene ATIC Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal AICA-ribosiduria due to ATIC deficiency, MIM# 608688 15114530;32557644 False 3 100;0;0 1.2304 True ENSG00000138363 ENSG00000138363 HGNC:794 ATL1 gene ATL1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neuropathy, hereditary sensory, type ID , MIM#613708;MONDO:0013381;Spastic paraplegia 3A, MIM 182600;Hereditary spastic paraplegia, AR 21194679;24604904;22340599;16401858;16537571;17657515;28396731;24473461;26888483 False 3 100;0;0 1.2304 True ENSG00000198513 ENSG00000198513 HGNC:11231 ATL3 gene ATL3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neuropathy, hereditary sensory, type IF, MIM# 615632 24459106;30666337;30339187;24736309 False 3 100;0;0 1.2304 True ENSG00000184743 ENSG00000184743 HGNC:24526 ATM gene ATM Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ataxia-telangiectasia, MIM# 208900 30819809;30137827 False 3 100;0;0 1.2304 True ENSG00000149311 ENSG00000149311 HGNC:795 ATN1 gene ATN1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Congenital hypotonia, epilepsy, developmental delay, and digital anomalies, MIM#618494 30827498 False 3 100;0;0 1.2304 True ENSG00000111676 ENSG00000111676 HGNC:3033 ATOH7 gene ATOH7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal "Persistent hyperplastic primary vitreous, autosomal recessive, MIM# 221900;microphthalmia;cataract;glaucoma;congenital retinal nonattachment" 22068589;22645276;31696227;11493566;11493566 False 3 100;0;0 1.2304 True ENSG00000179774 ENSG00000179774 HGNC:13907 ATP11A gene ATP11A Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Leukodystrophy, hypomyelinating, 24 , MIM# 619851Deafness, autosomal dominant 84 MIM#619810 PMID: 34403372;35278131;36300302 False 3 25;75;0 1.2304 True Other ENSG00000068650 ENSG00000068650 HGNC:13552 ATP13A3 gene ATP13A3 Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Primary pulmonary hypertension 5, MIM#265400 31798832;30679663;29650961 False 3 100;0;0 1.2304 True ENSG00000133657 ENSG00000133657 HGNC:24113 ATP1A1 gene ATP1A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Charcot-Marie-Tooth disease, axonal, type 2DD MIM#618036;Hypomagnesemia, seizures, and mental retardation 2 MIM#618314 29499166 False 3 100;0;0 1.2304 True ENSG00000163399 ENSG00000163399 HGNC:799 ATP1A2 gene ATP1A2 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Alternating hemiplegia of childhood 1, MIM#104290;Fetal akinesia, respiratory insufficiency, microcephaly, polymicrogyria, and dysmorphic facies, MIM# 619602;Developmental and epileptic encephalopathy 98, MIM# 619605 29343472;31608932;33880529 False 3 50;0;50 1.2304 True ENSG00000018625 ENSG00000018625 HGNC:800 ATP1A3 gene ATP1A3 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alternating hemiplegia of childhood 2, MIM# 614820;CAPOS syndrome, MIM# 601338;Dystonia-12, MIM# 128235;Polymicrogyria 15260953;22842232;24468074;33762331 False 3 100;0;0 1.2304 True ENSG00000105409 ENSG00000105409 HGNC:801 ATP2A1 gene ATP2A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Brody myopathy, OMIM # 601003 32040565 False 3 100;0;0 1.2304 True ENSG00000196296 ENSG00000196296 HGNC:811 ATP2A2 gene ATP2A2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Acrokeratosis verruciformis MIM#101900;Darier disease MIM#124200 PMID: 24336169 False 3 100;0;0 1.2304 True ENSG00000174437 ENSG00000174437 HGNC:812 ATP2B1 gene ATP2B1 Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder, autosomal dominant 66, MIM# 619910 PMID: 35358416 False 3 100;0;0 1.2304 True ENSG00000070961 ENSG00000070961 HGNC:814 ATP2B2 gene ATP2B2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Deafness, autosomal dominant 82, MIM# 619804;Neurodevelopmental Disorder, MONDO:0700092, ATP2B2-related 30535804;15829536;37675773 False 3 100;0;0 1.2304 True ENSG00000157087 ENSG00000157087 HGNC:815 ATP2C1 gene ATP2C1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Hailey-Hailey disease (MIM#169600) 28551824 False 3 100;0;0 1.2304 True ENSG00000017260 ENSG00000017260 HGNC:13211 ATP5D gene ATP5D Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex V (ATP synthase) deficiency, MIM# 618120 29478781 False 3 100;0;0 1.2304 True ENSG00000099624 ENSG00000099624 HGNC:837 ATP5E gene ATP5E Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex V (ATP synthase) deficiency, nuclear type 3 MIM#614053 20566710;27626380;20026007;34954817 False 3 50;50;0 1.2304 True ENSG00000124172 ENSG00000124172 HGNC:838 ATP5G3 gene ATP5G3 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia, early-onset, and/or spastic paraplegia, MIM#619681 34636445;34954817 False 3 100;0;0 1.2304 True ENSG00000154518 ENSG00000154518 HGNC:843 ATP5O gene ATP5O Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex V (ATP synthase) deficiency, nuclear type 7, MIM# 620359 34954817;35621276 False 3 50;0;50 1.2304 True ENSG00000241837 ENSG00000241837 HGNC:850 ATP6AP1 gene ATP6AP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Immunodeficiency 47, MIM#300972;Hepatopathy;Leukopaenia;Low copper;Intellectual disability in some 27231034 False 3 100;0;0 1.2304 True ENSG00000071553 ENSG00000071553 HGNC:868 ATP6AP2 gene ATP6AP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females ?Parkinsonism with spasticity, X-linked MIM#300911;Congenital disorder of glycosylation, type IIr MIM#301045;Intellectual developmental disorder, X-linked, syndromic, Hedera type MIM#300423 23595882 False 3 100;0;0 1.2304 True Other ENSG00000182220 ENSG00000182220 HGNC:18305 ATP6V0A1 gene ATP6V0A1 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 104 MIM#619970;Neurodevelopmental disorder with epilepsy and brain atrophy MIM#619971 30842224;33057194;34909687 False 3 50;50;0 1.2304 True ENSG00000033627 ENSG00000033627 HGNC:865 ATP6V0A2 gene ATP6V0A2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cutis laxa, autosomal recessive, type IIA, MIM# 219200;Wrinkly skin syndrome, MIM#278250 29952037;22773132 False 3 100;0;0 1.2304 True ENSG00000185344 ENSG00000185344 HGNC:18481 ATP6V0A4 gene ATP6V0A4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Renal tubular acidosis, distal, autosomal recessive, MIM#602722 12414817;10973252 False 3 100;0;0 1.2304 True ENSG00000105929 ENSG00000105929 HGNC:866 ATP6V0C gene ATP6V0C Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epilepsy, early-onset, with or without developmental delay, MIM#620465;Epilepsy;Intellectual Disability;microcephaly 33190975;33090716 False 3 67;33;0 1.2304 True ENSG00000185883 ENSG00000185883 HGNC:855 ATP6V1A gene ATP6V1A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Cutis laxa, autosomal recessive, type IID MIM#617403;Developmental and epileptic encephalopathy 93 MIM#618012 29668857;28065471;33320377 False 3 100;0;0 1.2304 True ENSG00000114573 ENSG00000114573 HGNC:851 ATP6V1B1 gene ATP6V1B1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Distal renal tubular acidosis 2 with progressive sensorineural hearing loss, MIM# 267300 9916796;12414817;16611712;18798332 False 3 100;0;0 1.2304 True ENSG00000116039 ENSG00000116039 HGNC:853 ATP6V1B2 gene ATP6V1B2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Zimmermann-Laband syndrome 2, MIM# 616455;Deafness, congenital, with onychodystrophy, autosomal dominant, MIM# 124480;Epileptic encephalopathy 25915598;24913193;28396750;32873933 False 3 100;0;0 1.2304 True ENSG00000147416 ENSG00000147416 HGNC:854 ATP6V1E1 gene ATP6V1E1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cutis laxa, autosomal recessive, type IIC MIM#617402 28065471;27023906 False 3 100;0;0 1.2304 True ENSG00000131100 ENSG00000131100 HGNC:857 ATP7A gene ATP7A Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Menkes disease MIM#309400;Occipital horn syndrome MIM#304150;Spinal muscular atrophy, distal, X-linked 3, MIM# 300489 21221114;7842019;8981948;20170900;33137485;31969342;31558336 False 3 100;0;0 1.2304 True ENSG00000165240 ENSG00000165240 HGNC:869 ATP8A2 gene ATP8A2 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, mental retardation, and dysequilibrium syndrome 4, MIM#615268 22892528;31612321 False 3 100;0;0 1.2304 True ENSG00000132932 ENSG00000132932 HGNC:13533 ATP8B1 gene ATP8B1 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal "Cholestasis, progressive familial intrahepatic 1, MIM# 211600;Cholestasis, benign recurrent intrahepatic, MIM# 243300;Cholestasis, intrahepatic, of pregnancy, 1, MIM# 147480" 15239083;9500542 False 3 100;0;0 1.2304 True ENSG00000081923 ENSG00000081923 HGNC:3706 ATP9A gene ATP9A Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with poor growth and behavioural abnormalities, MIM# 620242 34379057;34764295 False 3 50;50;0 1.2304 True ENSG00000054793 ENSG00000054793 HGNC:13540 ATR gene ATR Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Seckel syndrome 1, MIM# 210600 12640452;19620979;30199583;23111928 False 3 100;0;0 1.2304 True ENSG00000175054 ENSG00000175054 HGNC:882 ATRX gene ATRX Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) ATR-X-related syndrome MONDO:0016980 False 3 100;0;0 1.2304 True ENSG00000085224 ENSG00000085224 HGNC:886 ATXN7L3 gene ATXN7L3 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO_0100500, ATXN7L3-related PMID: 38753057 False 3 100;0;0 1.2304 True ENSG00000087152 ENSG00000087152 HGNC:25416 AUH gene AUH Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria, type I, MIM# 250950 12434311;16354225;20855850;21840233 False 3 100;0;0 1.2304 True ENSG00000148090 ENSG00000148090 HGNC:890 AURKC gene AURKC Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spermatogenic failure 5 MIM #243060 21733974;19147683 False 3 50;0;50 1.2304 True ENSG00000105146 ENSG00000105146 HGNC:11391 AUTS2 gene AUTS2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder, autosomal dominant 26, MIM# 615834 23332918;25205402;31474318 False 3 50;50;0 1.2304 True ENSG00000158321 ENSG00000158321 HGNC:14262 AVP gene AVP Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Diabetes insipidus, neurohypophyseal MIM#125700 6526016;1840604;8554046 False 3 100;0;0 1.2304 True ENSG00000101200 ENSG00000101200 HGNC:894 AVPR2 gene AVPR2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Diabetes insipidus, nephrogenic 304800;Nephrogenic syndrome of inappropriate antidiuresis 300539 9127330;15872203 False 3 100;0;0 1.2304 True ENSG00000126895 ENSG00000126895 HGNC:897 AXIN1 gene AXIN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Craniometadiaphyseal osteosclerosis with hip dysplasia, MIM# 620558 9335612;37582359 False 3 50;0;50 1.2304 True ENSG00000103126 ENSG00000103126 HGNC:903 AXIN2 gene AXIN2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Oligodontia-colorectal cancer syndrome, MIM# 608615 False 3 100;0;0 1.2304 True ENSG00000168646 ENSG00000168646 HGNC:904 B2M gene B2M Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Immunodeficiency 43 MIM# 241600;Sinopulmonary infections;Purple-red skin lesions;Decreased serum IgG;Decreased B cells;Absent 2m associated proteins MHC-I, CD1a, CD1b, and CD1c;MONDO:0009434;Amyloidosis, familial visceral, MIM# 105200 4186801;16549777;25702838;11118151;6165007;22693999 False 3 100;0;0 1.2304 True ENSG00000166710 ENSG00000166710 HGNC:914 B3GALNT2 gene B3GALNT2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 11, MIM# 615181;MONDO:0014071 23453667;33290285;29791932;29273094;28688748;28303321 False 3 100;0;0 1.2304 True ENSG00000162885 ENSG00000162885 HGNC:28596 B3GALT6 gene B3GALT6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Al-Gazali syndrome, MIM# 609465;Ehlers-Danlos syndrome, spondylodysplastic type, 2, MIM# 615349, MONDO:0014139;Spondyloepimetaphyseal dysplasia with joint laxity, type 1, with or without fractures, MIM# 271640, MONDO:0010075 25149931;29443383;23664117;29931299;23664117;23664118;31614862 False 3 100;0;0 1.2304 True ENSG00000176022 ENSG00000176022 HGNC:17978 B3GAT3 gene B3GAT3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Multiple joint dislocations, short stature, craniofacial dysmorphism, with or without congenital heart defects, MIM# 245600 26754439;31988067;26086840;25893793;21763480;24668659 False 3 100;0;0 1.2304 True ENSG00000149541 ENSG00000149541 HGNC:923 B3GLCT gene B3GLCT Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Peters-plus syndrome, MIM#261540 18798333;19796186;32533185;32204707;31795264 False 3 100;0;0 1.2304 True ENSG00000187676 ENSG00000187676 HGNC:20207 B4GALNT1 gene B4GALNT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 26, autosomal recessive (MIM #609195) 23746551;24103911 False 3 100;0;0 1.2304 True ENSG00000135454 ENSG00000135454 HGNC:4117 B4GALT1 gene B4GALT1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Iid, MIM#607091 11901181;30653653;21920538 False 3 100;0;0 1.2304 True ENSG00000086062 ENSG00000086062 HGNC:924 B4GALT7 gene B4GALT7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ehlers-Danlos syndrome, spondylodysplastic type, 1, MIM# 130070 23956117;24755949;31278392;31614862;31862401 False 3 100;0;0 1.2304 True ENSG00000027847 ENSG00000027847 HGNC:930 B4GAT1 gene B4GAT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 13 MIM# 615287 23359570;23877401 False 3 100;0;0 1.2304 True ENSG00000174684 ENSG00000174684 HGNC:15685 B9D1 gene B9D1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 27, MIM#617120;Meckel syndrome 9, MIM#614209 24886560;21493627;25920555;21763481;34338422 False 3 33;67;0 1.2304 True ENSG00000108641 ENSG00000108641 HGNC:24123 B9D2 gene B9D2 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 34, MIM#614175;Meckel syndrome 10, MIM#614175 26092869;21763481 False 3 100;0;0 1.2304 True ENSG00000123810 ENSG00000123810 HGNC:28636 BAAT gene BAAT Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bile acid conjugation defect 1, MIM# 619232 12704386;23415802 False 3 100;0;0 1.2304 True ENSG00000136881 ENSG00000136881 HGNC:932 BACH2 gene BACH2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Immunodeficiency 60 and autoimmunity, MIM# 618394 28530713 False 3 100;0;0 1.2304 True ENSG00000112182 ENSG00000112182 HGNC:14078 BAG3 gene BAG3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cardiomyopathy, dilated, 1HH, MIM# 613881;Myopathy, myofibrillar, 6, MIM# 612954 21353195;25008357;25448463;24623017;27391596;28211974;30442290;31983221;28737513;29323723;33947203;25208129;32453099;22734908 False 3 100;0;0 1.2304 True ENSG00000151929 ENSG00000151929 HGNC:939 BAG5 gene BAG5 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Cardiomyopathy, dilated, 2F, MIM# 619747 35044787 False 3 100;0;0 1.2304 True ENSG00000166170 ENSG00000166170 HGNC:941 BAZ2B gene BAZ2B Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability;autism 31999386;28135719;25363768 False 3 100;0;0 1.2304 True ENSG00000123636 ENSG00000123636 HGNC:963 BBS1 gene BBS1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 1, MIM# 209900 20177705;15637713 False 3 100;0;0 1.2304 True ENSG00000174483 ENSG00000174483 HGNC:966 BBS10 gene BBS10 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 10, MIM# 615987 16582908;19252258 False 3 50;0;50 1.2304 True ENSG00000179941 ENSG00000179941 HGNC:26291 BBS12 gene BBS12 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 12, MIM# 615989 19797195;29633607;26082521 False 3 100;0;0 1.2304 True ENSG00000181004 ENSG00000181004 HGNC:26648 BBS2 gene BBS2 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 2, MIM# 615981;Retinitis pigmentosa 74, MIM# 616562 11567139;16823392;28143435;31960602;25541840;15637713 False 3 50;0;50 1.2304 True ENSG00000125124 ENSG00000125124 HGNC:967 BBS4 gene BBS4 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 4, MIM#615982;MONDO:0014433 12016587;11381270 False 3 67;0;33 1.2304 True ENSG00000140463 ENSG00000140463 HGNC:969 BBS5 gene BBS5 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 5, MIM#615983;MONDO:0014434 19252258;15137946;10053027;15637713 False 3 50;0;50 1.2304 True ENSG00000163093 ENSG00000163093 HGNC:970 BBS7 gene BBS7 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 7, MIM# 615984;MONDO:0014435 12567324;21937992;19797195 False 3 50;0;50 1.2304 True ENSG00000138686 ENSG00000138686 HGNC:18758 BBS9 gene BBS9 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 9, MIM#615986;MONDO:0014437 16380913;22353939;32686083;32037757 False 3 50;0;50 1.2304 True ENSG00000122507 ENSG00000122507 HGNC:30000 BCAP31 gene BCAP31 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Deafness, dystonia, and cerebral hypomyelination, MIM# 300475 24011989;31330203;33603160 False 3 100;0;0 1.2304 True ENSG00000185825 ENSG00000185825 HGNC:16695 BCAS3 gene BCAS3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hengel-Maroofian-Schols syndrome, MIM# 619641 34022130 False 3 100;0;0 1.2304 True ENSG00000141376 ENSG00000141376 HGNC:14347 BCAT2 gene BCAT2 Expert Review Green;NHS GMS Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypervalinemia or hyperleucine-isoleucinemia MIM#618850;disorder of branched-chain amino acid metabolism 14755340;25653144 False 3 100;0;0 1.2304 True ENSG00000105552 ENSG00000105552 HGNC:977 BCHE gene BCHE Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Butyrylcholinesterase deficiency, MIM# 617936 False 3 100;0;0 1.2304 True ENSG00000114200 ENSG00000114200 HGNC:983 BCKDHA gene BCKDHA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Maple syrup urine disease, type Ia, MIM# 248600 34883003;34556729;34288399 False 3 100;0;0 1.2304 True ENSG00000248098 ENSG00000248098 HGNC:986 BCKDHB gene BCKDHB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Maple syrup urine disease, type Ib, MIM# 248600 34883003;34556729;34288399 False 3 100;0;0 1.2304 True ENSG00000083123 ENSG00000083123 HGNC:987 BCKDK gene BCKDK Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Branched-chain ketoacid dehydrogenase kinase deficiency MIM#614923;disorder of branched-chain amino acid metabolism 22956686;24449431 False 3 100;0;0 1.2304 True ENSG00000103507 ENSG00000103507 HGNC:16902 BCL10 gene BCL10 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 37, MIM# 616098 25365219;32008135;11163238;12910267 False 3 100;0;0 1.2304 True ENSG00000142867 ENSG00000142867 HGNC:989 BCL11A gene BCL11A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dias-Logan syndrome, MIM# 617101 27453576;32903878 False 3 100;0;0 1.2304 True ENSG00000119866 ENSG00000119866 HGNC:13221 BCL11B gene BCL11B Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Intellectual developmental disorder with dysmorphic facies, speech delay, and T-cell abnormalities, MIM# 618092" 29985992 False 3 100;0;0 1.2304 True ENSG00000127152 ENSG00000127152 HGNC:13222 BCOR gene BCOR Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Microphthalmia, syndromic 2, MIM# 300166;Oculofaciocardiodental syndrome;Lenz microphthalmia 29974297 False 3 100;0;0 1.2304 True ENSG00000183337 ENSG00000183337 HGNC:20893 BCS1L gene BCS1L Expert Review Green;Literature;Royal Melbourne Hospital;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bjornstad syndrome MIM#262000;GRACILE syndrome, MIM#603358;Mitochondrial complex III deficiency, nuclear type MIM#112400 26563427;24172246;17314340 False 3 100;0;0 1.2304 True ENSG00000074582 ENSG00000074582 HGNC:1020 BEST1 gene BEST1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Bestrophinopathy, autosomal recessive, MIM# 611809;Macular dystrophy, vitelliform, 2 MIM# 153700;Microcornea, rod-cone dystrophy, cataract, and posterior staphyloma, MIM# 193220;Retinitis pigmentosa-50, MIM# 613194;Retinitis pigmentosa, concentric, MIM# 61319;Vitreoretinochoroidopathy,MIM# 193220" 29668979 False 3 100;0;0 1.2304 True Other ENSG00000167995 ENSG00000167995 HGNC:12703 BFSP1 gene BFSP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Cataract 33, multiple types, MIM# 611391 17225135;26694549;24379646;28450710;31842807;26694549 False 3 100;0;0 1.2304 True ENSG00000125864 ENSG00000125864 HGNC:1040 BFSP2 gene BFSP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cataract 12, multiple types, MIM# 611597 10729115;10739768;15570218;24654948;21836522 False 3 100;0;0 1.2304 True ENSG00000170819 ENSG00000170819 HGNC:1041 BHLHA9 gene BHLHA9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Syndactyly, mesoaxial synostotic, with phalangeal reduction, MIM# 609432 25466284;34272776;31912643;31152918;30107244 False 3 100;0;0 1.2304 True ENSG00000205899 ENSG00000205899 HGNC:35126 BHLHE22 gene BHLHE22 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092, BHLHE22-related 39502664 False 3 100;0;0 1.2304 True ENSG00000180828 ENSG00000180828 HGNC:11963 BICD2 gene BICD2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodevelopmental disorder (MONDO#0700092), BICD2-related;Spinal muscular atrophy, lower extremity-predominant, 2A, autosomal dominant, MIM# 615290;MONDO:0014121;Spinal muscular atrophy, lower extremity-predominant, 2B, autosomal dominant, MIM# 618291 35896821;23664116;23664119;23664120;27751653;28635954;30054298;29528393 False 3 100;0;0 1.2304 True ENSG00000185963 ENSG00000185963 HGNC:17208 BICRA gene BICRA Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Coffin-Siris syndrome-12, MIM#619325;Developmental delay, intellectual disability, autism spectrum disorder,behavioral abnormalities, dysmorphic features 33232675 False 3 100;0;0 1.2304 True ENSG00000063169 ENSG00000063169 HGNC:4332 BIN1 gene BIN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Centronuclear myopathy 2, MIM# 255200 17676042;25260562;27854204 False 3 100;0;0 1.2304 True ENSG00000136717 ENSG00000136717 HGNC:1052 BLM gene BLM Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bloom Syndrome MIM# 210900;Short stature, dysmorphic facies;sun-sensitive;immunoglobulin deficiency (IgA, IgG, IgM);erythema;marrow failure;leukaemia;lymphoma;chromosomal instability;predisposition to malignancies 17407155;9285778;7585968;8079989;12242442;11101838 False 3 100;0;0 1.2304 True ENSG00000197299 ENSG00000197299 HGNC:1058 BLNK gene BLNK Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Agammaglobulinaemia 4, MIM# 613502 10583958;32194234;25893637 False 3 100;0;0 1.2304 True ENSG00000095585 ENSG00000095585 HGNC:14211 BLOC1S1 gene BLOC1S1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092, BLOC1S1-related 33875846 False 3 100;0;0 1.2304 True ENSG00000135441 ENSG00000135441 HGNC:4200 BLOC1S3 gene BLOC1S3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hermansky-Pudlak syndrome 8, MIM# 614077;MONDO:0013560 16385460;22709368;32687635 False 3 100;0;0 1.2304 True ENSG00000189114 ENSG00000189114 HGNC:20914 BLOC1S5 gene BLOC1S5 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Hermansky Pudlak syndrome 11, MIM#619172 32565547 False 3 100;0;0 1.2304 True ENSG00000188428 ENSG00000188428 HGNC:18561 BLOC1S6 gene BLOC1S6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hermansky-Pudlak syndrome 9, MIM# 614171 32245340;33543539;29054114;26575419;22461475;10610180 False 3 50;50;0 1.2304 True ENSG00000104164 ENSG00000104164 HGNC:8549 BMP1 gene BMP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Osteogenesis imperfecta, type XIII , MIM#614856 25402547;22052668;22482805;25214535 False 3 100;0;0 1.2304 True ENSG00000168487 ENSG00000168487 HGNC:1067 BMP15 gene BMP15 Expert Review Green;Victorian Clinical Genetics Services Mendeliome Other Ovarian dysgenesis 2, MIM# 300510;Premature ovarian failure 4, MIM# 300510 15136966;16508750;16464940 False 3 100;0;0 1.2304 True ENSG00000130385 ENSG00000130385 HGNC:1068 BMP2 gene BMP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Short stature, facial dysmorphism, and skeletal anomalies with or without cardiac anomalies 1, MIM# 617877 29198724 False 3 100;0;0 1.2304 True ENSG00000125845 ENSG00000125845 HGNC:1069 BMP4 gene BMP4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Orofacial cleft 11 600625;Microphthalmia, syndromic 6, MIM# 607932 31053785;19249007;31909686;21340693 False 3 100;0;0 1.2304 True ENSG00000125378 ENSG00000125378 HGNC:1071 BMP6 gene BMP6 Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Iron overload, susceptibility to} 620121 26582087;32464486 False 3 100;0;0 1.2304 True ENSG00000153162 ENSG00000153162 HGNC:1073 BMPER gene BMPER Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Diaphanospondylodysostosis, MIM#608022 20869035;30006055 False 3 100;0;0 1.2304 True ENSG00000164619 ENSG00000164619 HGNC:24154 BMPR1A gene BMPR1A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Polyposis, juvenile intestinal, MIM# 174900 11381269 False 3 100;0;0 1.2304 True ENSG00000107779 ENSG00000107779 HGNC:1076 BMPR1B gene BMPR1B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Acromesomelic dysplasia, Demirhan type, MIM# 609441;Brachydactyly, type A1, D, MIM# 616849;Brachydactyly, type A2, MIM# 112600;coloboma MONDO#0001476, BMPR1B-related 15805157;24129431;26105076;25758993;14523231;14523231;35034853 False 3 100;0;0 1.2304 True ENSG00000138696 ENSG00000138696 HGNC:1077 BMPR2 gene BMPR2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Pulmonary venoocclusive disease 1 MIM#265450;Pulmonary hypertension, familial primary, 1, with or without HHT MIM#178600;Pulmonary hypertension, primary, fenfluramine or dexfenfluramine-associated MIM#178600 33380512 False 3 100;0;0 1.2304 True Other ENSG00000204217 ENSG00000204217 HGNC:1078 BNC1 gene BNC1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Premature ovarian failure 16 MIM#618723 34794894;30010909;16624857;32962729;32894148;30689869;27301361 False 3 100;0;0 1.2304 True ENSG00000169594 ENSG00000169594 HGNC:1081 BNC2 gene BNC2 Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Lower urinary tract obstruction, congenital;OMIM #618612 31656805;31051115 False 3 100;0;0 1.2304 True ENSG00000173068 ENSG00000173068 HGNC:30988 BOLA3 gene BOLA3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Multiple mitochondrial dysfunctions syndrome 2 with hyperglycinemia, MIM# 614299 30302924;29654549;30302924 False 3 100;0;0 1.2304 True ENSG00000163170 ENSG00000163170 HGNC:24415 BORCS8 gene BORCS8 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodegeneration, infantile-onset, with optic atrophy and brain abnormalities, MIM# 620987 38128568 False 3 100;0;0 1.2304 True ENSG00000254901 ENSG00000254901 HGNC:37247 BPTF gene BPTF Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with dysmorphic facies and distal limb anomalies AD, MIM#617755 28942966 False 3 100;0;0 1.2304 True ENSG00000171634 ENSG00000171634 HGNC:3581 BRAF gene BRAF Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Noonan syndrome 7, MIM# 613706;Cardiofaciocutaneous syndrome, MIM# 115150 19206169;18042262 False 3 100;0;0 1.2304 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000157764 ENSG00000157764 HGNC:1097 BRAT1 gene BRAT1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with cerebellar atrophy and with or without seizures, MIM#618056;Rigidity and multifocal seizure syndrome, lethal neonatal, MIM# 614498 26483087;26494257;27282546;22279524;23035047;25319849;25500575;34747546 False 3 100;0;0 1.2304 True ENSG00000106009 ENSG00000106009 HGNC:21701 BRD4 gene BRD4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cornelia de Lange syndrome 6, MIM# 620568 29379197;30302754;11997514;34035299 False 3 100;0;0 1.2304 True ENSG00000141867 ENSG00000141867 HGNC:13575 BRF1 gene BRF1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cerebellofaciodental syndrome, MIM# 616202 25561519;25561519;27748960 False 3 100;0;0 1.2304 True ENSG00000185024 ENSG00000185024 HGNC:11551 BRIP1 gene BRIP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Fanconi anaemia, complementation group J, MIM# 609054 27107905 False 3 100;0;0 1.2304 True ENSG00000136492 ENSG00000136492 HGNC:20473 BRPF1 gene BRPF1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder with dysmorphic facies and ptosis, MIM# 617333;MONDO:0015022 27939640;27939639;32652122 False 3 100;0;0 1.2304 True ENSG00000156983 ENSG00000156983 HGNC:14255 BRSK2 gene BRSK2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability;autism 30879638 False 3 100;0;0 1.2304 True ENSG00000174672 ENSG00000174672 HGNC:11405 BRWD3 gene BRWD3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Intellectual developmental disorder, X-linked 93, MIM # 300659 17668385;30628072;24462886 False 3 100;0;0 1.2304 True ENSG00000165288 ENSG00000165288 HGNC:17342 BSCL2 gene BSCL2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neuropathy, distal hereditary motor, type VC, MIM# 619112;Encephalopathy, progressive, with or without lipodystrophy, MIM#615924;Lipodystrophy, congenital generalized, type 2, MIM# 269700;Silver spastic paraplegia syndrome, MIM# 270685;Developmental and epileptic encephalopathy, BSCL2-related, dominant, MONDO:0100062 14981520;15732094;11479539;15181077;15126564;23564749;31369919;35290466 False 3 100;0;0 1.2304 True ENSG00000168000 ENSG00000168000 HGNC:15832 BSN gene BSN Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Epilepsy MONDO:0005027 False 3 100;0;0 1.2304 True ENSG00000164061 ENSG00000164061 HGNC:1117 BSND gene BSND Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bartter syndrome, type 4a, MIM#602522 11687798;12574213;30174009;21269598 False 3 100;0;0 1.2304 True ENSG00000162399 ENSG00000162399 HGNC:16512 BTD gene BTD Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Biotinidase deficiency, MIM 253260 10801053;12359137 False 3 100;0;0 1.2304 True ENSG00000169814 ENSG00000169814 HGNC:1122 BTG4 gene BTG4 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Zygotic cleavage failure (ZCF);Oocyte maturation defect, MIM#619009 PMID: 32502391 False 3 100;0;0 1.2304 True ENSG00000137707 ENSG00000137707 HGNC:13862 BTK gene BTK Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Agammaglobulinaemia, X-linked 1, MIM# 300755;Isolated growth hormone deficiency, type III, with agammaglobulinaemia, MIM# 307200 8013627;7849697 False 3 100;0;0 1.2304 True ENSG00000010671 ENSG00000010671 HGNC:1133 BUB1B gene BUB1B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mosaic variegated aneuploidy syndrome 1, MIM# 257300;Premature ovarian failure 32716490;18548531 False 3 100;0;0 1.2304 True ENSG00000156970 ENSG00000156970 HGNC:1149 BVES gene BVES Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 25, MIM# 616812 26642364;32528171;31119192 False 3 100;0;0 1.2304 True ENSG00000112276 ENSG00000112276 HGNC:1152 C10orf71 gene C10orf71 Expert Review Green;Other Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown dilated cardiomyopathy MONDO:0005021 38950288 False 3 100;0;0 1.2304 True ENSG00000177354 ENSG00000177354 HGNC:26973 C11orf70 gene C11orf70 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 38, MIM# 618063 29727693;29727692 False 3 100;0;0 1.2304 True ENSG00000137691 ENSG00000137691 HGNC:28188 C12orf4 gene C12orf4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Intellectual developmental disorder, autosomal recessive 66 MIM#618221 34967075;31334606;27311568;25558065;28097321 False 3 100;0;0 1.2304 True ENSG00000047621 ENSG00000047621 HGNC:1184 C12orf57 gene C12orf57 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Temtamy syndrome MIM#218340 29383837;31853307 False 3 100;0;0 1.2304 True ENSG00000111678 ENSG00000111678 HGNC:29521 C12orf65 gene C12orf65 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 55, autosomal recessive, MIM#615035;Combined oxidative phosphorylation deficiency 7, MIM# 613559 23188110;24080142;24198383;20598281;32808965;32478789;28804760 False 3 100;0;0 1.2304 True ENSG00000130921 ENSG00000130921 HGNC:26784 C12orf66 gene C12orf66 Expert Review Green;Other Mendeliome BIALLELIC, autosomal or pseudoautosomal complex neurodevelopmental disorder MONDO:0100038 False 3 50;50;0 1.2304 True ENSG00000174206 ENSG00000174206 HGNC:26517 C14orf39 gene C14orf39 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Spermatogenic failure 52, MIM# 619202;Premature ovarian failure 18 619203 PMID: 33508233;27796301 False 3 100;0;0 1.2304 True ENSG00000179008 ENSG00000179008 HGNC:19849 C15orf41 gene C15orf41 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Dyserythropoietic anemia, congenital, type Ib, MIM# 615631" 23716552;32293259;31191338;29885034 False 3 100;0;0 1.2304 True ENSG00000186073 ENSG00000186073 HGNC:26929 C16orf62 gene C16orf62 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Ritscher-Schinzel syndrome-3 (RTSC3), MIM#619135 25434475 False 3 50;50;0 1.2304 True ENSG00000103544 ENSG00000103544 HGNC:24641 C17orf53 gene C17orf53 Expert Review;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Ovarian dysgenesis 11, MIM# 620897 34707299;31467087 False 3 100;0;0 1.2304 True ENSG00000125319 ENSG00000125319 HGNC:28460 C17orf62 gene C17orf62 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Chronic granulomatous disease 5, autosomal recessive, MIM# 618935" 30361506;30312704;28351984 False 3 100;0;0 1.2304 True ENSG00000178927 ENSG00000178927 HGNC:28672 C19orf12 gene C19orf12 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodegeneration with brain iron accumulation 4, MIM# 614298;Spastic paraplegia 43, autosomal recessive, MIM# 615043 33688131;21981780;22508347;23269600;31804703;30088953;20039086 False 3 100;0;0 1.2304 True ENSG00000131943 ENSG00000131943 HGNC:25443 C19orf70 gene C19orf70 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Combined oxidative phosphorylation deficiency 37, MIM# 618329" 29618761;27623147;27485409 False 3 100;0;0 1.2304 True ENSG00000174917 ENSG00000174917 HGNC:33702 C1GALT1C1 gene C1GALT1C1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Tn polyagglutination syndrome, somatic MIM#300622;atypical haemolytic-uremic syndrome MONDO#0016244, C1GALT1C1-related 18537974;16251947;36599939 False 3 50;50;0 1.2304 True ENSG00000171155 ENSG00000171155 HGNC:24338 C1orf127 gene C1orf127 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Heterotaxy, visceral, MONDO:0018677, CIROZ-related 39753129 False 3 100;0;0 1.2304 True ENSG00000175262 ENSG00000175262 HGNC:26730 C1QA gene C1QA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal C1q deficiency, MIM# 613652 9225968;21654842;9590289 False 3 100;0;0 1.2304 True ENSG00000173372 ENSG00000173372 HGNC:1241 C1QB gene C1QB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal C1q deficiency, MIM# 613652 2894352;17513176 False 3 100;0;0 1.2304 True ENSG00000173369 ENSG00000173369 HGNC:1242 C1QBP gene C1QBP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 33, MIM# 617713 28942965 False 3 100;0;0 1.2304 True ENSG00000108561 ENSG00000108561 HGNC:1243 C1QC gene C1QC Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal C1q deficiency MIM#613652 21654842;8630118;24157463 False 3 100;0;0 1.2304 True ENSG00000159189 ENSG00000159189 HGNC:1245 C1QTNF5 gene C1QTNF5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Retinal degeneration, late-onset, autosomal dominant MIM#605670 33949280;12944416;30451557;28939808;32036094 False 3 100;0;0 1.2304 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000223953 ENSG00000223953 HGNC:14344 C1R gene C1R Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Ehlers-Danlos syndrome, periodontal type, 1 MIM# 130080 Current Edit" 27745832;28306229 False 3 100;0;0 1.2304 True ENSG00000159403 ENSG00000159403 HGNC:1246 C1S gene C1S Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Ehlers-Danlos syndrome, periodontal type, 2 MIM#617174;C1s deficiency MIM#613783 28306229;30071989;27745832;31921203;19155518;20191570;18062908;11390518;9856483 False 3 100;0;0 1.2304 True ENSG00000182326 ENSG00000182326 HGNC:1247 C2 gene C2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal C2 deficiency MIM#217000 16026838;8621452;35272074;32385807 False 3 100;0;0 1.2304 True ENSG00000166278 ENSG00000166278 HGNC:1248 C21orf2 gene C21orf2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spondylometaphyseal dysplasia, axial, MIM# 602271;Retinal dystrophy with macular staphyloma, MIM# 617547 26974433;27548899;28422394;26294103;23105016;27548899 False 3 100;0;0 1.2304 True ENSG00000160226 ENSG00000160226 HGNC:1260 C21orf59 gene C21orf59 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 26, MIM# 615500 24094744 False 3 100;0;0 1.2304 True ENSG00000159079 ENSG00000159079 HGNC:1301 C2CD3 gene C2CD3 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Orofaciodigital syndrome XIV, MIM# 615948;MONDO:0014413 24997988;26477546;27094867;30097616;33875766 False 3 100;0;0 1.2304 True ENSG00000168014 ENSG00000168014 HGNC:24564 C2orf69 gene C2orf69 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency-53 (COXPD53), MIM#619423 34038740;33945503 False 3 100;0;0 1.2304 True ENSG00000178074 ENSG00000178074 HGNC:26799 C2orf71 gene C2orf71 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Retinitis pigmentosa 54, MIM# 613428 20398886;20398884;24780881;31819343;29946172;28763557 False 3 100;0;0 1.2304 True ENSG00000179270 ENSG00000179270 HGNC:34383 C3 gene C3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal C3 deficiency MIM#613779;C3 deficiency MIM#613779;{Hemolytic uremic syndrome, atypical, susceptibility to, 5}, MIM# 612925 15781264;1944729;11813855;26847111;18796626;34248927;33691638 False 3 100;0;0 1.2304 True ENSG00000125730 ENSG00000125730 HGNC:1318 C4orf26 gene C4orf26 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Amelogenesis imperfecta, type IIA4, MIM# 614832 22901946;27558265 False 3 100;0;0 1.2304 True ENSG00000174792 ENSG00000174792 HGNC:26300 C5 gene C5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal C5 deficiency MIM#609536 23743184;15488949;15778377;23371790 False 3 100;0;0 1.2304 True ENSG00000106804 ENSG00000106804 HGNC:1331 C5orf42 gene C5orf42 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 17, MIM# 614615;Orofaciodigital syndrome VI, MIM# 277170 22425360;24178751 False 3 100;0;0 1.2304 True ENSG00000197603 ENSG00000197603 HGNC:25801 C6 gene C6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal C6 deficiency MIM#612446 23537992;24378253;17257682;22668955;32670577 False 3 100;0;0 1.2304 True ENSG00000039537 ENSG00000039537 HGNC:1339 C7 gene C7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal C7 deficiency MIM#610102 22206826;20591074;17407100;16771861;16552475 False 3 100;0;0 1.2304 True ENSG00000112936 ENSG00000112936 HGNC:1346 C8B gene C8B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal C8 deficiency, type II MIM#613789 8098723;33563058;27183977;9476133;19434484 False 3 100;0;0 1.2304 True ENSG00000021852 ENSG00000021852 HGNC:1353 C8orf37 gene C8orf37 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 21, MIM#617406;Retinitis pigmentosa 64, MIM#614500 27008867;26854863;22177090;25113443;26865426;25802487 False 3 100;0;0 1.2304 True ENSG00000156172 ENSG00000156172 HGNC:27232 C9 gene C9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal C9 deficiency MIM#613825 9570574;9703418;9144525;31440263;9634479 False 3 100;0;0 1.2304 True ENSG00000113600 ENSG00000113600 HGNC:1358 C9orf3 gene C9orf3 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Dystonia 31, MIM# 619565 34596301 False 3 100;0;0 1.2304 True ENSG00000148120 ENSG00000148120 HGNC:1361 C9orf84 gene C9orf84 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "Spermatogenic failure 75, MIM# 619949" 32741963;32900840;35485979 False 3 100;0;0 1.2304 True ENSG00000165181 ENSG00000165181 HGNC:26535 CA12 gene CA12 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hyperchlorhidrosis, isolated MIM#143860 21035102;21184099;26911677 False 3 100;0;0 1.2304 True ENSG00000074410 ENSG00000074410 HGNC:1371 CA2 gene CA2 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Osteopetrosis, autosomal recessive 3, with renal tubular acidosis, MIM#259730 34624559;33555497;12566520;7627193 False 3 100;0;0 1.2304 True ENSG00000104267 ENSG00000104267 HGNC:1373 CA5A gene CA5A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hyperammonemia due to carbonic anhydrase VA deficiency, 615751 26913920;32381389 False 3 100;0;0 1.2304 True ENSG00000174990 ENSG00000174990 HGNC:1377 CA8 gene CA8 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome Unknown False 3 100;0;0 1.2304 True ENSG00000178538 ENSG00000178538 HGNC:1382 CABP2 gene CABP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 93, MIM# 614899 22981119;31661684;28183797 False 3 100;0;0 1.2304 True ENSG00000167791 ENSG00000167791 HGNC:1385 CABP4 gene CABP4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cone-rod synaptic disorder, congenital nonprogressive, MIM# 610427 16960802;19074807;20157620 False 3 100;0;0 1.2304 True ENSG00000175544 ENSG00000175544 HGNC:1386 CACHD1 gene CACHD1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal syndromic complex neurodevelopmental disorder MONDO:0800439 PMID: 38158856 False 3 100;0;0 1.2304 True ENSG00000158966 ENSG00000158966 HGNC:29314 CACNA1A gene CACNA1A Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic ataxia, type 2 MIM#108500 34267336 False 3 50;50;0 1.2304 True ENSG00000141837 ENSG00000141837 HGNC:1388 CACNA1B gene CACNA1B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with seizures and nonepileptic hyperkinetic movements, MIM# 618497 30982612 False 3 100;0;0 1.2304 True ENSG00000148408 ENSG00000148408 HGNC:1389 CACNA1D gene CACNA1D Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Primary aldosteronism, seizures, and neurologic abnormalities, MIM# 615474;MONDO:0014200;Sinoatrial node dysfunction and deafness, MIM# 614896 23913001;32336187;30698561;21131953;15357422;22678062 False 3 100;0;0 1.2304 True ENSG00000157388 ENSG00000157388 HGNC:1391 CACNA1E gene CACNA1E Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 69, MIM#618285 30343943 False 3 100;0;0 1.2304 True ENSG00000198216 ENSG00000198216 HGNC:1392 CACNA1F gene CACNA1F Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Aland Island eye disease MIM#300600;Cone-rod dystrophy, X-linked, 3 MIM#300476;Night blindness, congenital stationary (incomplete), 2A, X-linked MIM#300071 17525176;16505158;23776498;24124559;26075273;25999675 False 3 100;0;0 1.2304 True ENSG00000102001 ENSG00000102001 HGNC:1393 CACNA1G gene CACNA1G Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 42, early-onset, severe, with neurodevelopmental deficits, MIM#618087 29878067 False 3 100;0;0 1.2304 True ENSG00000006283 ENSG00000006283 HGNC:1394 CACNA1H gene CACNA1H Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hyperaldosteronism, familial, type IV MIM#617027;MONDO:0014875 27729216;25907736;31126930;16754686;32571372 False 3 100;0;0 1.2304 True ENSG00000196557 ENSG00000196557 HGNC:1395 CACNA1I gene CACNA1I Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with variable intellectual disability and speech impairment, with or without seizures (NEDISS), MIM#620114 33704440 False 3 100;0;0 1.2304 True Other ENSG00000100346 ENSG00000100346 HGNC:1396 CACNA2D1 gene CACNA2D1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "Developmental and epileptic encephalopathy 110, MIM# 620149" 35293990 False 3 50;0;50 1.2304 True ENSG00000153956 ENSG00000153956 HGNC:1399 CACNA2D2 gene CACNA2D2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cerebellar atrophy with seizures and variable developmental delay MIM#618501 23339110;24358150;30410802;29997391;31402629;11487633;11756448;4177347;14660671;15331424 False 3 100;0;0 1.2304 True ENSG00000007402 ENSG00000007402 HGNC:1400 CACNA2D4 gene CACNA2D4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Retinal cone dystrophy 4 MIM#610478 17033974;26560832;26560832;33927996;34996991 False 3 100;0;0 1.2304 True ENSG00000151062 ENSG00000151062 HGNC:20202 CAD gene CAD Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Epileptic encephalopathy, early infantile, 50, MIM# 616457" 28007989;25678555 False 3 100;0;0 1.2304 True ENSG00000084774 ENSG00000084774 HGNC:1424 CADM3 gene CADM3 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Charcot-Marie-Tooth disease, axonal, type 2FF, MIM# 619519 PMID: 33889941;38074074 False 3 50;50;0 1.2304 True ENSG00000162706 ENSG00000162706 HGNC:17601 CALM1 gene CALM1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Long QT syndrome 14 MIM#616247;Ventricular tachycardia, catecholaminergic polymorphic, 4 MIM#614916 31170290 False 3 100;0;0 1.2304 True ENSG00000198668 ENSG00000198668 HGNC:1442 CALM2 gene CALM2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Long QT syndrome 15 MIM#616249;CPVT 31983240 False 3 100;0;0 1.2304 True ENSG00000143933 ENSG00000143933 HGNC:1445 CALM3 gene CALM3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Long QT syndrome 16 MIM#618782;CPVT 31983240 False 3 100;0;0 1.2304 True ENSG00000160014 ENSG00000160014 HGNC:1449 CAMK2A gene CAMK2A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Mental retardation, autosomal recessive 63 MIM#618095;Mental retardation, autosomal dominant 53 MIM#617798 32600977;29784083;29560374 False 3 100;0;0 1.2304 True ENSG00000070808 ENSG00000070808 HGNC:1460 CAMK2B gene CAMK2B Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 54, MIM# 617799 29100089;29560374;32875707 False 3 100;0;0 1.2304 True ENSG00000058404 ENSG00000058404 HGNC:1461 CAMK2D gene CAMK2D Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder (MONDO#0700092), CAMK2D-related 38272033 False 3 0;0;0 1.2304 True ENSG00000145349 ENSG00000145349 HGNC:1462 CAMK4 gene CAMK4 Expert Review;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability;Autism;Behavioral abnormality;Abnormality of movement;Dystonia;Ataxia;Chorea;Myoclonus 30262571;33098801;33211350 False 3 100;0;0 1.2304 True ENSG00000152495 ENSG00000152495 HGNC:1464 CAMSAP1 gene CAMSAP1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Cortical dysplasia, complex, with other brain malformations 12, MIM# 620316 36283405 False 3 100;0;0 1.2304 True ENSG00000130559 ENSG00000130559 HGNC:19946 CAMTA1 gene CAMTA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cerebellar ataxia, nonprogressive, with mental retardation (614756 AD) 32157189;22693284 False 3 100;0;0 1.2304 True ENSG00000171735 ENSG00000171735 HGNC:18806 CANT1 gene CANT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Desbuquois dysplasia 1 MIM#251450;Epiphyseal dysplasia, multiple, 7, MIM# 617719 19853239;21037275;28742282 False 3 100;0;0 1.2304 True ENSG00000171302 ENSG00000171302 HGNC:19721 CAP2 gene CAP2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Cardiomyopathy, dilated, 2I (MIM#620462) 30518548;33083013;34862840 False 3 50;0;50 1.2304 True ENSG00000112186 ENSG00000112186 HGNC:20039 CAPN1 gene CAPN1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 76, autosomal recessive, MIM#616907;MONDO:0014827 27153400;27320912;29678961;30572172;31023339;31104286 False 3 100;0;0 1.2304 True ENSG00000014216 ENSG00000014216 HGNC:1476 CAPN15 gene CAPN15 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Oculogastrointestinal neurodevelopmental syndrome, MIM# 619318;microphthalmia HP:0000568;coloboma HP:0000589 32885237;33410501 False 3 100;0;0 1.2304 True ENSG00000103326 ENSG00000103326 HGNC:11182 CAPN3 gene CAPN3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal dominant 4, MIM# 618129;Muscular dystrophy, limb-girdle, autosomal recessive 1, MIM# 253600 31937337;28881388;32342993;32557990 False 3 100;0;0 1.2304 True ENSG00000092529 ENSG00000092529 HGNC:1480 CAPN5 gene CAPN5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Vitreoretinopathy, neovascular inflammatory, MIM# 193235 23055945;32274441;31110225;30986125 False 3 100;0;0 1.2304 True ENSG00000149260 ENSG00000149260 HGNC:1482 CAPRIN1 gene CAPRIN1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Neurodevelopmental disorder with language impairment, autism, and attention deficit-hyperactivity disorder, MIM# 620782;Neurodegeneration, childhood-onset, with cerebellar ataxia and cognitive decline, MIM# 620636" 35979925;36136249 False 3 50;50;0 1.2304 True ENSG00000135387 ENSG00000135387 HGNC:6743 CAPZA2 gene CAPZA2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder, MONDO:0700092, CAPZA2-related 32338762;38374166;35856264 False 3 50;50;0 1.2304 True ENSG00000198898 ENSG00000198898 HGNC:1490 CARD11 gene CARD11 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Immunodeficiency 11A, autosomal recessive, MIM# 615206;Immunodeficiency 11B with atopic dermatitis, autosomal dominant, MIM# 617638 23561803;12818158;23374270;28628108 False 3 100;0;0 1.2304 True ENSG00000198286 ENSG00000198286 HGNC:16393 CARD14 gene CARD14 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Pityriasis rubra pilaris (MIM#173200) 22703878;27760266 False 3 100;0;0 1.2304 True ENSG00000141527 ENSG00000141527 HGNC:16446 CARD9 gene CARD9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Candidiasis, familial, 2, autosomal recessive, MIM# 212050;Predisposition to invasive fungal disease, MONDO:0008905 19864672;23335372;24131138;33789983;33558980;33180249 False 3 100;0;0 1.2304 True ENSG00000187796 ENSG00000187796 HGNC:16391 CARMIL2 gene CARMIL2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 58, MIM# 618131;Early onset paediatric inflammatory bowel disease 29479355;28112205;27896283;33723309 False 3 100;0;0 1.2304 True ENSG00000159753 ENSG00000159753 HGNC:27089 CARS gene CARS Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Intellectual disability;microcephaly;brittle hair and nails PMID: 30824121 False 3 0;0;0 1.2304 True ENSG00000110619 ENSG00000110619 HGNC:1493 CARS2 gene CARS2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 27, MIM# 616672;MONDO:0014728 25361775;25787132;30139652 False 3 100;0;0 1.2304 True ENSG00000134905 ENSG00000134905 HGNC:25695 CASK gene CASK Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) FG syndrome 4 MIM#300422;Intellectual developmental disorder and microcephaly with pontine and cerebellar hypoplasia MIM#300749;Mental retardation, with or without nystagmus MIM#300422 24278995 False 3 100;0;0 1.2304 True ENSG00000147044 ENSG00000147044 HGNC:1497 CASP10 gene CASP10 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Autoimmune lymphoproliferative syndrome, type II MIM#603909 34329798;34384744;20301287 False 3 100;0;0 1.2304 True ENSG00000003400 ENSG00000003400 HGNC:1500 CASP2 gene CASP2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Intellectual developmental disorder, autosomal recessive 80, with variant lissencephaly, MIM# 620653 37880421 False 3 100;0;0 1.2304 True ENSG00000106144 ENSG00000106144 HGNC:1503 CASQ1 gene CASQ1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myopathy, vacuolar, with CASQ1 aggregates MIM#616231 26136523;30258016 False 3 100;0;0 1.2304 True ENSG00000143318 ENSG00000143318 HGNC:1512 CASR gene CASR Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Hyperparathyroidism, neonatal MIM#239200;Hypocalcemia, autosomal dominant MIM#601198;Hypocalcemia autosomal dominant, with Bartter syndrome MIM#601198;hypercalcemia, type I MIM#145980 7916660;7726161;8675635;17698911;22620673;26646938;22422767 False 3 100;0;0 1.2304 True ENSG00000036828 ENSG00000036828 HGNC:1514 CAST gene CAST Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Peeling skin with leukonychia, acral punctate keratoses, cheilitis, and knuckle pads (MIM#616295) 25683118;31392520;30656735;28851602 False 3 100;0;0 1.2304 True ENSG00000153113 ENSG00000153113 HGNC:1515 CASZ1 gene CASZ1 Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dilated cardiomyopathy, MONDO:0005021, CASZ1-related;left ventricular non compaction 28099117;36293425;31268246 False 3 100;0;0 1.2304 True ENSG00000130940 ENSG00000130940 HGNC:26002 CAT gene CAT Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Acatalasemia MIM#614097;hypocatalasemia 24025477 False 3 100;0;0 1.2304 True ENSG00000121691 ENSG00000121691 HGNC:1516 CATSPER1 gene CATSPER1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spermatogenic failure 7 MIM#612997 19344877;25457194;19210926 False 3 100;0;0 1.2304 True ENSG00000175294 ENSG00000175294 HGNC:17116 CAV1 gene CAV1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Lipodystrophy, familial partial, type 7, autosomal dominant MIM# 606721;Lipodystrophy, congenital generalized, type 3, autosomal recessive, MIM# 612526 18237401;25898808;11739396;18211975;27717241;26176221;33836561;33776068;32502478;22474227;28768485 False 3 100;0;0 1.2304 True ENSG00000105974 ENSG00000105974 HGNC:1527 CAV3 gene CAV3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myopathy, distal, Tateyama type MIM#614321;Rippling muscle disease 2 MIM#606072;Creatine phosphokinase, elevated serum MIM#123320 32004987;28807458;27312022;10746614 False 3 100;0;0 1.2304 True ENSG00000182533 ENSG00000182533 HGNC:1529 CAVIN1 gene CAVIN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Lipodystrophy, congenital generalized, type 4, MIM# 613327;MONDO:0013225 19726876;20300641;20684003;18840361 False 3 100;0;0 1.2304 True ENSG00000177469 ENSG00000177469 HGNC:9688 CBFB gene CBFB Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted cleidocranial dysplasia (MONDO#0007340), CBFB-related 36241386 False 3 100;0;0 1.2304 True ENSG00000067955 ENSG00000067955 HGNC:1539 CBL gene CBL Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Noonan syndrome-like disorder with or without juvenile myelomonocytic leukaemia, MIM# 613563 25358541;20619386;20543203;20694012 False 3 100;0;0 1.2304 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000110395 ENSG00000110395 HGNC:1541 CBLB gene CBLB Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "Autoimmune disease, multisystem, infantile-onset, 3, MIM# 620430" 36006710 False 3 100;0;0 1.2304 True ENSG00000114423 ENSG00000114423 HGNC:1542 CBS gene CBS Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Homocystinuria, B6-responsive and nonresponsive types, 236200;Thrombosis, hyperhomocysteinemic, 236200 7506602;10338090 False 3 100;0;0 1.2304 True ENSG00000160200 ENSG00000160200 HGNC:1550 CBX1 gene CBX1 Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder (MONDO#0700092), CBX1-related PMID: 37087635 False 3 100;0;0 1.2304 True ENSG00000108468 ENSG00000108468 HGNC:1551 CBY1 gene CBY1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome, MONDO:0018772, CBY1-related 33131181;25103236;25220153 False 3 100;0;0 1.2304 True ENSG00000100211 ENSG00000100211 HGNC:1307 CC2D1A gene CC2D1A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Intellectual developmental disorder, autosomal recessive 3, MIM# 608443 25066123 False 3 100;0;0 1.2304 True ENSG00000132024 ENSG00000132024 HGNC:30237 CC2D2A gene CC2D2A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 9, MIM# 612285;Meckel syndrome 6, MIM# 612284;COACH syndrome 2, MIM# 619111 18387594;18950740;18513680;18950740;19574260;21725307;33486889;30267408 False 3 100;0;0 1.2304 True ENSG00000048342 ENSG00000048342 HGNC:29253 CCBE1 gene CCBE1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hennekam lymphangiectasia- lymphoedema syndrome MIM# 235510;lymphangiectasia and lymphoedema;facial abnormalities;dysmorphic features;hypoalbuminaemia;intellectual disability;hypoglobulinaemia 19935664;19911200;19287381;25925991;27345729;21778431 False 3 100;0;0 1.2304 True ENSG00000183287 ENSG00000183287 HGNC:29426 CCDC103 gene CCDC103 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 17, MIM# 614679 22581229;32447765;31858719;28790179 False 3 100;0;0 1.2304 True ENSG00000167131 ENSG00000167131 HGNC:32700 CCDC114 gene CCDC114 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 20, MIM# 615067 23261303;23261302;32855706;23506398 False 3 100;0;0 1.2304 True ENSG00000105479 ENSG00000105479 HGNC:26560 CCDC115 gene CCDC115 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IIo (MIM# 616828) 26833332 False 3 100;0;0 1.2304 True ENSG00000136710 ENSG00000136710 HGNC:28178 CCDC134 gene CCDC134 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Osteogenesis imperfecta, type XXII, MIM#619795 32181939;34204301;35019224 False 3 100;0;0 1.2304 True ENSG00000100147 ENSG00000100147 HGNC:26185 CCDC151 gene CCDC151 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 30, MIM# 616037 25192045;25224326;32490514;32286033;30504913 False 3 100;0;0 1.2304 True ENSG00000198003 ENSG00000198003 HGNC:28303 CCDC155 gene CCDC155 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Non-obstructive azoospermia;Premature ovarian insufficiency;Infertility disorder, MONDO:0005047, CCDC155-related 35674372;35708642;29790874;35587281 False 3 100;0;0 1.2304 True ENSG00000161609 ENSG00000161609 HGNC:26520 CCDC22 gene CCDC22 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Ritscher-Schinzel syndrome 2, MIM# 300963 21826058;24916641;34020006;33059814;31971710 False 3 100;0;0 1.2304 True ENSG00000101997 ENSG00000101997 HGNC:28909 CCDC32 gene CCDC32 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Cardiofacioneurodevelopmental syndrome (CFNDS), MIM#619123;Craniofacial, cardiac, laterality and neurodevelopmental anomalies 32307552 False 3 50;50;0 1.2304 True ENSG00000128891 ENSG00000128891 HGNC:28295 CCDC34 gene CCDC34 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Spermatogenic failure 76, MIM# 620084" 34348960 False 3 100;0;0 1.2304 True ENSG00000109881 ENSG00000109881 HGNC:25079 CCDC39 gene CCDC39 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 14, MIM# 613807 21131972;23255504 False 3 100;0;0 1.2304 True ENSG00000145075 ENSG00000145075 HGNC:25244 CCDC40 gene CCDC40 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 15, MIM#613808 21131974;23255504;31879361;31765523;31650533 False 3 100;0;0 1.2304 True ENSG00000141519 ENSG00000141519 HGNC:26090 CCDC47 gene CCDC47 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Trichohepatoneurodevelopmental syndrome, 618268 30401460 False 3 100;0;0 1.2304 False ENSG00000108588 ENSG00000108588 HGNC:24856 CCDC65 gene CCDC65 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 27, MIM# 615504 23991085;24094744 False 3 100;0;0 1.2304 True ENSG00000139537 ENSG00000139537 HGNC:29937 CCDC8 gene CCDC8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal 3-M syndrome 3, MIM#614205 21737058 False 3 100;0;0 1.2304 True ENSG00000169515 ENSG00000169515 HGNC:25367 CCDC82 gene CCDC82 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092, CCDC82-related 35373332;35118659;27457812 False 3 100;0;0 1.2304 True ENSG00000149231 ENSG00000149231 HGNC:26282 CCDC88A gene CCDC88A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal PEHO syndrome-like, MIM# 617507 26917597;30392057 False 3 100;0;0 1.2304 True ENSG00000115355 ENSG00000115355 HGNC:25523 CCDC88C gene CCDC88C Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spinocerebellar ataxia 40, MIM#616053;Hydrocephalus, nonsyndromic, autosomal recessive 236600;Early-onset pure hereditary spastic paraplegia 23042809;21031079;25062847;30398676;33602173 False 3 25;75;0 1.2304 True ENSG00000015133 ENSG00000015133 HGNC:19967 CCIN gene CCIN Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Spermatogenic failure 91, MIM# 620838 36546111;36527329 False 3 100;0;0 1.2304 True ENSG00000185972 ENSG00000185972 HGNC:1568 CCM2 gene CCM2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cerebral cavernous malformations-2 MIM#603284 14624391;18779516;30356112;21543988 False 3 100;0;0 1.2304 True ENSG00000136280 ENSG00000136280 HGNC:21708 CCND2 gene CCND2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, CCND2-related MONDO: 0700092;Microcephaly, MONDO: 0001149;Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 3, MIM# 615938 False 3 100;0;0 1.2304 True ENSG00000118971 ENSG00000118971 HGNC:1583 CCNO gene CCNO Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 29, MIM# 615872 24747639;31765523;28801648 False 3 100;0;0 1.2304 True ENSG00000152669 ENSG00000152669 HGNC:18576 CCR2 gene CCR2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal {HIV infection, susceptibility/resistance to};Polycystic lung disease MIM#219600 34516427;17504215;15167933;17604544;38157855 False 3 50;0;50 1.2304 True ENSG00000121807 ENSG00000121807 HGNC:1603 CCR5 gene CCR5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Hepatitis C virus, resistance to} 609532;{HIV infection, susceptibility/resistance to};{West nile virus, susceptibility to}MIM# 610379 False 3 100;0;0 1.2304 True ENSG00000160791 ENSG00000160791 HGNC:1606 CCT3 gene CCT3 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with speech or visual impairment and brain hypomyelination, MIM# 621034 39480921 False 3 100;0;0 1.2304 True ENSG00000163468 ENSG00000163468 HGNC:1616 CCT6A gene CCT6A Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted neurodevelopmental disorder MONDO:0700092, CCT6A-related 39480921 False 3 100;0;0 1.2304 True ENSG00000146731 ENSG00000146731 HGNC:1620 CD151 gene CD151 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Nephropathy with pretibial epidermolysis bullosa and deafness, MIM#609057 15265795;29138120 False 3 100;0;0 1.2304 True ENSG00000177697 ENSG00000177697 HGNC:1630 CD164 gene CD164 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Deafness, autosomal dominant 66, MIM# 616969 26197441;35254497;26197441 False 3 100;0;0 1.2304 True ENSG00000135535 ENSG00000135535 HGNC:1632 CD19 gene CD19 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency, common variable, 3, MIM# 613493 16672701;17882224;17882224;21330302;21159371 False 3 100;0;0 1.2304 True ENSG00000177455 ENSG00000177455 HGNC:1633 CD247 gene CD247 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 25, MIM# 610163;Absent T cells;Normal B cells;Normal NK cells 16672702 False 3 100;0;0 1.2304 True ENSG00000198821 ENSG00000198821 HGNC:1677 CD27 gene CD27 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Lymphoproliferative syndrome 2;CD27-deficiency MIM# 615122;hepatosplenomegaly;reduced CD8+ T-cell function;lymphadenopathy;hepatosplenomegaly;fever;increased susceptibility to EBV infection;aplastic anaemia 22197273;22801960;22365582;25843314;11062504 False 3 100;0;0 1.2304 True ENSG00000139193 ENSG00000139193 HGNC:11922 CD2AP gene CD2AP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal focal segmental glomerulosclerosis 3, susceptibility to MONDO:0011917 30612599;17713465;10997929;12764198;15951437 False 3 0;100;0 1.2304 True ENSG00000198087 ENSG00000198087 HGNC:14258 CD36 gene CD36 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Platelet glycoprotein IV deficiency MIM#608404;{Malaria, cerebral, reduced risk of} MIM#611162;{Malaria, cerebral, susceptibility to} MIM#611162 7686693;11950861;10890433;24960640;10890433 False 3 100;0;0 1.2304 True ENSG00000135218 ENSG00000135218 HGNC:1663 CD3D gene CD3D Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 19 MIM# 615617 14602880;15546002;21926461;21883749 False 3 100;0;0 1.2304 True ENSG00000167286 ENSG00000167286 HGNC:1673 CD3E gene CD3E Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 18 MIM# 615615 5546002;28597365;8490660 False 3 100;0;0 1.2304 True ENSG00000198851 ENSG00000198851 HGNC:1674 CD3G gene CD3G Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 17, CD3 gamma deficient MIM# 615607;immune deficiency;autoimmunity;failure to thrive;recurrent gastrointestinal infections;recurrent respiratory infections;autoimmune haemolytic anaemia;bronchiolitis obliterans;low CD3 complex;partial T lymphocytopenia;intractable diarrhoea. 2872416;1635567;17277165;23590417;24910257;18482219;31921117;11160319 False 3 100;0;0 1.2304 True ENSG00000160654 ENSG00000160654 HGNC:1675 CD4 gene CD4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 79, MIM# 619238;Absence of CD4+ T cells;exuberant, relapsing, treatment-refractory warts 31781092;33471124 False 3 100;0;0 1.2304 True ENSG00000010610 ENSG00000010610 HGNC:1678 CD40 gene CD40 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency with hyper-IgM, type 3, MIM# 606843 11675497;12915844 False 3 100;0;0 1.2304 True ENSG00000101017 ENSG00000101017 HGNC:11919 CD40LG gene CD40LG Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Immunodeficiency, X-linked, with hyper-IgM MIM# 308230;Severe opportunistic infections (recurrent), idiopathic neutropaenia;dysgammaglobulinaemia hepatitis;cholangitis;cholangiocarcinoma;autoimmune blood cytopenias;haemolytic anaemia;thrombocytopaenia;diarrhoea;peripheral neuroectodermal tumours 7679801;7679206;8094231;9933119;15358621;15997875;7678782;7915248;15367912;7518839;16311023;9933119;12402041;7882172;33475257 False 3 100;0;0 1.2304 True ENSG00000102245 ENSG00000102245 HGNC:11935 CD46 gene CD46 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal {Hemolytic uremic syndrome, atypical, susceptibility to, 2} MIM#612922 20301541;26054645;26826462 False 3 100;0;0 1.2304 True ENSG00000117335 ENSG00000117335 HGNC:6953 CD55 gene CD55 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Complement hyperactivation, angiopathic thrombosis, and protein-losing enteropathy, MIM# 226300 28657829;28657861 False 3 100;0;0 1.2304 True ENSG00000196352 ENSG00000196352 HGNC:2665 CD59 gene CD59 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Haemolytic anaemia, CD59-mediated, with or without immune-mediated polyneuropathy, MIM# 612300 24382084;23149847 False 3 100;0;0 1.2304 True ENSG00000085063 ENSG00000085063 HGNC:1689 CD70 gene CD70 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Lymphoproliferative syndrome 3, MIM# 618261 28011864;28011863 False 3 100;0;0 1.2304 True ENSG00000125726 ENSG00000125726 HGNC:11937 CD79A gene CD79A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Agammaglobulinaemia 3 MIM#613501 29335801;31696364;24481606;10525050;11920841 False 3 100;0;0 1.2304 True ENSG00000105369 ENSG00000105369 HGNC:1698 CD79B gene CD79B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Agammaglobulinaemia 6, MIM#612692 17709424;17675462;33733381;24722855 False 3 100;0;0 1.2304 True ENSG00000007312 ENSG00000007312 HGNC:1699 CD81 gene CD81 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency, common variable, 6, MIM# 613496 20237408;35849269 False 3 50;50;0 1.2304 True ENSG00000110651 ENSG00000110651 HGNC:1701 CDAN1 gene CDAN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Dyserythropoietic anemia, congenital, type Ia, 224120 32518175 False 3 100;0;0 1.2304 True ENSG00000140326 ENSG00000140326 HGNC:1713 CDC14A gene CDC14A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 32, with or without immotile sperm, MIM# 608653 29293958;2725905 False 3 100;0;0 1.2304 True ENSG00000079335 ENSG00000079335 HGNC:1718 CDC23 gene CDC23 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal inherited oocyte maturation defect MONDO#0014769, CDC23-related 37768355 False 3 100;0;0 1.2304 True ENSG00000094880 ENSG00000094880 HGNC:1724 CDC42 gene CDC42 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Takenouchi-Kosaki syndrome, MIM#616737 29394990;31601675;32303876;32231661 False 3 100;0;0 1.2304 True ENSG00000070831 ENSG00000070831 HGNC:1736 CDC42BPB gene CDC42BPB Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Chilton-Okur-Chung neurodevelopmental syndrome, MIM# 619841 32031333 False 3 100;0;0 1.2304 True ENSG00000198752 ENSG00000198752 HGNC:1738 CDC45 gene CDC45 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Meier-Gorlin syndrome 7, MIM 617063 31474763 False 3 100;0;0 1.2304 True ENSG00000093009 ENSG00000093009 HGNC:1739 CDC73 gene CDC73 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hyperparathyroidism-jaw tumour syndrome, MIM# 145001;Hyperparathyroidism, familial primary, MIM# 145000 12434154 False 3 100;0;0 1.2304 True ENSG00000134371 ENSG00000134371 HGNC:16783 CDCA7 gene CDCA7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency-centromeric instability-facial anomalies syndrome 3, MIM# 616910;MONDO:0014828 26216346 False 3 100;0;0 1.2304 True ENSG00000144354 ENSG00000144354 HGNC:14628 CDCA8 gene CDCA8 Expert Review;Expert Review Green Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Congenital hypothyroidism, thyroid dysgenesis, no OMIM # 28025328;29546359 False 3 100;0;0 1.2304 True Other ENSG00000134690 ENSG00000134690 HGNC:14629 CDH11 gene CDH11 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Elsahy-Waters syndrome, MIM# 211380;Teebi hypertelorism syndrome 33811546;27431290;28988429;29271567;33811546 False 3 100;0;0 1.2304 True ENSG00000140937 ENSG00000140937 HGNC:1750 CDH2 gene CDH2 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Intellectual disability;corpus callosum abnormalities;congenital abnormalities;Agenesis of corpus callosum, cardiac, ocular, and genital syndrome, MIM# 618929;Attention deficit-hyperactivity disorder 8 , MIM# 619957" 31585109 False 3 100;0;0 1.2304 True ENSG00000170558 ENSG00000170558 HGNC:1759 CDH23 gene CDH23 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Usher syndrome, type 1D (MIM# 601067);Deafness, autosomal recessive 12 (MIM # 601386) Usher syndrome, type 1D/F digenic (MIM #601067) 11138009;25468891;21940737 False 3 100;0;0 1.2304 True ENSG00000107736 ENSG00000107736 HGNC:13733 CDH3 gene CDH3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ectodermal dysplasia, ectrodactyly, and macular dystrophy, MIM# 225280;Hypotrichosis, congenital, with juvenile macular dystrophy, MIM# 601553 11544476;15805154;28061825;22140374 False 3 100;0;0 1.2304 True ENSG00000062038 ENSG00000062038 HGNC:1762 CDHR1 gene CDHR1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cone-rod dystrophy 15 MIM#613660;Retinitis pigmentosa 65 MIM#613660 20805371;20087419;34926197;32277948;32783370;31387115;32681094 False 3 100;0;0 1.2304 True ENSG00000148600 ENSG00000148600 HGNC:14550 CDK10 gene CDK10 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Al Kaissi syndrome MIM#617694 28886341;34974531 False 3 100;0;0 1.2304 True ENSG00000185324 ENSG00000185324 HGNC:1770 CDK13 gene CDK13 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Congenital heart defects, dysmorphic facial features, and intellectual developmental disorder, MIM#617360 29021403;29393965;30904094 False 3 100;0;0 1.2304 True ENSG00000065883 ENSG00000065883 HGNC:1733 CDK16 gene CDK16 Expert list;Expert Review Green Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Neurodevelopmental disorder (MONDO#0700092) CDK16-related 25644381;36323681;31981491;25644381 False 3 50;50;0 1.2304 True ENSG00000102225 ENSG00000102225 HGNC:8749 CDK19 gene CDK19 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Intellectual disability;epileptic encephalopathy;Epileptic encephalopathy, early infantile, 87, MIM# 618916" 32330417 False 3 100;0;0 1.2304 True ENSG00000155111 ENSG00000155111 HGNC:19338 CDK5RAP2 gene CDK5RAP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephaly 3, primary, autosomal recessive, MIM# 604804;MONDO:0011488 15793586;22887808;23995685;23726037;27761245;20460369;32677750;32015000 False 3 100;0;0 1.2304 True ENSG00000136861 ENSG00000136861 HGNC:18672 CDK8 gene CDK8 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability;dysmorphism;congenital abnormalities;seizures 30905399 False 3 100;0;0 1.2304 True ENSG00000132964 ENSG00000132964 HGNC:1779 CDKL5 gene CDKL5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Epileptic encephalopathy, early infantile, 2, MIM 300672 27080038;30842224 False 3 100;0;0 1.2304 True ENSG00000008086 ENSG00000008086 HGNC:11411 CDKN1B gene CDKN1B Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Multiple endocrine neoplasia type 4, MEN4, OMIM #610755 24819502;17030811;23555276 False 3 100;0;0 1.2304 True ENSG00000111276 ENSG00000111276 HGNC:1785 CDKN1C gene CDKN1C Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed) Beckwith-Wiedemann syndrome, MIM# 130650;IMAGe syndrome, MIM# 614732;Silver-Russell syndrome 10424811;8841187;22205991;20503313;19843502;15372379;23511928;30794780;33076988;31976094;31497289 False 3 100;0;0 1.2304 True ENSG00000129757 ENSG00000129757 HGNC:1786 CDKN2A gene CDKN2A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Melanoma and neural system tumor syndrome} MIM#155755;{Melanoma, cutaneous malignant, 2} MIM#155601;{Melanoma-pancreatic cancer syndrome} MIM#606719 False 3 50;0;50 1.2304 True ENSG00000147889 ENSG00000147889 HGNC:1787 CDON gene CDON Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Holoprosencephaly 11, MIM# 614226;MONDO:0013642 21802063;26529631;26728615;23071453 False 3 100;0;0 1.2304 True ENSG00000064309 ENSG00000064309 HGNC:17104 CDSN gene CDSN Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Peeling skin syndrome 1 MIM#270300;ichthyosiform erythroderma 24794518;18436651;20691404;21191406 False 3 100;0;0 1.2304 True ENSG00000204539 ENSG00000204539 HGNC:1802 CDT1 gene CDT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Meier-Gorlin syndrome 4, MIM# 613804;MONDO:0013431 21358632;21358631;33338304;22333897 False 3 100;0;0 1.2304 True ENSG00000167513 ENSG00000167513 HGNC:24576 CDX2 gene CDX2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Genetic multiple congenital anomalies/dysmorphic syndrome, MONDO:0043005;Congenital abnormalities of anus, renal and urogenital system, vertebrae and/or the limbs 29177441 False 3 50;50;0 1.2304 True ENSG00000165556 ENSG00000165556 HGNC:1806 CEACAM16 gene CEACAM16 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Deafness, autosomal dominant 4B, MIM# 614614;Deafness, autosomal recessive 113, MIM# 618410 21368133;22544735;29703829;25589040;31249509;30514912 False 3 100;0;0 1.2304 True ENSG00000213892 ENSG00000213892 HGNC:31948 CEBPA gene CEBPA Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Leukaemia, acute myeloid, MIM#601626 15575056;32430494;31309983 False 3 50;0;50 1.2304 True ENSG00000245848 ENSG00000245848 HGNC:1833 CEBPE gene CEBPE Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Specific granule deficiency, MIM# 245480;Immunodeficiency 108 with autoinflammation, MIM# 260570 10359588;11313242;31256937;29651288;31201888 False 3 100;0;0 1.2304 True ENSG00000092067 ENSG00000092067 HGNC:1836 CELF2 gene CELF2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 97, MIM#619561 33131106 False 3 100;0;0 1.2304 True ENSG00000048740 ENSG00000048740 HGNC:2550 CELSR1 gene CELSR1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Lymphatic malformation 9, MIM# 619319 31215153;31403174;26855770 False 3 100;0;0 1.2304 True ENSG00000075275 ENSG00000075275 HGNC:1850 CELSR3 gene CELSR3 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder (MONDO#0700092), CELSR3-related PMID: 38429302 False 3 100;0;0 1.2304 True ENSG00000008300 ENSG00000008300 HGNC:3230 CENPF gene CENPF Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Stromme syndrome (MIM#243605) 25564561;28407396;26820108 False 3 100;0;0 1.2304 True ENSG00000117724 ENSG00000117724 HGNC:1857 CENPJ gene CENPJ Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephaly 6, primary, autosomal recessive, MIM# 608393, MONDO:0012029;Seckel syndrome 4, MIM# 613676, MONDO:0013358 20522431;23166506;15793586;20978018;22775483;32677750;32549991;34068194 False 3 100;0;0 1.2304 True ENSG00000151849 ENSG00000151849 HGNC:17272 CEP104 gene CEP104 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 25, MIM# 616781;MONDO:0014770;Neurodevelopmental disorder;MONDO:0014770, CEP104-related 26477546;34196201;35359234 False 3 100;0;0 1.2304 True ENSG00000116198 ENSG00000116198 HGNC:24866 CEP120 gene CEP120 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 31, MIM# 617761;Short-rib thoracic dysplasia 13 with or without polydactyly, MIM# 616300 27208211;33486889;29847808;25361962;27208211 False 3 100;0;0 1.2304 True ENSG00000168944 ENSG00000168944 HGNC:26690 CEP135 gene CEP135 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephalic primordial dwarfism;Microcephaly 8, primary, autosomal recessive, 614673 30214071;22521416 False 3 100;0;0 1.2304 True ENSG00000174799 ENSG00000174799 HGNC:29086 CEP152 gene CEP152 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephaly 9, primary, autosomal recessive, MIM# 614852;MONDO:0013923;Seckel syndrome 5, MIM# 613823;MONDO:0013443 20598275;22775483;21131973;23199753 False 3 100;0;0 1.2304 True ENSG00000103995 ENSG00000103995 HGNC:29298 CEP164 gene CEP164 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome;Nephronophthisis 15, MIM# 614845;Oro-facio-digital syndrome 34132027;34013113;32055034;27708425;22863007 False 3 100;0;0 1.2304 True ENSG00000110274 ENSG00000110274 HGNC:29182 CEP250 gene CEP250 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cone-rod dystrophy and hearing loss 2, MIM# 618358 24780881;29718797;30459346 False 3 100;0;0 1.2304 True ENSG00000126001 ENSG00000126001 HGNC:1859 CEP290 gene CEP290 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 14, MIM# 615991;Joubert syndrome 5 610188;Leber congenital amaurosis 10, MIM# 611755;Meckel syndrome 4, MIM# 611134;Senior-Loken syndrome 6, MIM# 610189 18327255;20690115;16682973;16682970;17564967;16909394;17564974 False 3 100;0;0 1.2304 True ENSG00000198707 ENSG00000198707 HGNC:29021 CEP295 gene CEP295 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Seckel syndrome 11, OMIM # 620767 PMID: 38154379 False 3 100;0;0 1.2304 True ENSG00000166004 ENSG00000166004 HGNC:29366 CEP41 gene CEP41 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 15, MIM# 614464 22246503 False 3 100;0;0 1.2304 True ENSG00000106477 ENSG00000106477 HGNC:12370 CEP55 gene CEP55 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Multinucleated neurons, anhydramnios, renal dysplasia, cerebellar hypoplasia, and hydranencephaly, MIM# 236500 28264986;28295209;32100459 False 3 50;50;0 1.2304 True ENSG00000138180 ENSG00000138180 HGNC:1161 CEP57 gene CEP57 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mosaic variegated aneuploidy syndrome 2, #MIM 614114 24259107;21552266;32861809;30147898 False 3 100;0;0 1.2304 True ENSG00000166037 ENSG00000166037 HGNC:30794 CEP76 gene CEP76 Expert Review Green;Other Mendeliome BIALLELIC, autosomal or pseudoautosomal complex neurodevelopmental disorder MONDO:0100038;Joubert syndrome;Bardet-Biedl syndrome;retinitis pigmentosa False 3 100;0;0 1.2304 True ENSG00000101624 ENSG00000101624 HGNC:25727 CEP78 gene CEP78 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cone-rod dystrophy and hearing loss MIM#617236 28005958;27588451;27588452;27627988 False 3 100;0;0 1.2304 True ENSG00000148019 ENSG00000148019 HGNC:25740 CEP83 gene CEP83 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Nephronophthisis 18, MIM# 615862;MONDO:0014374;Retinal dystrophy;ID 24882706;33938610 False 3 100;0;0 1.2304 True ENSG00000173588 ENSG00000173588 HGNC:17966 CEP85L gene CEP85L Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Lissencephaly, posterior predominant 32097630 False 3 100;0;0 1.2304 True ENSG00000111860 ENSG00000111860 HGNC:21638 CERKL gene CERKL Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Retinitis pigmentosa 26, MIM# 608380 33322828;32865075;32411380;14681825;24043777;28838317;27208204;28130426 False 3 100;0;0 1.2304 True ENSG00000188452 ENSG00000188452 HGNC:21699 CERS3 gene CERS3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ichthyosis, congenital, autosomal recessive 9, MIM# 615023 23754960;23549421;31168818;30578701 False 3 100;0;0 1.2304 True ENSG00000154227 ENSG00000154227 HGNC:23752 CFAP20 gene CFAP20 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Retinitis pigmentosa (MONDO:0019200), CFAP20-related PMID:36329026 False 3 100;0;0 1.2304 True ENSG00000070761 ENSG00000070761 HGNC:29523 CFAP43 gene CFAP43 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal "Hydrocephalus, normal pressure, 1 236690;Spermatogenic failure 19 617592" PMID: 31884020;28552195;31004071;29449551 False 3 0;0;0 1.2304 True ENSG00000197748 ENSG00000197748 HGNC:26684 CFAP45 gene CFAP45 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Heterotaxy, visceral, 11, autosomal, with male infertility, MIM#619608 33139725 False 3 100;0;0 1.2304 True ENSG00000213085 ENSG00000213085 HGNC:17229 CFAP47 gene CFAP47 Expert Review Green;Literature Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Spermatogenic failure, X-linked, 3, MIM# 301059;asthenoteratozoospermia;morphological abnormalities of the flagella (MMAF) PMID: 33472045 False 3 50;50;0 1.2304 True ENSG00000165164 ENSG00000165164 HGNC:26708 CFAP52 gene CFAP52 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Heterotaxy, visceral, 10, autosomal, with male infertility, MIM#619607 25469542;33139725 False 3 100;0;0 1.2304 True ENSG00000166596 ENSG00000166596 HGNC:16053 CFAP53 gene CFAP53 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Heterotaxy, visceral, 6, autosomal recessive 614779 28621423;22577226;26531781 False 3 50;0;50 1.2304 True ENSG00000172361 ENSG00000172361 HGNC:26530 CFAP57 gene CFAP57 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spermatogenic failure 95, MIM# 620917;Van der Woude Syndrome;Primary ciliary dyskinesia 21574244;32764743;36752199 False 3 50;50;0 1.2304 True ENSG00000243710 ENSG00000243710 HGNC:26485 CFAP58 gene CFAP58 Expert Review;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Spermatogenic failure 49, MIM#619144;Multiple morphological abnormalities of the sperm flagella (MMAF) 32791035 False 3 100;0;0 1.2304 True ENSG00000120051 ENSG00000120051 HGNC:26676 CFAP65 gene CFAP65 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "Spermatogenic failure 40 618664" 31501240;31413122;34231842 False 3 100;0;0 1.2304 True ENSG00000181378 ENSG00000181378 HGNC:25325 CFAP69 gene CFAP69 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Asthenoteratospermia (Impaired sperm motility;severe flagellar abnormalities (short, coiled, absent or irregular calibre)) 29606301;30415212 False 3 100;0;0 1.2304 True ENSG00000105792 ENSG00000105792 HGNC:26107 CFB gene CFB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Complement factor B deficiency, MIM# 615561;{Hemolytic uremic syndrome, atypical, susceptibility to, 4} 612924 24152280;17182750 False 3 100;0;0 1.2304 True ENSG00000243649 ENSG00000243649 HGNC:1037 CFC1 gene CFC1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Heterotaxy, visceral, 2, autosomal 605376 31633655;18162845;25423076;11062482 False 3 50;0;50 1.2304 True ENSG00000136698 ENSG00000136698 HGNC:18292 CFD gene CFD Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Complement factor D deficiency MIM#613912 11457876;16527897;31440263 False 3 100;0;0 1.2304 True ENSG00000197766 ENSG00000197766 HGNC:2771 CFH gene CFH Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Basal laminar drusen MIM#126700;Complement factor H deficiency MIM#609814;{Hemolytic uremic syndrome, atypical, susceptibility to, 1} MIMI#235400 27572114;25814826;20301541;9312129;10803850;29888403;30905644 False 3 100;0;0 1.2304 True ENSG00000000971 ENSG00000000971 HGNC:4883 CFHR1 gene CFHR1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal {Hemolytic uremic syndrome, atypical, susceptibility to} MIM#235400 32424742 False 3 50;50;0 1.2304 True ENSG00000244414 ENSG00000244414 HGNC:4888 CFHR2 gene CFHR2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal C3 glomerulopathy;C3G;Immune complex MPGN;IC-MPGN 24334459;23728178;20800271 False 3 100;0;0 1.2304 True ENSG00000080910 ENSG00000080910 HGNC:4890 CFHR3 gene CFHR3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal {Hemolytic uremic syndrome, atypical, susceptibility to} MIM#235400 32424742 False 3 50;50;0 1.2304 True ENSG00000116785 ENSG00000116785 HGNC:16980 CFHR5 gene CFHR5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Nephropathy due to CFHR5 deficiency, MIM#614809 30844074;30197990;24067434;21566112;20800271;27490940;24334459 False 3 100;0;0 1.2304 True ENSG00000134389 ENSG00000134389 HGNC:24668 CFI gene CFI Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Complement factor I deficiency MIM#610984;{Hemolytic uremic syndrome, atypical, susceptibility to, 3} MIM#612923 29292855;28942469;27091480;20301541 False 3 100;0;0 1.2304 True ENSG00000205403 ENSG00000205403 HGNC:5394 CFL2 gene CFL2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Nemaline myopathy 7, autosomal recessive, MIM# 610687 17160903;22560515;32697999;29457652;24610938;32160286 False 3 100;0;0 1.2304 True ENSG00000165410 ENSG00000165410 HGNC:1875 CFP gene CFP Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Properdin deficiency, X-linked MIM#312060 8871668;10909851;22229731;9476131;10698340;10540191;16511390;19328743 False 3 100;0;0 1.2304 True ENSG00000126759 ENSG00000126759 HGNC:8864 CFTR gene CFTR Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cystic fibrosis, MIM# 219700;Congenital bilateral absence of vas deferens, MIM# 277180 False 3 100;0;0 1.2304 True ENSG00000001626 ENSG00000001626 HGNC:1884 CHAMP1 gene CHAMP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 40 (MIM#616579) 27148580;26340335 False 3 100;0;0 1.2304 True ENSG00000198824 ENSG00000198824 HGNC:20311 CHAT gene CHAT Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital myasthenics syndrome associated with episodic apnea;Myasthenic syndrome, congenital, 6, presynaptic, 254210 11172068;12756141;31192527;29518833;29189923 False 3 100;0;0 1.2304 True ENSG00000070748 ENSG00000070748 HGNC:1912 CHCHD10 gene CHCHD10 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 2 615911;Spinal muscular atrophy, Jokela type 615048;Myopathy, isolated mitochondrial, autosomal dominant 616209 31261376;24934289;25428574;25193783;32042922;31690696;30877432;30874923 False 3 100;0;0 1.2304 True Other ENSG00000250479 ENSG00000250479 HGNC:15559 CHD1 gene CHD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Pilarowski-Bjornsson syndrome, MIM#617682 28866611 False 3 100;0;0 1.2304 True Other ENSG00000153922 ENSG00000153922 HGNC:1915 CHD2 gene CHD2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, childhood-onset (MIM # 615369) False 3 100;0;0 1.2304 True ENSG00000173575 ENSG00000173575 HGNC:1917 CHD3 gene CHD3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Snijders Blok-Campeau syndrome (618205) 30397230 False 3 100;0;0 1.2304 True Other ENSG00000170004 ENSG00000170004 HGNC:1918 CHD4 gene CHD4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Sifrim-Hitz-Weiss syndrome, MIM 617159;Childhood idiopathic epilepsy and sinus arrhythmia 31388190;34109749 False 3 67;33;0 1.2304 True ENSG00000111642 ENSG00000111642 HGNC:1919 CHD5 gene CHD5 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Parenti-Mignot neurodevelopmental syndrome MIM#619873 33944996 False 3 100;0;0 1.2304 True ENSG00000116254 ENSG00000116254 HGNC:16816 CHD7 gene CHD7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypogonadotropic hypogonadism 5 with or without anosmia MIM#612370;CHARGE syndrome MIM#214800 26411921 False 3 100;0;0 1.2304 True ENSG00000171316 ENSG00000171316 HGNC:20626 CHD8 gene CHD8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Autism, susceptibility to, 18} 615032;Neurodevelopmental disorder, MONDO:0700092, CHD8-associated 31980904 False 3 100;0;0 1.2304 True ENSG00000100888 ENSG00000100888 HGNC:20153 CHKA gene CHKA Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly, movement abnormalities, and seizures, MIM#620023 35202461 False 3 100;0;0 1.2304 True ENSG00000110721 ENSG00000110721 HGNC:1937 CHKB gene CHKB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, congenital, megaconial type, MIM# 602541 21665002;23692895;24997086 False 3 100;0;0 1.2304 True ENSG00000100288 ENSG00000100288 HGNC:1938 CHM gene CHM Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Choroideremia MIM#303100 20301511 False 3 100;0;0 1.2304 True ENSG00000188419 ENSG00000188419 HGNC:1940 CHMP1A gene CHMP1A Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 8, MIM# 614961 23023333 False 3 50;0;50 1.2304 True ENSG00000131165 ENSG00000131165 HGNC:8740 CHMP4B gene CHMP4B Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cataract 31, multiple types MIM#605387 34722561;17701905;10682967;30078984 False 3 100;0;0 1.2304 True ENSG00000101421 ENSG00000101421 HGNC:16171 CHN1 gene CHN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Duane retraction syndrome 2,MIM#604356 20301369 False 3 100;0;0 1.2304 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000128656 ENSG00000128656 HGNC:1943 CHP1 gene CHP1 Expert Review;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 9, autosomal recessive, MIM #618438 29379881;32787936 False 3 100;0;0 1.2304 True ENSG00000187446 ENSG00000187446 HGNC:17433 CHRDL1 gene CHRDL1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Megalocornea OMIM# 309300 25093588 False 3 100;0;0 1.2304 True ENSG00000101938 ENSG00000101938 HGNC:29861 CHRM3 gene CHRM3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Prune belly syndrome, MIM# 100100 22077972;31441039 False 3 100;0;0 1.2304 True ENSG00000133019 ENSG00000133019 HGNC:1952 CHRNA1 gene CHRNA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Multiple pterygium syndrome, lethal type, MIM# 253290;MONDO:0009668;Myasthenic syndrome, congenital, 1A, slow-channel, MIM# 601462;Myasthenic syndrome, congenital, 1B, fast-channel , MIM#608930 26910802;10195214;12588888;15079006;18806275;7619526;8872460;9158151;18252226 False 3 100;0;0 1.2304 True ENSG00000138435 ENSG00000138435 HGNC:1955 CHRNA2 gene CHRNA2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epilepsy, nocturnal frontal lobe, type 4 MIM#610353 16826524;25770198;30809122;25847220 False 3 100;0;0 1.2304 True ENSG00000120903 ENSG00000120903 HGNC:1956 CHRNA3 gene CHRNA3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bladder dysfunction, autonomic, with impaired pupillary reflex and secondary CAKUT, MIM# 191800 31708116 False 3 100;0;0 1.2304 True ENSG00000080644 ENSG00000080644 HGNC:1957 CHRNA4 gene CHRNA4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epilepsy, nocturnal frontal lobe, 1, MIM# 600513 14623738;23114665 False 3 100;0;0 1.2304 True Other ENSG00000101204 ENSG00000101204 HGNC:1958 CHRNB1 gene CHRNB1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Myasthenic syndrome, slow-channel congenital, 601462 Myasthenic syndrome, congenital, 2A, slow-channel, 616313;Myasthenic syndrome, congenital, 2C, associated with acetylcholine receptor deficiency, 616314 8872460;8651643;27375219;32504635;10562302 False 3 100;0;0 1.2304 True ENSG00000170175 ENSG00000170175 HGNC:1961 CHRNB2 gene CHRNB2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epilepsy, nocturnal frontal lobe, 3, MIM# 605375 11062464;11104662;19153075;32536355;25770198;23032131 False 3 100;0;0 1.2304 True ENSG00000160716 ENSG00000160716 HGNC:1962 CHRND gene CHRND Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 3B, fast-channel, MIM#616322;Myasthenic syndrome, congenital, 3C, associated with acetylcholine receptor deficiency, MIM#616323;Myasthenic syndrome, congenital, 3A, slow-channel, MIM#616321;Multiple pterygium syndrome, lethal type, MIM# 253290;MONDO:0009668 16916845;11435464;12499478;18398509;11782989;29399782;18252226 False 3 100;0;0 1.2304 True ENSG00000135902 ENSG00000135902 HGNC:1965 CHRNE gene CHRNE Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 4B, fast-channel, 616324;Myasthenic syndrome, congenital, 4C, associated with acetylcholine receptor deficiency, 608931;Myasthenic syndrome, slow-channel congenital, 601462;Myasthenic syndrome, congenital, 4A, slow-channel, 605809 8755487;8957026;11030414;12417530;32727330;32070632;31773638 False 3 100;0;0 1.2304 True ENSG00000108556 ENSG00000108556 HGNC:1966 CHRNG gene CHRNG Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Escobar syndrome, MIM# 265000;Multiple pterygium syndrome, lethal type, MIM# 253290;MONDO:0009926;MONDO:0009668 16826520;16826531;22167768 False 3 100;0;0 1.2304 True ENSG00000196811 ENSG00000196811 HGNC:1967 CHST14 gene CHST14 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ehlers-Danlos syndrome, musculocontractural type 1 MIM# 601776 28306229;25703627;26373698 False 3 100;0;0 1.2304 True ENSG00000169105 ENSG00000169105 HGNC:24464 CHST3 gene CHST3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spondyloepiphyseal dysplasia with congenital joint dislocations, MIM# 143095 18513679 False 3 100;0;0 1.2304 True ENSG00000122863 ENSG00000122863 HGNC:1971 CHST6 gene CHST6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Macular corneal dystrophy, MIM# 217800, MONDO:0009020 11818380;16207214;26604660 False 3 100;0;0 1.2304 True ENSG00000183196 ENSG00000183196 HGNC:6938 CHSY1 gene CHSY1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Temtamy preaxial brachydactyly syndrome, MIM# 605282, MONDO:0011533;CHSY1-CDG (Disorders of protein O-glycosylation, O-mannosylglycan synthesis deficiencies) 21129728;21129727;24269551 False 3 100;0;0 1.2304 True ENSG00000131873 ENSG00000131873 HGNC:17198 CHUK gene CHUK Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Combined immunodeficiency, MONDO:0015131, CHUK-related;Popliteal pterygium syndrome, Bartsocas-Papas type 2, MIM# 619339;Cocoon syndrome, MIM# 613630;AEC-like syndrome 25691407;20961246;10195895;10195896;29523099;28513979;34533979 False 3 50;50;0 1.2304 True ENSG00000213341 ENSG00000213341 HGNC:1974 CIAO1 gene CIAO1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Multiple mitochondrial dysfunctions syndrome 10, MIM#620960 38411040;38196629 False 3 100;0;0 1.2304 True ENSG00000144021 ENSG00000144021 HGNC:14280 CIB1 gene CIB1 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Epidermodysplasia verruciformis 3 618267;HPV infections and cancer of the skin" 30068544 False 3 100;0;0 1.2304 True ENSG00000185043 ENSG00000185043 HGNC:16920 CIB2 gene CIB2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 48, MIM# 609439 23023331;23023331;26173970;26473954;27344577;26226137;26445815 False 3 100;0;0 1.2304 True ENSG00000136425 ENSG00000136425 HGNC:24579 CIC gene CIC Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder, autosomal dominant 45 MIM#617600 28288114;21076407 False 3 100;0;0 1.2304 True ENSG00000079432 ENSG00000079432 HGNC:14214 CIITA gene CIITA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bare Lymphocyte Syndrome, type II, complementation group A MIM# 209920;varied ID;bronchiolitis;pneumonia;severe autoimmune cytopaenia;CD4 T-cell lymphopaenia;hypogammaglobulinemia;absence of antigen-induced immune response;chronic diarrhoea;recurrent respiratory infections;recurrent gastroenteritis;failure to thrive;liver/biliary tract disease 8402893;9099848;11862382;28676232;24789686;20197681;11466404;15821736;12910265 False 3 100;0;0 1.2304 True ENSG00000179583 ENSG00000179583 HGNC:7067 CISD2 gene CISD2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Wolfram syndrome 2 MIM#604928 29237418;28335035;27459537;26230298;17846994 False 3 100;0;0 1.2304 True ENSG00000145354 ENSG00000145354 HGNC:24212 CIT gene CIT Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephaly 17, primary, autosomal recessive (MIM#617090) 27453578;27503289;27453579 False 3 100;0;0 1.2304 True ENSG00000122966 ENSG00000122966 HGNC:1985 CITED2 gene CITED2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Atrial septal defect 8 - MIM#614433;Ventricular septal defect 2 - MIM#614431 33706167;33439552;31515672;29536580 False 3 100;0;0 1.2304 True ENSG00000164442 ENSG00000164442 HGNC:1987 CKAP2L gene CKAP2L Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Filippi syndrome, MIM# 272440 25439729;33913579;29473684 False 3 100;0;0 1.2304 True ENSG00000169607 ENSG00000169607 HGNC:26877 CLCF1 gene CLCF1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cold-induced sweating syndrome 2 MIM#610313 16782820;20400119;21370513 False 3 100;0;0 1.2304 True ENSG00000175505 ENSG00000175505 HGNC:17412 CLCN1 gene CLCN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Myotonia congenita, dominant 160800;Myotonia congenita, recessive 255700 1379744;7981750;8533761 False 3 100;0;0 1.2304 True ENSG00000188037 ENSG00000188037 HGNC:2019 CLCN2 gene CLCN2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Leukoencephalopathy with ataxia, MIM# 615651;Hyperaldosteronism, familial, type II, MIM# 605635 29403011;29403012;23707145 False 3 100;0;0 1.2304 True ENSG00000114859 ENSG00000114859 HGNC:2020 CLCN3 gene CLCN3 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal "Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512;Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517" PMID: 34186028 False 3 100;0;0 1.2304 True Other ENSG00000109572 ENSG00000109572 HGNC:2021 CLCN4 gene CLCN4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Raynaud-Claes syndrome, MIM#300114;intellectual disability;epilepsy;autistic features;mood disorders;cerebral white matter changes;progressive appendicular spasticity 27550844 False 3 100;0;0 1.2304 True ENSG00000073464 ENSG00000073464 HGNC:2022 CLCN5 gene CLCN5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Dent disease, MIM#300009;Hypophosphatemic rickets, MIM#300554;Nephrolithiasis, type I, MIM#310468;Proteinuria, low molecular weight, with hypercalciuric nephrocalcinosis, MIM#308990 False 3 100;0;0 1.2304 True ENSG00000171365 ENSG00000171365 HGNC:2023 CLCN6 gene CLCN6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration, childhood-onset, hypotonia, respiratory insufficiency and brain imaging abnormalities, MIM# 619173;Neurodegeneration;Benign partial epilepsy;febrile seizures;NCL 25794116;21107136;33217309 False 3 100;0;0 1.2304 True ENSG00000011021 ENSG00000011021 HGNC:2024 CLCN7 gene CLCN7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hypopigmentation, organomegaly, and delayed myelination and development, MIM# 618541;Osteopetrosis, autosomal recessive 4, MIM# 611490 31155284 False 3 100;0;0 1.2304 True ENSG00000103249 ENSG00000103249 HGNC:2025 CLCNKB gene CLCNKB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bartter syndrome, type 3, MIM# 607364;Bartter syndrome, type 4b, digenic, MIM# 613090 9326936;15044642;18310267 False 3 100;0;0 1.2304 True ENSG00000184908 ENSG00000184908 HGNC:2027 CLDN1 gene CLDN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ichthyosis, leukocyte vacuoles, alopecia, and sclerosing cholangitis MIM#607626 12164927;11889141;29146216 False 3 100;0;0 1.2304 True ENSG00000163347 ENSG00000163347 HGNC:2032 CLDN10 gene CLDN10 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal HELIX syndrome MIM#617671;hypohidrosis, electrolyte imbalance, lacrimal gland dysfunction, ichthyosis, and xerostomia (HELIX) False 3 100;0;0 1.2304 True ENSG00000134873 ENSG00000134873 HGNC:2033 CLDN11 gene CLDN11 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypomyelinating leukodystrophy-22, MIM#619328 33313762 False 3 100;0;0 1.2304 True ENSG00000013297 ENSG00000013297 HGNC:8514 CLDN14 gene CLDN14 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 29, MIM# 614035 11163249;20811388;22246673;23235333;27870113;27838790;12913076 False 3 100;0;0 1.2304 True ENSG00000159261 ENSG00000159261 HGNC:2035 CLDN16 gene CLDN16 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypomagnesemia 3, renal MIM#248250;amelogenesis imperfecta MONDO#0019507, CLDN16-related 26426912;16501001;10878661;32869508 False 3 100;0;0 1.2304 True ENSG00000113946 ENSG00000113946 HGNC:2037 CLDN19 gene CLDN19 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypomagnesaemia 5, renal, with ocular involvement, MIM#248190 17033971;22422540;27530400 False 3 100;0;0 1.2304 True ENSG00000164007 ENSG00000164007 HGNC:2040 CLDN5 gene CLDN5 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Syndromic disorder, MONDO:0002254, CLDN5-related 35714222;36477332 False 3 50;50;0 1.2304 True ENSG00000184113 ENSG00000184113 HGNC:2047 CLDN9 gene CLDN9 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 116, MIM#619093 31175426;19696885;34265170 False 3 50;50;0 1.2304 True ENSG00000213937 ENSG00000213937 HGNC:2051 CLEC3B gene CLEC3B Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Macular dystrophy, retinal, 4, OMIM #619977 PMID: 35331648 False 3 100;0;0 1.2304 True ENSG00000163815 ENSG00000163815 HGNC:11891 CLMP gene CLMP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital short bowel syndrome , MIM#615237 22155368 False 3 100;0;0 1.2304 True ENSG00000166250 ENSG00000166250 HGNC:24039 CLN3 gene CLN3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 3, MIM# 204200;MONDO:0008767 7553855 False 3 100;0;0 1.2304 True ENSG00000188603 ENSG00000188603 HGNC:2074 CLN5 gene CLN5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 5, MIM# 256731;MONDO:0009745 20157158 False 3 100;0;0 1.2304 True ENSG00000102805 ENSG00000102805 HGNC:2076 CLN6 gene CLN6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 6, MIM# 601780;Ceroid lipofuscinosis, neuronal, Kufs type, adult onset, MIM# 204300 11791207;11727201;21549341;30561534 False 3 100;0;0 1.2304 True ENSG00000128973 ENSG00000128973 HGNC:2077 CLN8 gene CLN8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 8, MIM# 600143;Ceroid lipofuscinosis, neuronal, 8, Northern epilepsy variant, MIM# 610003 10508524;15024724;16570191 False 3 100;0;0 1.2304 True ENSG00000182372 ENSG00000182372 HGNC:2079 CLP1 gene CLP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia type 10, MIM# 615803 24766809;29307788 False 3 100;0;0 1.2304 True ENSG00000172409 ENSG00000172409 HGNC:16999 CLPB gene CLPB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal 3-methylglutaconic aciduria, type VII, with cataracts, neurologic involvement and neutropaenia, MIM# 616271;3-methylglutaconic aciduria, type VIIA, autosomal dominant, MIM# 619835;Neutropenia, severe congenital, 9, autosomal dominant, MIM# 619813 25597510;34140661 False 3 100;0;0 1.2304 True ENSG00000162129 ENSG00000162129 HGNC:30664 CLPP gene CLPP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Perrault syndrome 3, MIM# 614129 23541340;27087618;27899912;25254289 False 3 100;0;0 1.2304 True ENSG00000125656 ENSG00000125656 HGNC:2084 CLRN1 gene CLRN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Usher syndrome, type 3A, MIM# 276902 11524702;24596593;22135276;21675857;19753315;27110679;26943149;22787034 False 3 100;0;0 1.2304 True ENSG00000163646 ENSG00000163646 HGNC:12605 CLTC gene CLTC Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 56, MIM# 617854 29100083;26822784 False 3 100;0;0 1.2304 True ENSG00000141367 ENSG00000141367 HGNC:2092 CNGA1 gene CNGA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Retinitis pigmentosa 49 MIM#613756 33633220;32705276;30652268;20301590;7479749 False 3 100;0;0 1.2304 True ENSG00000198515 ENSG00000198515 HGNC:2148 CNGA3 gene CNGA3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Achromatopsia 2, MIM# 216900 9662398;11536077;17265047 False 3 100;0;0 1.2304 True ENSG00000144191 ENSG00000144191 HGNC:2150 CNGB1 gene CNGB1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Retinitis pigmentosa 45 MIM#613767 11379879;15557452;23661369;33847019 False 3 100;0;0 1.2304 True ENSG00000070729 ENSG00000070729 HGNC:2151 CNGB3 gene CNGB3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Achromatopsia 3, MIM# 262300 17265047 False 3 100;0;0 1.2304 True ENSG00000170289 ENSG00000170289 HGNC:2153 CNKSR2 gene CNKSR2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Intellectual developmental disorder, X-linked, syndromic, Houge type, MIM# 301008 34266427 False 3 100;0;0 1.2304 True ENSG00000149970 ENSG00000149970 HGNC:19701 CNNM2 gene CNNM2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Hypomagnesemia 6, renal MIM#613882;Hypomagnesemia, seizures, and mental retardation MIM#616418 34604137;35170241 False 3 100;0;0 1.2304 True ENSG00000148842 ENSG00000148842 HGNC:103 CNNM4 gene CNNM4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal "Jalili syndrome 217080;amelogenesis imperfecta, cone-rod dystrophy" 30705057 False 3 100;0;0 1.2304 True ENSG00000158158 ENSG00000158158 HGNC:105 CNOT1 gene CNOT1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Vissers-Bodmer syndrome, MIM#619033;Holoprosencephaly 12, with or without pancreatic agenesis;OMIM# 618500 31006513;21679367;31006513;32553196 False 3 75;25;0 1.2304 True ENSG00000125107 ENSG00000125107 HGNC:7877 CNOT2 gene CNOT2 Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Intellectual developmental disorder with nasal speech, dysmorphic facies, and variable skeletal anomalies 618608" 31512373;31145527;28135719 False 3 100;0;0 1.2304 True ENSG00000111596 ENSG00000111596 HGNC:7878 CNOT3 gene CNOT3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder with speech delay, autism, and dysmorphic facies, MIM# 618672 31201375 False 3 100;0;0 1.2304 True ENSG00000088038 ENSG00000088038 HGNC:7879 CNOT9 gene CNOT9 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted neurodevelopmental disorder, MONDO:0700092 PMID: 37092538 False 3 100;0;0 1.2304 True ENSG00000144580 ENSG00000144580 HGNC:10445 CNPY3 gene CNPY3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Epileptic encephalopathy, early infantile, 60 (MIM 617929) 29394991;30237576 False 3 100;0;0 1.2304 True ENSG00000137161 ENSG00000137161 HGNC:11968 CNTN1 gene CNTN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Compton-North congenital myopathy MONDO:0012929;fetal akinesia deformation sequence MONDO:0008824 19026398;10595523;22242131;32779773 False 3 50;50;0 1.2304 True ENSG00000018236 ENSG00000018236 HGNC:2171 CNTN2 gene CNTN2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Epilepsy, MONDO:0015653, CNTN2-related 23518707;34120799;34691156;37359369 False 3 50;50;0 1.2304 True ENSG00000184144 ENSG00000184144 HGNC:2172 CNTNAP1 gene CNTNAP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypomyelinating neuropathy, congenital, 3, MIM#618186;Lethal congenital contracture syndrome 7, MIM# 616286 28374019;29511323;27668699 False 3 100;0;0 1.2304 True ENSG00000108797 ENSG00000108797 HGNC:8011 CNTNAP2 gene CNTNAP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cortical dysplasia-focal epilepsy syndrome, MIM# 610042 16571880;19896112;27439707 False 3 100;0;0 1.2304 True ENSG00000174469 ENSG00000174469 HGNC:13830 COA6 gene COA6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 13, MIM# 616501;Cardioencephalomyopathy, fatal infantile, MONDO:0014668 24549041;25339201;31851937;26160915 False 3 100;0;0 1.2304 True ENSG00000168275 ENSG00000168275 HGNC:18025 COA7 gene COA7 Expert list;Expert Review Green;Royal Melbourne Hospital Mendeliome BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 3, MIM#618387 29718187;27683825 False 3 100;0;0 1.2304 True ENSG00000162377 ENSG00000162377 HGNC:25716 COASY gene COASY Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodegeneration with brain iron accumulation 6 MIM#615643;Pontocerebellar hypoplasia, type 12 MIM#v618266 30089828;28489334;24360804;35499143 False 3 100;0;0 1.2304 True ENSG00000068120 ENSG00000068120 HGNC:29932 COCH gene COCH Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Deafness, autosomal dominant 9, MIM# 601369;Deafness, autosomal recessive 110, MIM# 618094 16151338;28116169;28099493;9806553;17561763;21046548;26256111;22931125;22610276;18312449;28733840;18697796;29449721;32939038;32562050 False 3 100;0;0 1.2304 True ENSG00000100473 ENSG00000100473 HGNC:2180 COG1 gene COG1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IIg, MIM# 611209 16537452;19008299;17904886;11980916 False 3 100;0;0 1.2304 True ENSG00000166685 ENSG00000166685 HGNC:6545 COG4 gene COG4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Saul-Wilson syndrome, OMIM #618150;Congenital disorder of glycosylation, type IIj, OMIM #613489 31949312;30290151;19494034;21185756 False 3 100;0;0 1.2304 True ENSG00000103051 ENSG00000103051 HGNC:18620 COG5 gene COG5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IIi, MIM# 613612 23228021;31572517;32174980 False 3 100;0;0 1.2304 True ENSG00000164597 ENSG00000164597 HGNC:14857 COG6 gene COG6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IIl, MIM# 614576 20605848;23430903;26260076;32905044;32683677;31420886 False 3 100;0;0 1.2304 True ENSG00000133103 ENSG00000133103 HGNC:18621 COG7 gene COG7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IIe , MIM#608779 15107842;17356545;28883096 False 3 100;0;0 1.2304 True ENSG00000168434 ENSG00000168434 HGNC:18622 COG8 gene COG8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IIh, MIM# 611182 17220172;28619360;30690882;17331980 False 3 100;0;0 1.2304 True ENSG00000213380 ENSG00000213380 HGNC:18623 COL10A1 gene COL10A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Metaphyseal chondrodysplasia, Schmid type, MIM#156500 15880705;31633898 False 3 100;0;0 1.2304 True ENSG00000123500 ENSG00000123500 HGNC:2185 COL11A1 gene COL11A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Fibrochondrogenesis 1 (MIM#228520);Marshall syndrome (MIM#154780);Stickler syndrome, type II (MIM#604841) 25073711;30245514;32427345;27081569;21035103 False 3 100;0;0 1.2304 True Other ENSG00000060718 ENSG00000060718 HGNC:2186 COL11A2 gene COL11A2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Stickler syndrome type 3;Deafness, autosomal dominant 13 MIM#601868;Deafness, autosomal recessive 53 MIM#609706;Fibrochondrogenesis 2 MIM#614524;Otospondylomegaepiphyseal dysplasia, autosomal dominant MIM#184840;Otospondylomegaepiphyseal dysplasia, autosomal recessive MIM#215150 10581026;25633957;16033917;25240749;22796475;20112039 False 3 100;0;0 1.2304 True ENSG00000204248 ENSG00000204248 HGNC:2187 COL12A1 gene COL12A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Myopathic EDS;Bethlem myopathy 2 MIM#616471;Ullrich congenital muscular dystrophy 2 MIM#616470 28306229;31273343;24334604 False 3 100;0;0 1.2304 True ENSG00000111799 ENSG00000111799 HGNC:2188 COL13A1 gene COL13A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 19 (OMIM #616720) 31081514;28369367;20844119 False 3 100;0;0 1.2304 True ENSG00000197467 ENSG00000197467 HGNC:2190 COL17A1 gene COL17A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Epidermolysis bullosa, junctional 4, intermediate MIM#619787;Epithelial recurrent erosion dystrophy MIM#122400;Amelogenesis imperfecta MONDO:0019507, COL17A1-related 27309958;29708937;25676728;20301304;37979963 False 3 100;0;0 1.2304 True ENSG00000065618 ENSG00000065618 HGNC:2194 COL18A1 gene COL18A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Knobloch syndrome, type 1, MIM# 267750 27259167;25456301 False 3 100;0;0 1.2304 True ENSG00000182871 ENSG00000182871 HGNC:2195 COL1A1 gene COL1A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Caffey disease MIM#114000;Combined osteogenesis imperfecta and Ehlers-Danlos syndrome 1 MIM#619115;Ehlers-Danlos syndrome, arthrochalasia type, 1 MIM#130060;Osteogenesis imperfecta, type I MIM#166200;Osteogenesis imperfecta, type II MIM#166210;Osteogenesis imperfecta, type III MIM#259420;Osteogenesis imperfecta, type IV MIM#166220 20301422;20301667;30071989;28981071;12362985;28956891 False 3 100;0;0 1.2304 True ENSG00000108821 ENSG00000108821 HGNC:2197 COL1A2 gene COL1A2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Combined osteogenesis imperfecta and Ehlers-Danlos syndrome 2, MIM# 619120;Ehlers-Danlos syndrome, arthrochalasia type, 2, MIM# 617821;Ehlers-Danlos syndrome, cardiac valvular type, MIM# 225320;Osteogenesis imperfecta, type II, MIM# 166210;Osteogenesis imperfecta, type III, MIM# 259420;Osteogenesis imperfecta, type IV, MIM# 166220 28306229;32091183;2993307;30821104 False 3 100;0;0 1.2304 True ENSG00000164692 ENSG00000164692 HGNC:2198 COL25A1 gene COL25A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Fibrosis of extraocular muscles, congenital, 5, MIM# 616219;arthrogryposis multiplex congenita MONDO:0015168 25500261;26486031;31875546;26437029;35077597 False 3 100;0;0 1.2304 True ENSG00000188517 ENSG00000188517 HGNC:18603 COL27A1 gene COL27A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Steel syndrome, MIM #615155 24986830;28276056;28322503;32360765;33963180 False 3 100;0;0 1.2304 True ENSG00000196739 ENSG00000196739 HGNC:22986 COL2A1 gene COL2A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Achondrogenesis, type II or hypochondrogenesis 200610;Avascular necrosis of the femoral head 608805;Czech dysplasia 609162;Epiphyseal dysplasia, multiple, with myopia and deafness 132450;Kniest dysplasia 156550;Legg-Calve-Perthes disease 150600;Osteoarthritis with mild chondrodysplasia 604864;Platyspondylic skeletal dysplasia, Torrance type 151210;SED congenita 183900;SMED Strudwick type 184250;Spondyloepiphyseal dysplasia, Stanescu type 616583;Spondyloperipheral dysplasia 271700;Stickler sydrome, type I, nonsyndromic ocular 609508;Stickler syndrome, type I 108300;Vitreoretinopathy with phalangeal epiphyseal dysplasia 15895462;17721977;27234559;20179744 False 3 100;0;0 1.2304 True ENSG00000139219 ENSG00000139219 HGNC:2200 COL4A1 gene COL4A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Angiopathy, hereditary, with nephropathy, aneurysms, and muscle cramps MIM#611773;Brain small vessel disease with or without ocular anomalies MIM#175780;Microangiopathy and leukoencephalopathy, pontine, autosomal dominant MIM#618564 24628545;25719457;21625620;23225343;23065703;20818663;20301768 False 3 100;0;0 1.2304 True ENSG00000187498 ENSG00000187498 HGNC:2202 COL4A2 gene COL4A2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Cerebral Palsy MONDO#0006497, COL4A2-related;Brain small vessel disease 2 MIM# 614483 33528536;33912663;22209246;30315939;22333902 False 3 100;0;0 1.2304 True ENSG00000134871 ENSG00000134871 HGNC:2203 COL4A3 gene COL4A3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Alport syndrome 2, autosomal recessive, MIM# 203780;Alport syndrome 3, autosomal dominant, MIM# 104200 False 3 100;0;0 1.2304 True ENSG00000169031 ENSG00000169031 HGNC:2204 COL4A3BP gene COL4A3BP Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder 34 (MIM#616351) 25533962;36976648 False 3 100;0;0 1.2304 True Other ENSG00000113163 ENSG00000113163 HGNC:2205 COL4A4 gene COL4A4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Alport syndrome 2, autosomal recessive MIM#203780;Hematuria, familial benign MIM#141200 20301386 False 3 100;0;0 1.2304 True ENSG00000081052 ENSG00000081052 HGNC:2206 COL4A5 gene COL4A5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Alport syndrome 1, X-linked, MIM# 301050 False 3 100;0;0 1.2304 True ENSG00000188153 ENSG00000188153 HGNC:2207 COL5A1 gene COL5A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ehlers-Danlos syndrome, classic type, 1, MIM# 130000;Fibromuscular dysplasia, multifocal, MIM# 619329 30071989;32938213 False 3 100;0;0 1.2304 True ENSG00000130635 ENSG00000130635 HGNC:2209 COL5A2 gene COL5A2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ehlers-Danlos syndrome, classic type, 2 MIM#130010 20301422 False 3 100;0;0 1.2304 True ENSG00000204262 ENSG00000204262 HGNC:2210 COL6A1 gene COL6A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Bethlem myopathy MIM#158810;Ullrich congenital muscular dystrophy MIM#254090 20301676;25535305;15955946;23738969;29277723;24443028 False 3 100;0;0 1.2304 True ENSG00000142156 ENSG00000142156 HGNC:2211 COL6A2 gene COL6A2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Bethlem myopathy 1 MIM#158810;Ullrich congenital muscular dystrophy 1 MIM#254090 20301676 False 3 100;0;0 1.2304 True ENSG00000142173 ENSG00000142173 HGNC:2212 COL6A3 gene COL6A3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Bethlem myopathy 1 MIM#158810;Dystonia 27 MIM#616411;Ullrich congenital muscular dystrophy 1 MIM#254090 20301676;26004199;32037012;26872670;32037012 False 3 100;0;0 1.2304 True ENSG00000163359 ENSG00000163359 HGNC:2213 COL7A1 gene COL7A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal EBD inversa, MIM# 226600;EBD, Bart type MIM# 132000;EBD, localisata variant;Epidermolysis bullosa dystrophica, MIM# 131750;Epidermolysis bullosa dystrophica, 226600;Epidermolysis bullosa pruriginosa 604129;Epidermolysis bullosa, pretibial, MIM# 131850;Transient bullous of the newborn 131705 False 3 100;0;0 1.2304 True ENSG00000114270 ENSG00000114270 HGNC:2214 COL8A2 gene COL8A2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Corneal dystrophy, Fuchs endothelial, 1, MIM# 136800;Corneal dystrophy, posterior polymorphous 2, MIM# 609140 11689488;15914606;18024822;18464802 False 3 100;0;0 1.2304 True ENSG00000171812 ENSG00000171812 HGNC:2216 COL9A1 gene COL9A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Stickler syndrome, type IV, MIM# 614134 16909383;21421862;31090205 False 3 100;0;0 1.2304 True ENSG00000112280 ENSG00000112280 HGNC:2217 COL9A2 gene COL9A2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Stickler syndrome, type V MIM#614284' Epiphyseal dysplasia, multiple, 2 MIM#600204 21671392;31090205;33356723;10364514;15633184;20358595;8528240 False 3 100;0;0 1.2304 True ENSG00000049089 ENSG00000049089 HGNC:2218 COL9A3 gene COL9A3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Epiphyseal dysplasia, multiple, 3, with or without myopathy, MIM# 600969;Stickler syndrome, type VI, MIM# 620022;Deafness AD;Peripheral vitreoretinal degeneration and retinal detachment, AD 33633367;30450842;31090205;24273071;10090888;15551337;33078831;15917166 False 3 100;0;0 1.2304 True ENSG00000092758 ENSG00000092758 HGNC:2219 COLEC10 gene COLEC10 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal 3MC syndrome 3, MONDO:0009554;3MC syndrome 3, OMIM:248340 28301481;34740859 False 3 100;0;0 1.2304 True ENSG00000184374 ENSG00000184374 HGNC:2220 COLEC11 gene COLEC11 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal 3MC syndrome 2, MIM# 265050 21258343;26789649;28301481 False 3 100;0;0 1.2304 True ENSG00000118004 ENSG00000118004 HGNC:17213 COLGALT1 gene COLGALT1 Expert Review Green;Other Mendeliome BIALLELIC, autosomal or pseudoautosomal Brain small vessel disease 3 MIM#618360 30412317;33709034;31759980 False 3 100;0;0 1.2304 True ENSG00000130309 ENSG00000130309 HGNC:26182 COLQ gene COLQ Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 5, MIM# 603034 9689136;9758617;11865139;32978031;31831253 False 3 100;0;0 1.2304 True ENSG00000206561 ENSG00000206561 HGNC:2226 COMP gene COMP Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epiphyseal dysplasia, multiple, 1 MIM#132400;Pseudoachondroplasia MIM#177170 20301302;20301660 False 3 100;0;0 1.2304 True ENSG00000105664 ENSG00000105664 HGNC:2227 COPA gene COPA Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Autoimmune interstitial lung, joint, and kidney disease, MIM 616414 31455335;30804679 False 3 100;0;0 1.2304 True ENSG00000122218 ENSG00000122218 HGNC:2230 COPB2 gene COPB2 Expert list;Expert Review Green Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Microcephaly 19, primary, autosomal recessive, MIM# 617800;Osteoporosis, childhood- or juvenile-onset, with developmental delay, MIM# 619884" 29036432;34450031 False 3 50;0;50 1.2304 True ENSG00000184432 ENSG00000184432 HGNC:2232 COQ2 gene COQ2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 1, MIM# 607426;MONDO:0011829 16400613;17332895;17855635 False 3 100;0;0 1.2304 True ENSG00000173085 ENSG00000173085 HGNC:25223 COQ4 gene COQ4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 7, MIM# 616276;Spastic ataxia 10, autosomal recessive, MIM# 620666 25658047;26185144;33704555;36047608;38014483;38013626 False 3 100;0;0 1.2304 True ENSG00000167113 ENSG00000167113 HGNC:19693 COQ6 gene COQ6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 6 MIM#614650 28125198 False 3 100;0;0 1.2304 True ENSG00000119723 ENSG00000119723 HGNC:20233 COQ7 gene COQ7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 8 MIM#616733;Neuronopathy, distal hereditary motor, autosomal recessive 9, MIM# 620402 26084283;31240163;33215859;28409910;36758993;36759155 False 3 100;0;0 1.2304 True ENSG00000167186 ENSG00000167186 HGNC:2244 COQ8A gene COQ8A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 4 MIM#612016 32337771 False 3 100;0;0 1.2304 True ENSG00000163050 ENSG00000163050 HGNC:16812 COQ8B gene COQ8B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Nephrotic syndrome, type 9 MIM#615573;Retinitis pigmentosa MONDO:0019200 24270420;39226897;25967120 False 3 100;0;0 1.2304 True ENSG00000123815 ENSG00000123815 HGNC:19041 COQ9 gene COQ9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 5, MIM#614654 19375058;26081641;23255162;31821167 False 3 100;0;0 1.2304 True ENSG00000088682 ENSG00000088682 HGNC:25302 CORO1A gene CORO1A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 8, MIM# 615401 25073507;2352248;18836449 False 3 100;0;0 1.2304 True ENSG00000102879 ENSG00000102879 HGNC:2252 COX10 gene COX10 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 3, MIM# 619046 10767350;12928484;15455402;27290639 False 3 100;0;0 1.2304 True ENSG00000006695 ENSG00000006695 HGNC:2260 COX11 gene COX11 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial disease (MONDO:0044970), COX11-related 36030551 False 3 100;0;0 1.2304 True ENSG00000166260 ENSG00000166260 HGNC:2261 COX15 gene COX15 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 6, MIM# 615119 33746038;32232962;26959537;21412973;12474143;15235026 False 3 100;0;0 1.2304 True ENSG00000014919 ENSG00000014919 HGNC:2263 COX20 gene COX20 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 11, MIM#619054 24202787;31079202;30656193;23125284;32606554 False 3 100;0;0 1.2304 True ENSG00000203667 ENSG00000203667 HGNC:26970 COX6A1 gene COX6A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Charcot Marie Tooth disease, recessive intermediate D, MIM# 616039;MONDO:0014467 25152455;26302975;25152455 False 3 100;0;0 1.2304 True ENSG00000111775 ENSG00000111775 HGNC:2277 COX6A2 gene COX6A2 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 18, MIM#619062 31155743;23460811 False 3 100;0;0 1.2304 True ENSG00000156885 ENSG00000156885 HGNC:2279 COX6B1 gene COX6B1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 7, MIM# 619051 18499082;24781756 False 3 100;0;0 1.2304 True ENSG00000126267 ENSG00000126267 HGNC:2280 COX7B gene COX7B Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Linear skin defects with multiple congenital anomalies 2, MIM#300887 23122588 False 3 100;0;0 1.2304 True ENSG00000131174 ENSG00000131174 HGNC:2291 CP gene CP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Aceruloplasminaemia, MIM#604290 False 3 100;0;0 1.2304 True ENSG00000047457 ENSG00000047457 HGNC:2295 CPA1 gene CPA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary pancreatitis, MONDO:0008185, CPA1-related 23955596;28497564;28258133;31005883 False 3 100;0;0 1.2304 True ENSG00000091704 ENSG00000091704 HGNC:2296 CPAMD8 gene CPAMD8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Anterior segment dysgenesis 8, MIM# 617319 32274568 False 3 100;0;0 1.2304 True ENSG00000160111 ENSG00000160111 HGNC:23228 CPE gene CPE Expert Review;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Intellectual developmental disorder and hypogonadotropic hypogonadism, MIM# 619326 26120850;32936766;34383079 False 3 50;50;0 1.2304 True ENSG00000109472 ENSG00000109472 HGNC:2303 CPLX1 gene CPLX1 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Epileptic encephalopathy, early infantile, 63, MIM# 617976" 26539891;28422131 False 3 100;0;0 1.2304 True ENSG00000168993 ENSG00000168993 HGNC:2309 CPOX gene CPOX Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Coproporphyria, MIM#121300;Harderoporphyria, MIM#121300 30828546;28349448;23582006;24156084 False 3 100;0;0 1.2304 True ENSG00000080819 ENSG00000080819 HGNC:2321 CPS1 gene CPS1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Carbamoylphosphate synthetase I deficiency MIM#237300 31268178;8486760;17310273;21120950 False 3 50;0;50 1.2304 True ENSG00000021826 ENSG00000021826 HGNC:2323 CPSF1 gene CPSF1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myopia 27, 618827;high myopia;early-onset high myopia 30689892 False 3 100;0;0 1.2304 True ENSG00000071894 ENSG00000071894 HGNC:2324 CPSF3 gene CPSF3 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly, hypotonia, and seizures (NEDMHS), MIM#619876 35121750 False 3 100;0;0 1.2304 True ENSG00000119203 ENSG00000119203 HGNC:2326 CPT1A gene CPT1A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal CPT deficiency, hepatic, type IA, MIM# 255120 12189492;25778941;23430932 False 3 100;0;0 1.2304 True ENSG00000110090 ENSG00000110090 HGNC:2328 CPT1C gene CPT1C Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 73, autosomal dominant MIM#616282;MONDO:0014568 25751282;23973755;30564185 False 3 100;0;0 1.2304 True ENSG00000169169 ENSG00000169169 HGNC:18540 CPT2 gene CPT2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal CPT II deficiency, infantile 600649;CPT II deficiency, lethal neonatal 608836;CPT II deficiency, myopathic, stress-induced 255110 11477613;12410208;8651281;12410208;8358442 False 3 100;0;0 1.2304 True ENSG00000157184 ENSG00000157184 HGNC:2330 CR2 gene CR2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency, common variable, 7, MIM# 614699 22035880;26325596;28499783 False 3 100;0;0 1.2304 True ENSG00000117322 ENSG00000117322 HGNC:2336 CRADD gene CRADD Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mental retardation, autosomal recessive 34, with variant lissencephaly, MIM# 614499 27773430 False 3 100;0;0 1.2304 True ENSG00000169372 ENSG00000169372 HGNC:2340 CRB1 gene CRB1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Leber congenital amaurosis 8 MIM#613835;Pigmented paravenous chorioretinal atrophy MIM#172870;Retinitis pigmentosa-12 MIM#600105 30285347;32922261;31884620;15459956 False 3 100;0;0 1.2304 True ENSG00000134376 ENSG00000134376 HGNC:2343 CRB2 gene CRB2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ventriculomegaly with cystic kidney disease, MIM# 219730;Focal segmental glomerulosclerosis 9, MIM# 616220 25557780;33687977;32051522;30212996;33575434;31438467;30593785;25557779 False 3 100;0;0 1.2304 True ENSG00000148204 ENSG00000148204 HGNC:18688 CREB3L1 gene CREB3L1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Osteogenesis imperfecta, type XVI, MIM#616229 24079343;28817112;29936144;30657919 False 3 100;0;0 1.2304 True ENSG00000157613 ENSG00000157613 HGNC:18856 CREBBP gene CREBBP Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Rubinstein-Taybi syndrome 1, MIM# 180849;Menke-Hennekam syndrome 1, MIM# 618332 10699051;17855048;27311832;29460469 False 3 100;0;0 1.2304 True ENSG00000005339 ENSG00000005339 HGNC:2348 CRELD1 gene CRELD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Jeffries-Lakhani neurodevelopmental syndrome, MIM# 620771;Atrioventricular septal defect, partial, with heterotaxy syndrome, MIM# 606217 22740159;37947183 False 3 67;0;33 1.2304 True ENSG00000163703 ENSG00000163703 HGNC:14630 CRIPT gene CRIPT Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Short stature with microcephaly and distinctive facies (MIM#615789);Rothmund-Thomson syndrome MONDO:0010002 24389050;27250922 False 3 67;33;0 1.2304 True ENSG00000119878 ENSG00000119878 HGNC:14312 CRLF1 gene CRLF1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cold-induced sweating syndrome 1, MIM#272430 12509788;17436251;17436252 False 3 100;0;0 1.2304 True ENSG00000006016 ENSG00000006016 HGNC:2364 CRLS1 gene CRLS1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 57, MIM# 620167 35147173 False 3 100;0;0 1.2304 True ENSG00000088766 ENSG00000088766 HGNC:16148 CRNKL1 gene CRNKL1 Expert Review Green;Other Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted complex neurodevelopmental disorder MONDO:0100038 False 3 100;0;0 1.2304 True ENSG00000101343 ENSG00000101343 HGNC:15762 CRTAP gene CRTAP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Osteogenesis imperfecta, type VII MIM#610682 21955071;19846465;17192541 False 3 100;0;0 1.2304 True ENSG00000170275 ENSG00000170275 HGNC:2379 CRX gene CRX Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Leber congenital amaurosis 7, MIM# 613829;Cone-rod retinal dystrophy-2 MIM#120970 12208271;9931337;9537410;29568065;27427859;25270190;32927963;33910785 False 3 100;0;0 1.2304 True ENSG00000105392 ENSG00000105392 HGNC:2383 CRY1 gene CRY1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Attention deficit/hyperactivity disorder (ADHD);Delayed sleep phase disorder (DSPD), PMID: 28388406;PMID: 32538895 False 3 100;0;0 1.2304 True ENSG00000008405 ENSG00000008405 HGNC:2384 CRYAA gene CRYAA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Cataract 9, multiple types, MIM# 604219 9467006;11006246;16735993;17724170;23255486 False 3 100;0;0 1.2304 True ENSG00000160202 ENSG00000160202 HGNC:2388 CRYAB gene CRYAB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Cataract 16, multiple types MIM#613763 AD, AR;Myopathy, myofibrillar, 2 MIM#608810 AD;Myopathy, myofibrillar, fatal infantile hypertonic, alpha-B crystallin-related MIM#613869 AR 31215171;21337604;21130652;32420686;33272090 False 3 100;0;0 1.2304 True ENSG00000109846 ENSG00000109846 HGNC:2389 CRYBA1 gene CRYBA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cataract 10, multiple types, MIM# 600881 9788845;14598164;34419537;33827296;31488069 False 3 100;0;0 1.2304 True ENSG00000108255 ENSG00000108255 HGNC:2394 CRYBA4 gene CRYBA4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cataract 23, MIM# 610425 16960806;16960806;20577656 False 3 100;0;0 1.2304 True ENSG00000196431 ENSG00000196431 HGNC:2396 CRYBB1 gene CRYBB1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Cataract 17, multiple types, MIM# 611544 12360425;16110300;17460281;21972112 False 3 100;0;0 1.2304 True ENSG00000100122 ENSG00000100122 HGNC:2397 CRYBB2 gene CRYBB2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cataract 3, multiple types, MIM# 601547 9158139;10634616;11424921;17234267 False 3 100;0;0 1.2304 True ENSG00000244752 ENSG00000244752 HGNC:2398 CRYBB3 gene CRYBB3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Cataract 22, MIM# 609741 15914629;23508780;34356085;33594837;33510601 False 3 100;0;0 1.2304 True ENSG00000100053 ENSG00000100053 HGNC:2400 CRYGC gene CRYGC Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cataract 2, multiple types, MIM# 604307 10521291;10914683;12011157;19204787;22052681 False 3 100;0;0 1.2304 True ENSG00000163254 ENSG00000163254 HGNC:2410 CRYGD gene CRYGD Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cataract 4, multiple types, MIM# 115700 9927684;10915766;12676897;17724170 False 3 100;0;0 1.2304 True ENSG00000118231 ENSG00000118231 HGNC:2411 CRYGS gene CRYGS Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cataract 20, multiple types MIM#116100 34014271;16141006;18587492;19262743 False 3 100;0;0 1.2304 True ENSG00000213139 ENSG00000213139 HGNC:2417 CRYM gene CRYM Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Deafness, autosomal dominant 40 MIM#616357 32742378;12471561;16740909;18448257;24676347;26915689 False 3 100;0;0 1.2304 True ENSG00000103316 ENSG00000103316 HGNC:2418 CSDE1 gene CSDE1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, CSDE1-related 31579823 False 3 100;0;0 1.2304 True ENSG00000009307 ENSG00000009307 HGNC:29905 CSF1R gene CSF1R Expert Review Green;Literature;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Brain abnormalities, neurodegeneration, and dysosteosclerosis, (MIM#618476);Leukoencephalopathy, diffuse hereditary, with spheroids, (MIM#221820) 24198292;25563800;25935893;31330095;24336230 False 3 100;0;0 1.2304 True Other ENSG00000182578 ENSG00000182578 HGNC:2433 CSF2RA gene CSF2RA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Surfactant metabolism dysfunction, pulmonary, 4, MIM# 300770 20622029;25425184;18955570 False 3 100;0;0 1.2304 True ENSG00000198223 ENSG00000198223 HGNC:2435 CSF2RB gene CSF2RB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Surfactant metabolism dysfunction, pulmonary, 5, MIM#614370 21205713;27514590;7568173;30846703 False 3 100;0;0 1.2304 True ENSG00000100368 ENSG00000100368 HGNC:2436 CSF3R gene CSF3R Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neutropaenia, severe congenital, 7, autosomal recessive, MIM# 617014 24753537;26324699;33511998;32966608 False 3 100;0;0 1.2304 True ENSG00000119535 ENSG00000119535 HGNC:2439 CSGALNACT1 gene CSGALNACT1 Expert Review;Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Skeletal dysplasia, mild, with joint laxity and advanced bone age, MIM# 618870 31705726;31325655 False 3 100;0;0 1.2304 True ENSG00000147408 ENSG00000147408 HGNC:24290 CSMD1 gene CSMD1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal complex neurodevelopmental disorder MONDO:0100038 PMID:38816421 False 3 100;0;0 1.2304 True ENSG00000183117 ENSG00000183117 HGNC:14026 CSNK1G1 gene CSNK1G1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, CSNK1G-related 33009664 False 3 50;50;0 1.2304 True ENSG00000169118 ENSG00000169118 HGNC:2454 CSNK2A1 gene CSNK2A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Okur-Chung neurodevelopmental syndrome, MIM# 617062 27048600;29240241;29383814 False 3 100;0;0 1.2304 True ENSG00000101266 ENSG00000101266 HGNC:2457 CSNK2B gene CSNK2B Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Poirier-Bienvenu neurodevelopmental syndrome , MIM#618732;Craniodigital syndrome-intellectual disability syndrome MONDO:0015463 28585349;28762608;35571680 False 3 100;0;0 1.2304 True ENSG00000204435 ENSG00000204435 HGNC:2460 CSPP1 gene CSPP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 21, MIM# 615636;MONDO:0014288 24360808;24360803;24360807;25997910 False 3 100;0;0 1.2304 True ENSG00000104218 ENSG00000104218 HGNC:26193 CSRP3 gene CSRP3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted hypertrophic cardiomyopathy12 MIM#612124;dilated cardiomyopathy 1M MIM#607482 18505755;30681346;12507422;14567970;19412328 False 3 100;0;0 1.2304 True ENSG00000129170 ENSG00000129170 HGNC:2472 CST3 gene CST3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cerebral amyloid angiopathy, MIM# 105150 3495457 False 3 50;50;0 1.2304 True ENSG00000101439 ENSG00000101439 HGNC:2475 CST6 gene CST6 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Ectodermal dysplasia 15, hypohidrotic/hair type MIM#618535 30425301;36371786 False 3 100;0;0 1.2304 True ENSG00000175315 ENSG00000175315 HGNC:2478 CSTA gene CSTA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Peeling skin syndrome 4 MIM#607936;exfoliative ichthyosis 21944047;23534700;25400170 False 3 100;0;0 1.2304 True ENSG00000121552 ENSG00000121552 HGNC:2481 CSTB gene CSTB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM# 254800;Keratolytic winter erythema (MIM#148370) 32920378;18028412;9012407;9054946;28457472 False 3 50;50;0 1.2304 True ENSG00000160213 ENSG00000160213 HGNC:2482 CTBP1 gene CTBP1 Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypotonia, ataxia, developmental delay, and tooth enamel defect syndrome, MIM#617915 27094857;28955726;31041561 False 3 100;0;0 1.2304 True ENSG00000159692 ENSG00000159692 HGNC:2494 CTC1 gene CTC1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cerebroretinal microangiopathy with calcifications and cysts, MIM# 612199 22267198;22387016 False 3 100;0;0 1.2304 True ENSG00000178971 ENSG00000178971 HGNC:26169 CTCF gene CTCF Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 21 (MIM#615502) 23746550;31239556 False 3 100;0;0 1.2304 True ENSG00000102974 ENSG00000102974 HGNC:13723 CTDP1 gene CTDP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital cataracts, facial dysmorphism, and neuropathy, MIM# 604168 14517542;24690360;25529582 False 3 100;0;0 1.2304 True ENSG00000060069 ENSG00000060069 HGNC:2498 CTLA4 gene CTLA4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Autoimmune lymphoproliferative syndrome, type V (MIM#616100), AD False 3 100;0;0 1.2304 True ENSG00000163599 ENSG00000163599 HGNC:2505 CTNNA1 gene CTNNA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Macular dystrophy, butterfly-shaped pigmentary, 2, MIM# 608970;Familial exudative vitreoretinopathy MONDO#0019516, CTNNA1-related 26691986;33497368 False 3 100;0;0 1.2304 True ENSG00000044115 ENSG00000044115 HGNC:2509 CTNNA2 gene CTNNA2 Australian Genomics Health Alliance Brain Malformations Flagship;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cortical dysplasia, complex, with other brain malformations 9, MIM#618174 30013181 False 3 100;0;0 1.2304 True ENSG00000066032 ENSG00000066032 HGNC:2510 CTNNB1 gene CTNNB1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Exudative vitreoretinopathy 7, MIM# 617572;Neurodevelopmental disorder with spastic diplegia and visual defects, MIM# 615075 25326669;29435196;27915094;30640974 False 3 100;0;0 1.2304 True Other ENSG00000168036 ENSG00000168036 HGNC:2514 CTNND1 gene CTNND1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Blepharocheilodontic syndrome 2, MIM# 617681" 28301459;32196547 False 3 100;0;0 1.2304 True ENSG00000198561 ENSG00000198561 HGNC:2515 CTNS gene CTNS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cystinosis, atypical nephropathic MIM#219800;Cystinosis, late-onset juvenile or adolescent nephropathic MIM#219900;Cystinosis, nephropathic MIM#219800;Cystinosis, ocular nonnephropathic MIM#219750 20301574;9537412;31068690 False 3 100;0;0 1.2304 True ENSG00000040531 ENSG00000040531 HGNC:2518 CTPS1 gene CTPS1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 24, MIM# 615897;Recurrent/chronic bacterial and viral infections (EBV, VZV);EBV lymphoproliferation;B-cell non-Hodgkin lymphoma 24870241 False 3 100;0;0 1.2304 True ENSG00000171793 ENSG00000171793 HGNC:2519 CTR9 gene CTR9 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder (MONDO:0700092), CTR9 related;Familial Wilms tumour, MONDO:0006058, CTR9-related PMID: 35499524;25099282;29292210 False 3 100;0;0 1.2304 True ENSG00000198730 ENSG00000198730 HGNC:16850 CTSA gene CTSA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Galactosialidosis, MIM# 256540;Cathepsin A-related arteriopathy with strokes and leukoencephalopathy 31177426 False 3 100;0;0 1.2304 True ENSG00000064601 ENSG00000064601 HGNC:9251 CTSC gene CTSC Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Haim-Munk syndrome MIM#245010;Papillon-Lefevre syndrome MIM#245000;Periodontitis 1, juvenile MIM#170650 11106356;32601924;10581027;14974080;10662808 False 3 100;0;0 1.2304 True ENSG00000109861 ENSG00000109861 HGNC:2528 CTSD gene CTSD Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 10, MIM# 610127;MONDO:0012414 16685649;16670177;25298308;33681191;29284168;27072142 False 3 100;0;0 1.2304 True ENSG00000117984 ENSG00000117984 HGNC:2529 CTSF gene CTSF Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 13, Kufs type, MIM# 615362 28749476;27668283;27524508 False 3 100;0;0 1.2304 True ENSG00000174080 ENSG00000174080 HGNC:2531 CTSK gene CTSK Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pycnodysostosis, MIM# 265800 False 3 100;0;0 1.2304 True ENSG00000143387 ENSG00000143387 HGNC:2536 CTU2 gene CTU2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephaly, facial dysmorphism, renal agenesis, and ambiguous genitalia syndrome, MIM#618142 27480277;26633546;31301155 False 3 100;0;0 1.2304 True ENSG00000174177 ENSG00000174177 HGNC:28005 CUBN gene CUBN Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Imerslund-Grasbeck syndrome 1 MIM#261100 AR;[Proteinuria, chronic benign] MIM#618884 31613795;21903995;31497480;10080186 False 3 100;0;0 1.2304 True ENSG00000107611 ENSG00000107611 HGNC:2548 CUL3 gene CUL3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Pseudohypoaldosteronism, type IIE 614496;Neurodevelopmental disorder with or without autism or seizures, MIM# 619239" 22495309;22914163;25363760;27824329;32341456;22266938 False 3 100;0;0 1.2304 True ENSG00000036257 ENSG00000036257 HGNC:2553 CUL4B gene CUL4B Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Intellectual developmental disorder, X-linked syndromic, Cabezas type, MIM#300354 17236139;19377476 False 3 100;0;0 1.2304 True ENSG00000158290 ENSG00000158290 HGNC:2555 CUL7 gene CUL7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal 3-M syndrome 1, MIM# 273750;Yakut short stature syndrome 16142236;19225462;17675530 False 3 100;0;0 1.2304 True ENSG00000044090 ENSG00000044090 HGNC:21024 CUX1 gene CUX1 Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Global developmental delay with or without impaired intellectual development, 618330 25059644;20510857;30014507 False 3 100;0;0 1.2304 True ENSG00000257923 ENSG00000257923 HGNC:2557 CUX2 gene CUX2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 67, MIM#618141 2963073;29795476 False 3 100;0;0 1.2304 True ENSG00000111249 ENSG00000111249 HGNC:19347 CWC27 gene CWC27 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Retinitis pigmentosa with or without skeletal anomalies, MIM# 250410 28285769;31481716 False 3 100;0;0 1.2304 True ENSG00000153015 ENSG00000153015 HGNC:10664 CWF19L1 gene CWF19L1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 17, MIM#616127;intellectual disability, developmental delay 25361784;15981765;26197978;27016154;30167849 False 3 100;0;0 1.2304 True ENSG00000095485 ENSG00000095485 HGNC:25613 CXCR2 gene CXCR2 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal WHIM syndrome 2, 619407 24777453 False 3 100;0;0 1.2304 True ENSG00000180871 ENSG00000180871 HGNC:6027 CXCR4 gene CXCR4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted WHIM syndrome, MIM# 193670 12692554 False 3 100;0;0 1.2304 True ENSG00000121966 ENSG00000121966 HGNC:2561 CXorf56 gene CXorf56 Expert list;Expert Review Green Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females "Mental retardation, X-linked 107, MIM# 301013" 29374277 False 3 100;0;0 1.2304 True ENSG00000018610 ENSG00000018610 HGNC:26239 CYB561 gene CYB561 Expert Review;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Orthostatic hypotension 2, MIM# 618182" 29343526;31822578 False 3 100;0;0 1.2304 True ENSG00000008283 ENSG00000008283 HGNC:2571 CYB5A gene CYB5A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Methemoglobinaemia and ambiguous genitalia, MIM# 250790 22170710;32051920 False 3 100;0;0 1.2304 True ENSG00000166347 ENSG00000166347 HGNC:2570 CYB5R3 gene CYB5R3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Methaemoglobinaemia, type I and II, MIM# 250800 2107882;1707593;12393396 False 3 100;0;0 1.2304 True ENSG00000100243 ENSG00000100243 HGNC:2873 CYBA gene CYBA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Chronic granulomatous disease 4, autosomal recessive, MIM# 233690;MONDO:0009308 2770793 False 3 100;0;0 1.2304 True ENSG00000051523 ENSG00000051523 HGNC:2577 CYBB gene CYBB Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Chronic granulomatous disease, X-linked, MIM# 306400 2556453;1710153;9585602 False 3 100;0;0 1.2304 True ENSG00000165168 ENSG00000165168 HGNC:2578 CYC1 gene CYC1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex III deficiency, nuclear type 6 MIM#615453 23910460;34252606 False 3 100;0;0 1.2304 True ENSG00000179091 ENSG00000179091 HGNC:2579 CYCS gene CYCS Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Thrombocytopenia 4, MIM# 612004 24326104;18345000;30051457 False 3 100;0;0 1.2304 True ENSG00000172115 ENSG00000172115 HGNC:19986 CYFIP2 gene CYFIP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 65, MIM#618008 29534297 False 3 100;0;0 1.2304 True ENSG00000055163 ENSG00000055163 HGNC:13760 CYHR1 gene CYHR1 Expert Review Green;Other Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092, ZTRAF1-related 38641995 False 3 50;50;0 1.2304 True ENSG00000187954 ENSG00000187954 HGNC:17806 CYLC1 gene CYLC1 Expert Review Green;Literature Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females "Spermatogenic failure, X-linked, 8, MIM# 301119" False 3 100;0;0 1.2304 True ENSG00000183035 ENSG00000183035 HGNC:2582 CYLD gene CYLD Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Brooke-Spiegler syndrome, 605041;Cylindromatosis, familial, 132700;Trichoepithelioma, multiple familial, 1, 601606;Frontotemporal dementia and/or amytrophic lateral sclerosis 8, MIM# 619132 10835629;16307661;12950348;19807742;32185393 False 3 50;50;0 1.2304 True ENSG00000083799 ENSG00000083799 HGNC:2584 CYP11A1 gene CYP11A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Adrenal insufficiency, congenital, with 46XY sex reversal, partial or complete, MIM# 613743 12161514;16705068;18182448;28425981 False 3 100;0;0 1.2304 True ENSG00000140459 ENSG00000140459 HGNC:2590 CYP11B1 gene CYP11B1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Adrenal hyperplasia, congenital, due to 11-beta-hydroxylase deficiency, MIM# 202010;Aldosteronism, glucocorticoid-remediable, MIM# 103900 8768848;1731223;29703198 False 3 100;0;0 1.2304 True ENSG00000160882 ENSG00000160882 HGNC:2591 CYP11B2 gene CYP11B2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypoaldosteronism, congenital, due to CMO I deficiency (MIM#203400) or due to CMO II deficiency (MIM#610600). 8439335;9360501;15240589;9814506;12788848;8772616 False 3 100;0;0 1.2304 True ENSG00000179142 ENSG00000179142 HGNC:2592 CYP17A1 gene CYP17A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal 17-alpha-hydroxylase/17,20-lyase deficiency, MIM# 202110 2843762;14671162;2026124 False 3 100;0;0 1.2304 True ENSG00000148795 ENSG00000148795 HGNC:2593 CYP19A1 gene CYP19A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Aromatase deficiency (MIM#613546), AR;Aromatase excess syndrome (MIM#139300), AD 17164303;25264451 False 3 100;0;0 1.2304 True ENSG00000137869 ENSG00000137869 HGNC:2594 CYP1B1 gene CYP1B1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Anterior segment dysgenesis 6, multiple subtypes, 617315;Glaucoma 3A, primary open angle, congenital, juvenile, or adult onset, 231300 21730847;27243976;9463332;10655546;12372064;21081970 False 3 100;0;0 1.2304 True ENSG00000138061 ENSG00000138061 HGNC:2597 CYP21A2 gene CYP21A2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Adrenal hyperplasia, congenital, due to 21-hydroxylase deficiency, 201910;Hyperandrogenism, nonclassic type, due to 21-hydroxylase deficiency, 201910 False 3 100;0;0 1.2304 True ENSG00000231852 ENSG00000231852 HGNC:2600 CYP24A1 gene CYP24A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypercalcaemia, infantile, 1, MIM# 143880;MONDO:0020739 21675912;22047572;33516786;33186763;32866123;32743688 False 3 100;0;0 1.2304 True ENSG00000019186 ENSG00000019186 HGNC:2602 CYP26B1 gene CYP26B1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Craniosynostosis with radiohumeral fusions and other skeletal and craniofacial anomalies, MIM# 614416 27410456;22019272 False 3 100;0;0 1.2304 True ENSG00000003137 ENSG00000003137 HGNC:20581 CYP26C1 gene CYP26C1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Focal facial dermal dysplasia 4 MIM#614974 29263414;23161670;16530710 False 3 100;0;0 1.2304 True ENSG00000187553 ENSG00000187553 HGNC:20577 CYP27A1 gene CYP27A1 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cerebrotendinous xanthomatosis MIM#213700;Disorders of bile acid biosynthesis 2019602 False 3 100;0;0 1.2304 True ENSG00000135929 ENSG00000135929 HGNC:2605 CYP27B1 gene CYP27B1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Vitamin D-dependent rickets, type I MIM#264700 9486994;9415400;12050193;27473561;34492747;33823104 False 3 100;0;0 1.2304 True ENSG00000111012 ENSG00000111012 HGNC:2606 CYP2R1 gene CYP2R1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Rickets due to defect in vitamin D 25-hydroxylation deficiency MIM#600081 15128933;28548312 False 3 100;0;0 1.2304 True ENSG00000186104 ENSG00000186104 HGNC:20580 CYP2U1 gene CYP2U1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 56, autosomal recessive, MIM#615030 23176821;32006740;29034544 False 3 100;0;0 1.2304 True ENSG00000155016 ENSG00000155016 HGNC:20582 CYP3A4 gene CYP3A4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Vitamin D-dependent rickets-3, MIM#619073 29461981 False 3 100;0;0 1.2304 True Other ENSG00000160868 ENSG00000160868 HGNC:2637 CYP4F22 gene CYP4F22 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ichthyosis, congenital, autosomal recessive 5, MIM# 604777 16436457 False 3 100;0;0 1.2304 True ENSG00000171954 ENSG00000171954 HGNC:26820 CYP4V2 gene CYP4V2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bietti crystalline corneoretinal dystrophy, MIM# 210370 15042513;22497028 False 3 100;0;0 1.2304 True ENSG00000145476 ENSG00000145476 HGNC:23198 CYP51A1 gene CYP51A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal congenital cataract-severe neonatal hepatopathy-global developmental delay syndrome MONDO#0033853 22935719;26622071;27878435;25148791 False 3 100;0;0 1.2304 True ENSG00000001630 ENSG00000001630 HGNC:2649 CYP7B1 gene CYP7B1 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bile acid synthesis defect, congenital, 3 MIM#613812;Spastic paraplegia 5A, autosomal recessive MIM#270800;Disorders of bile acid biosynthesis 9802883;18252231;31337596 False 3 100;0;0 1.2304 True ENSG00000172817 ENSG00000172817 HGNC:2652 D2HGDH gene D2HGDH Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal D-2-hydroxyglutaric aciduria MIM#600721 25778941;31349060;15609246;20020533 False 3 100;0;0 1.2304 True ENSG00000180902 ENSG00000180902 HGNC:28358 DAAM2 gene DAAM2 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Nephrotic syndrome, type 24, MIM# 619263;steroid-resistant nephrotic syndrome (SRNS);Androgen insensitivity syndrome, MONDO:0019154, DAAM2-related 33232676;36972684 False 3 100;0;0 1.2304 True ENSG00000146122 ENSG00000146122 HGNC:18143 DAG1 gene DAG1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 9;Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 9, 613818;Walker-Warburg syndrome and tectocerebellar dysgraphia 29337005;25503980;21388311;25934851;24052401;25503980 False 3 100;0;0 1.2304 True ENSG00000173402 ENSG00000173402 HGNC:2666 DAGLA gene DAGLA Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Neuroocular syndrome 2, paroxysmal type, MIM# 168885" 35737950 False 3 100;0;0 1.2304 True ENSG00000134780 ENSG00000134780 HGNC:1165 DAP3 gene DAP3 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial disease MONDO:0044970, DAP3-related 39701103 False 3 100;0;0 1.2304 True ENSG00000132676 ENSG00000132676 HGNC:2673 DARS gene DARS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypomyelination with brainstem and spinal cord involvement and leg spasticity, MIM# 615281 25527264;23643384 False 3 100;0;0 1.2304 True ENSG00000115866 ENSG00000115866 HGNC:2678 DARS2 gene DARS2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation, MIM# 611105 17384640;15002045;16788019 False 3 100;0;0 1.2304 True ENSG00000117593 ENSG00000117593 HGNC:25538 DAW1 gene DAW1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Primary ciliary dyskinesia, with or without heterotaxy, MIM#620570 36074124 False 3 100;0;0 1.2304 True ENSG00000123977 ENSG00000123977 HGNC:26383 DBH gene DBH Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Dopamine beta-hydroxylase deficiency, MIM#223360 11857564 False 3 100;0;0 1.2304 True ENSG00000123454 ENSG00000123454 HGNC:2689 DBR1 gene DBR1 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal {Encephalitis, acute, infection (viral)-induced, susceptibility to, 11}, MIM# 619441;Viral infections of the brainstem;Xerosis and growth failure with immune and pulmonary dysfunction syndrome, MIM# 620510 29474921 False 3 50;50;0 1.2304 True ENSG00000138231 ENSG00000138231 HGNC:15594 DBT gene DBT Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Maple syrup urine disease, type II (MIM#248600) 20570198 False 3 100;0;0 1.2304 True ENSG00000137992 ENSG00000137992 HGNC:2698 DCAF17 gene DCAF17 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Woodhouse-Sakati syndrome, MIM# 241080 19026396;20507343;35002959;34877714;34732557;34590781 False 3 100;0;0 1.2304 True ENSG00000115827 ENSG00000115827 HGNC:25784 DCC gene DCC Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mirror movements 1 and/or agenesis of the corpus callosum, OMIM #157600;Gaze palsy, familial horizontal, with progressive scoliosis, 2,OMIM # 617542 20431009;31697046;21242494;28250454;28250456;25763452;33141514 False 3 100;0;0 1.2304 True ENSG00000187323 ENSG00000187323 HGNC:2701 DCDC2 gene DCDC2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Nephronophthisis 19, MIM# 616217;Sclerosing cholangitis, neonatal, MIM# 617394 25557784;27319779;27469900;31821705 False 3 50;50;0 1.2304 True ENSG00000146038 ENSG00000146038 HGNC:18141 DCHS1 gene DCHS1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Van Maldergem syndrome 1, MIM# 601390 27262615;22473091;24056717;29046692 False 3 100;0;0 1.2304 True ENSG00000166341 ENSG00000166341 HGNC:13681 DCLRE1B gene DCLRE1B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal "Dyskeratosis congenita, autosomal recessive 8, MIM# 620133" 20479256;21647296;35007328 False 3 50;50;0 1.2304 True ENSG00000118655 ENSG00000118655 HGNC:17641 DCLRE1C gene DCLRE1C Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Severe combined immunodeficiency, Athabascan type MIM# 602450;Omenn syndrome, MIM# 603554 19953608;15699179;12055248;34220820 False 3 100;0;0 1.2304 True ENSG00000152457 ENSG00000152457 HGNC:17642 DCN gene DCN Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Corneal dystrophy, congenital stromal, MIM# 610048 15671264;16935612;21993463;24413633;26828927 False 3 100;0;0 1.2304 True ENSG00000011465 ENSG00000011465 HGNC:2705 DCPS gene DCPS Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Al-Raqad syndrome, MIM#616459 25701870;30289615;25712129 False 3 100;0;0 1.2304 True ENSG00000110063 ENSG00000110063 HGNC:29812 DCT gene DCT Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Oculocutaneous albinism, type VIII, MIM# 619165 33100333 False 3 100;0;0 1.2304 True ENSG00000080166 ENSG00000080166 HGNC:2709 DCTN1 gene DCTN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuronopathy, distal hereditary motor, type VIIB, MIM# 607641;MONDO:0011879;Perry syndrome, MIM# 168605 12627231;15326253;33443672;32023010;27573046 False 3 100;0;0 1.2304 True ENSG00000204843 ENSG00000204843 HGNC:2711 DCX gene DCX Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Lissencephaly, X-linked, MIM# 300067;Subcortical laminal heterotopia, X-linked 300067 10915612;9489699;12552055 False 3 100;0;0 1.2304 True ENSG00000077279 ENSG00000077279 HGNC:2714 DDB1 gene DDB1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "White-Kernohan syndrome, MIM# 619426;Syndromic intellectual disability" 33743206 False 3 100;0;0 1.2304 True ENSG00000167986 ENSG00000167986 HGNC:2717 DDB2 gene DDB2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Xeroderma pigmentosum, group E, DDB-negative subtype, MIM# 278740 33276309;32530099;32239545;32228487 False 3 100;0;0 1.2304 True ENSG00000134574 ENSG00000134574 HGNC:2718 DDC gene DDC Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Aromatic L-amino acid decarboxylase deficiency, MIM# 608643 20505134;30952622 False 3 100;0;0 1.2304 True ENSG00000132437 ENSG00000132437 HGNC:2719 DDHD1 gene DDHD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 28, autosomal recessive, 609340;MONDO:0012256 23176821 False 3 100;0;0 1.2304 True ENSG00000100523 ENSG00000100523 HGNC:19714 DDHD2 gene DDHD2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 54, autosomal recessive, MIM# 615033 23486545;24482476;23176823;31302745 False 3 100;0;0 1.2304 True ENSG00000085788 ENSG00000085788 HGNC:29106 DDR2 gene DDR2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spondylometaepiphyseal dysplasia, short limb-hand type, MIM#271665;Warburg-Cinotti syndrome, MIM# 618175 19110212;20223752;30449416 False 3 100;0;0 1.2304 True ENSG00000162733 ENSG00000162733 HGNC:2731 DDRGK1 gene DDRGK1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Spondyloepimetaphyseal dysplasia, Shohat type (MIM#602557) 28263186;35377455;35670300;36243336 False 3 100;0;0 1.2304 True ENSG00000198171 ENSG00000198171 HGNC:16110 DDX11 gene DDX11 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Warsaw breakage syndrome, MIM# 613398;MONDO:0013252 20137776;23033317;30216658 False 3 100;0;0 1.2304 True ENSG00000013573 ENSG00000013573 HGNC:2736 DDX17 gene DDX17 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder (MONDO#0700092), DDX17-related https://www.medrxiv.org/search/DDX17 False 3 100;0;0 1.2304 True ENSG00000100201 ENSG00000100201 HGNC:2740 DDX23 gene DDX23 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, DDX23-related 33057194;34050707 False 3 50;50;0 1.2304 True ENSG00000174243 ENSG00000174243 HGNC:17347 DDX3X gene DDX3X Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Intellectual developmental disorder, X-linked, syndrome, Snijders Blok type MIM# 300958 30266093;26235985;25533962;33528536;30936465;31274575;30817323 False 3 100;0;0 1.2304 True ENSG00000215301 ENSG00000215301 HGNC:2745 DDX53 gene DDX53 Expert Review Green;Literature Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females autism spectrum disorder MONDO:0005258 PMID: 39706195 False 3 100;0;0 1.2304 True ENSG00000184735 ENSG00000184735 HGNC:20083 DDX58 gene DDX58 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Singleton-Merten syndrome 2, MIM# 616298 25620203;30574673;33495304 False 3 100;0;0 1.2304 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000107201 ENSG00000107201 HGNC:19102 DDX59 gene DDX59 Expert Review;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Orofaciodigital syndrome V (MIM#174300) 29127725;23972372;28711741 False 3 100;0;0 1.2304 True ENSG00000118197 ENSG00000118197 HGNC:25360 DDX6 gene DDX6 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder with impaired language and dysmorphic facies, MIM#618653 31422817 False 3 100;0;0 1.2304 True ENSG00000110367 ENSG00000110367 HGNC:2747 DEAF1 gene DEAF1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodevelopmental disorder with hypotonia, impaired expressive language, and with or without seizures 617171;Vulto-van Silfout-de Vries syndrome 615828 30923367;24726472 False 3 100;0;0 1.2304 True Other ENSG00000177030 ENSG00000177030 HGNC:14677 DEF6 gene DEF6 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 87 and autoimmunity, MIM# 619573;Systemic autoimmunity 31308374;32562707 False 3 100;0;0 1.2304 True ENSG00000023892 ENSG00000023892 HGNC:2760 DEGS1 gene DEGS1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 18, MIM#618404 30620338;30620337 False 3 100;0;0 1.2304 True ENSG00000143753 ENSG00000143753 HGNC:13709 DENND5A gene DENND5A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Epileptic encephalopathy, early infantile, 49, MIM# 617281 27431290;27866705;32705489 False 3 100;0;0 1.2304 True ENSG00000184014 ENSG00000184014 HGNC:19344 DENND5B gene DENND5B Expert Review Green;Other Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with white matter anomalies, MONDO:0700092, DENND5B-related PMID: 38387458 False 3 100;0;0 1.2304 True ENSG00000170456 ENSG00000170456 HGNC:28338 DEPDC5 gene DEPDC5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Epilepsy, familial focal, with variable foci 1, MIM#604364;Developmental and epileptic encephalopathy 111, MIM# 620504" 31444548;23542697;23542701 False 3 100;0;0 1.2304 True ENSG00000100150 ENSG00000100150 HGNC:18423 DES gene DES Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Cardiomyopathy, dilated, 1I, MIM# 604765;Myopathy, myofibrillar, 1 , MIM#601419;Arrhythmogenic right ventricular cardiomyopathy 20718792;19879535;20423733;24200904;22395865;29212896;23168288;20829228;10430757;11728149;17325244;23300193;31514951;26724190;23349452;25557463;33947203 False 3 100;0;0 1.2304 True ENSG00000175084 ENSG00000175084 HGNC:2770 DFNA5 gene DFNA5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Deafness, autosomal dominant 5, MIM# 600994 9771715;14676472; 14559215;24933359;17868390;24506266;12853124;14736743;22848872 False 3 100;0;0 1.2304 True ENSG00000105928 ENSG00000105928 HGNC:2810 DFNB59 gene DFNB59 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 59, MIM# 610220 16804542;26166082;22617256;28964305;17373699;25631766;28209736 False 3 100;0;0 1.2304 True ENSG00000204311 ENSG00000204311 HGNC:29502 DGAT1 gene DGAT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Diarrhoea 7, protein-losing enteropathy type, MIM# 615863 33261563;32786057;31778854;28373485;29604290 False 3 100;0;0 1.2304 True ENSG00000185000 ENSG00000185000 HGNC:2843 DGKE gene DGKE Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Nephrotic syndrome, type 7, MIM# 615008 23274426;23542698 False 3 100;0;0 1.2304 True ENSG00000153933 ENSG00000153933 HGNC:2852 DGUOK gene DGUOK Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 3 (hepatocerebral type), MIM# 251880;Portal hypertension, noncirrhotic, 1, MIM# 617068;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 4, MIM# 617070 11687800;12874104;15887277;23043144;26874653 False 3 100;0;0 1.2304 True ENSG00000114956 ENSG00000114956 HGNC:2858 DHCR24 gene DHCR24 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Desmosterolosis MIM#602398;Disorders of the metabolism of sterols 11519011;33524375;21671375;12457401;29175559;21559050;29175559 False 3 100;0;0 1.2304 True ENSG00000116133 ENSG00000116133 HGNC:2859 DHCR7 gene DHCR7 Expert list;Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Smith-Lemli-Opitz syndrome (MIM#270400) 23059950 False 3 100;0;0 1.2304 True ENSG00000172893 ENSG00000172893 HGNC:2860 DHDDS gene DHDDS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Developmental delay and seizures with or without movement abnormalities, MIM#617836;Congenital disorder of glycosylation, type 1bb, MIM# 613861 27343064;29100083;21295283;34382076;27343064;29100083;21295283;27343064;21295283;28130426;29276052;32483926;36046393;24078709;28005406;36046393 False 3 100;0;0 1.2304 True ENSG00000117682 ENSG00000117682 HGNC:20603 DHFR gene DHFR Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Megaloblastic anaemia due to dihydrofolate reductase deficiency, MIM# 613839 21310276;21310277 False 3 100;0;0 1.2304 True ENSG00000228716 ENSG00000228716 HGNC:2861 DHH gene DHH Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal "46XY gonadal dysgenesis with minifascicular neuropathy MIM#607080;46XY sex reversal 7 MIM#233420" 31018998;29471294;11017805 False 3 100;0;0 1.2304 True ENSG00000139549 ENSG00000139549 HGNC:2865 DHODH gene DHODH Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Miller syndrome, MIM# 263750 19915526;20220176;33262786;27370710 False 3 100;0;0 1.2304 True ENSG00000102967 ENSG00000102967 HGNC:2867 DHPS gene DHPS Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with seizures and speech and walking impairment, MIM#618480 30661771 False 3 100;0;0 1.2304 True ENSG00000095059 ENSG00000095059 HGNC:2869 DHRSX gene DHRSX Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type 1DD, MIM# 301133 38821050 False 3 100;0;0 1.2304 True ENSG00000169084 ENSG00000169084 HGNC:18399 DHTKD1 gene DHTKD1 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Alpha-aminoadipic and alpha-ketoadipic aciduria MIM#204750, AR;Charcot-Marie-Tooth disease, axonal, type 2Q, MIM#615025" 23141294;29661920;28902413;27604308;23141293;29661920;25860818 False 3 50;50;0 1.2304 True ENSG00000181192 ENSG00000181192 HGNC:23537 DHX16 gene DHX16 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Neuromuscular disease and ocular or auditory anomalies with or without seizures, MIM# 618733" 31256877 False 3 100;0;0 1.2304 True ENSG00000204560 ENSG00000204560 HGNC:2739 DHX30 gene DHX30 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with severe motor impairment and absent language, 617804 29100085 False 3 100;0;0 1.2304 True ENSG00000132153 ENSG00000132153 HGNC:16716 DHX37 gene DHX37 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal 46,XY gonadal dysgenesis;testicular regression syndrome (TRS);Neurodevelopmental disorder with brain anomalies and with or without vertebral or cardiac anomalies, MIM#618731 31337883;31745530;26539891;31256877 False 3 100;0;0 1.2304 True ENSG00000150990 ENSG00000150990 HGNC:17210 DHX9 gene DHX9 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder, autosomal dominant 75, MIM# 620988;Charcot-Marie-Tooth disease, MONDO:0015626 37467750 False 3 100;0;0 1.2304 True ENSG00000135829 ENSG00000135829 HGNC:2750 DIAPH1 gene DIAPH1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Deafness;thrombocytopenia 124900;Seizures;cortical blindness;microcephaly 616632 24781755;26463574;24781755;27808407;28003573;28815995 False 3 100;0;0 1.2304 True ENSG00000131504 ENSG00000131504 HGNC:2876 DIP2C gene DIP2C Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder (MONDO#0700092), DIP2C-related PMID: 38421105 False 3 100;0;0 1.2304 True ENSG00000151240 ENSG00000151240 HGNC:29150 DIS3L2 gene DIS3L2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Perlman syndrome MIM# 267000 22306653;28328139;29950491 False 3 100;0;0 1.2304 True ENSG00000144535 ENSG00000144535 HGNC:28648 DISP1 gene DISP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Holoprosencephaly, MONDO:0016296 19184110;26748417;23542665;38529886 False 3 50;50;0 1.2304 True ENSG00000154309 ENSG00000154309 HGNC:19711 DKC1 gene DKC1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Dyskeratosis congenita, X-linked 305000;Hoyeraal-Hreidarsson Syndrome 31269755;26951492;29081935;25940403 False 3 100;0;0 1.2304 True ENSG00000130826 ENSG00000130826 HGNC:2890 DLAT gene DLAT Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pyruvate dehydrogenase E2 deficiency MIM#245348 34138529 False 3 100;0;0 1.2304 True ENSG00000150768 ENSG00000150768 HGNC:2896 DLC1 gene DLC1 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Nephrotic syndrome MONDO:0005377 29773874 False 3 100;0;0 1.2304 True ENSG00000164741 ENSG00000164741 HGNC:2897 DLD gene DLD Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Dihydrolipoamide dehydrogenase deficiency MIM#246900 3769994;8506365;9934985;17404228;21558426;21930696 False 3 100;0;0 1.2304 True ENSG00000091140 ENSG00000091140 HGNC:2898 DLG3 gene DLG3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Mental retardation, X-linked 90, MIM#300850 28777483;24721225 False 3 100;0;0 1.2304 True ENSG00000082458 ENSG00000082458 HGNC:2902 DLG4 gene DLG4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder 62, MIM# 618793 33597769;27479843;25123844;19617690;29460436;23020937;28135719 False 3 100;0;0 1.2304 True ENSG00000132535 ENSG00000132535 HGNC:2903 DLG5 gene DLG5 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Yuksel-Vogel-Bauer syndrome, MIM#620703 32631816 False 3 100;0;0 1.2304 True ENSG00000151208 ENSG00000151208 HGNC:2904 DLK1 gene DLK1 Expert Review;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) central precocious puberty 28324015;30462238 False 3 100;0;0 1.2304 True ENSG00000185559 ENSG00000185559 HGNC:2907 DLL1 gene DLL1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability;autism;seizures;variable brain abnormalities;scoliosis 31353024 False 3 100;0;0 1.2304 True ENSG00000198719 ENSG00000198719 HGNC:2908 DLL3 gene DLL3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spondylocostal dysostosis 1, autosomal recessive, MIM# 277300 10742114;12746394 False 3 100;0;0 1.2304 True ENSG00000090932 ENSG00000090932 HGNC:2909 DLL4 gene DLL4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Adams-Oliver syndrome 6, MIM#616589 26299364;33899511;31261205;29924900 False 3 100;0;0 1.2304 True ENSG00000128917 ENSG00000128917 HGNC:2910 DLX3 gene DLX3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amelogenesis imperfecta, type IV, MIM# 104510;Trichodontoosseous syndrome, MIM# 190320 9467018;15666299;18203197 False 3 100;0;0 1.2304 True ENSG00000064195 ENSG00000064195 HGNC:2916 DLX5 gene DLX5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Split-hand/foot malformation 1 with sensorineural hearing loss MIM#220600;Split-hand/foot malformation 1 MIM#183600 22121204;24496061;25196357;20534536;12112878 False 3 100;0;0 1.2304 True ENSG00000105880 ENSG00000105880 HGNC:2918 DMAP1 gene DMAP1 Expert Review Green;Other Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092, DMAP1-related False 3 100;0;0 1.2304 True ENSG00000178028 ENSG00000178028 HGNC:18291 DMC1 gene DMC1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Primary ovarian insufficiency;non-obstructive azoospermia 34794894;29331980;9660954;9660953;18166824 False 3 100;0;0 1.2304 True ENSG00000100206 ENSG00000100206 HGNC:2927 DMD gene DMD Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Becker muscular dystrophy MIM@300376 XLR;Cardiomyopathy, dilated, 3B MIM#302045 XL;Duchenne muscular dystrophy MIM#310200 20301298 False 3 100;0;0 1.2304 True ENSG00000198947 ENSG00000198947 HGNC:2928 DMP1 gene DMP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypophosphatemic rickets MIM#241520 32920683;17033625;17033621 False 3 100;0;0 1.2304 True ENSG00000152592 ENSG00000152592 HGNC:2932 DMXL2 gene DMXL2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "Epileptic encephalopathy, early infantile, 81, MIM# 618663" 31688942;30237576 False 3 100;0;0 1.2304 True ENSG00000104093 ENSG00000104093 HGNC:2938 DNA2 gene DNA2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Rothmund-Thomson syndrome, type 4, MIM# 620819;Seckel syndrome 8, MIM#615807;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 6 MIM#615156 24389050;31045292;23352259;25635128;28554558;37133451 False 3 50;50;0 1.2304 True ENSG00000138346 ENSG00000138346 HGNC:2939 DNAAF1 gene DNAAF1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 13, MIM# 613193 19944400;19944405;32502479;29228333;27261005 False 3 100;0;0 1.2304 True ENSG00000154099 ENSG00000154099 HGNC:30539 DNAAF2 gene DNAAF2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 10, MIM# 612518 19052621;32638265;31107948 False 3 100;0;0 1.2304 True ENSG00000165506 ENSG00000165506 HGNC:20188 DNAAF3 gene DNAAF3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 2, MIM# 606763 22387996;32622824;31186518 False 3 100;0;0 1.2304 True ENSG00000167646 ENSG00000167646 HGNC:30492 DNAAF4 gene DNAAF4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 25, MIM# 615482 23872636 False 3 100;0;0 1.2304 True ENSG00000256061 ENSG00000256061 HGNC:21493 DNAAF5 gene DNAAF5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 18, MIM# 614874 23040496;29363216;25232951 False 3 100;0;0 1.2304 True ENSG00000164818 ENSG00000164818 HGNC:26013 DNAH1 gene DNAH1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal primary ciliary dyskinesia,37 MIM#617577;Spermatogenic failure 18 MIM#617576 34867808;31507630;31765523;25927852;24360805;33577779;27798045 False 3 100;0;0 1.2304 True ENSG00000114841 ENSG00000114841 HGNC:2940 DNAH10 gene DNAH10 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "Spermatogenic failure 56, MIM# 619515" 34237282 False 3 100;0;0 1.2304 True ENSG00000197653 ENSG00000197653 HGNC:2941 DNAH11 gene DNAH11 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 7, with or without situs inversus, MIM#611884 12142464;18022865;22102620;32633470;31879361;31765523;31040315 False 3 100;0;0 1.2304 True ENSG00000105877 ENSG00000105877 HGNC:2942 DNAH17 gene DNAH17 Expert Review Green;Other Mendeliome BIALLELIC, autosomal or pseudoautosomal spermatogenic failure 39 (MONDO:0032845) https://search.clinicalgenome.org/CCID:004669 False 3 100;0;0 1.2304 True ENSG00000187775 ENSG00000187775 HGNC:2946 DNAH2 gene DNAH2 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Spermatogenic failure 45, MIM# 619094" 30811583 False 3 100;0;0 1.2304 True ENSG00000183914 ENSG00000183914 HGNC:2948 DNAH5 gene DNAH5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 3, with or without situs inversus (MIM #608644) 16627867 False 3 100;0;0 1.2304 True ENSG00000039139 ENSG00000039139 HGNC:2950 DNAH7 gene DNAH7 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Primary ciliary dyskinesia, MONDO:0016575, DNAH7-related 34476482;35543642 False 3 100;0;0 1.2304 True ENSG00000118997 ENSG00000118997 HGNC:18661 DNAH8 gene DNAH8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spermatogenic failure 46, MIM#619095;Asthenozoospermia;primary ciliary dyskinesia 31178125;24307375 False 3 100;0;0 1.2304 True ENSG00000124721 ENSG00000124721 HGNC:2952 DNAH9 gene DNAH9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 40, MIM# 618300 30471717;30471718 False 3 100;0;0 1.2304 True ENSG00000007174 ENSG00000007174 HGNC:2953 DNAI1 gene DNAI1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 1, with or without situs inversus, MIM# 244400 10577904;11231901;32502479;31765523;30622330 False 3 100;0;0 1.2304 True ENSG00000122735 ENSG00000122735 HGNC:2954 DNAI2 gene DNAI2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 9, with or without situs inversus, MIM# 612444 18950741;23261302 False 3 100;0;0 1.2304 True ENSG00000171595 ENSG00000171595 HGNC:18744 DNAJB11 gene DNAJB11 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Polycystic kidney disease 6 with or without polycystic liver disease, MIM#618061;Ivermark II syndrome. 29706351;29777155;33129895;34177435 False 3 100;0;0 1.2304 True ENSG00000090520 ENSG00000090520 HGNC:14889 DNAJB13 gene DNAJB13 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 34, MIM# 617091 27486783 False 3 100;0;0 1.2304 True ENSG00000187726 ENSG00000187726 HGNC:30718 DNAJB2 gene DNAJB2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neuronopathy, distal hereditary motor, autosomal recessive 5 (MIM#614881) 22522442;25274842;33369814;22522442 False 3 100;0;0 1.2304 True ENSG00000135924 ENSG00000135924 HGNC:5228 DNAJB4 gene DNAJB4 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Congenital myopathy 21 with early respiratory failure, MIM# 620326;distal myopathy MONDO:0018949 PMID: 36264506;36512060 False 3 67;33;0 1.2304 True ENSG00000162616 ENSG00000162616 HGNC:14886 DNAJB6 gene DNAJB6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Muscular dystrophy, limb-girdle, autosomal dominant 1 MIM#603511 26847086;26338452;24170373 False 3 100;0;0 1.2304 True ENSG00000105993 ENSG00000105993 HGNC:14888 DNAJC12 gene DNAJC12 Expert Review;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hyperphenylalaninemia, mild, non-BH4-deficient, MIM#617384 False 3 100;0;0 1.2304 True ENSG00000108176 ENSG00000108176 HGNC:28908 DNAJC19 gene DNAJC19 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria, type V MIM#610198 16055927;17244376;22797137 False 3 100;0;0 1.2304 True ENSG00000205981 ENSG00000205981 HGNC:30528 DNAJC21 gene DNAJC21 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bone marrow failure syndrome 3 - MIM#617052 29700810;28062395;27346687 False 3 100;0;0 1.2304 True ENSG00000168724 ENSG00000168724 HGNC:27030 DNAJC3 gene DNAJC3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ataxia, combined cerebellar and peripheral, with hearing loss and diabetes mellitus - MIM#616192 33486469;34630333;34654017;32738013 False 3 100;0;0 1.2304 True ENSG00000102580 ENSG00000102580 HGNC:9439 DNAJC30 gene DNAJC30 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Leber Hereditary Optic Neuropathy, MIM#619382 33465056 False 3 100;0;0 1.2304 True ENSG00000176410 ENSG00000176410 HGNC:16410 DNAJC5 gene DNAJC5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ceroid lipofuscinosis, neuronal, 4 (Kufs type), autosomal dominant - MIM#162350;ceroid lipofuscinosis, neuronal, 4 (Kufs type) - MONDO:0008083 22978711;21820099;22235333;31919451;26659577 False 3 100;0;0 1.2304 True ENSG00000101152 ENSG00000101152 HGNC:16235 DNAJC6 gene DNAJC6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Parkinson disease 19a, juvenile-onset - MIM#615528;Parkinson disease 19b, early-onset - MIM#615528 22563501;23211418;26528954 False 3 100;0;0 1.2304 True ENSG00000116675 ENSG00000116675 HGNC:15469 DNASE1L3 gene DNASE1L3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Systemic lupus erythematosus 16 - MIM#614420 30008451;22019780;27821515 False 3 0;0;0 1.2304 True ENSG00000163687 ENSG00000163687 HGNC:2959 DNASE2 gene DNASE2 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Autoinflammatory-pancytopaenia syndrome, MIM# 619858 29259162;31775019 False 3 100;0;0 1.2304 True ENSG00000105612 ENSG00000105612 HGNC:2960 DNHD1 gene DNHD1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Spermatogenic failure 65, MIM# 619712 34932939 False 3 100;0;0 1.2304 True ENSG00000179532 ENSG00000179532 HGNC:26532 DNM1 gene DNM1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 31A, autosomal dominant, MIM# 616346;Developmental and epileptic encephalopathy 31B, autosomal recessive, MIM# 620352 25262651;27066543;33372033;34172529 False 3 100;0;0 1.2304 True ENSG00000106976 ENSG00000106976 HGNC:2972 DNM1L gene DNM1L Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Encephalopathy, lethal, due to defective mitochondrial peroxisomal fission 1 - MIM#614388 (AD, AR);Optic atrophy 5 - MIM#610708 (AD) False 3 100;0;0 1.2304 True ENSG00000087470 ENSG00000087470 HGNC:2973 DNM2 gene DNM2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, axonal type 2M, MIM# 606482;Charcot-Marie-Tooth disease, dominant intermediate B, MIM# 606482;MONDO:0011674 15731758;17636067;33459893;31628461 False 3 50;0;50 1.2304 True ENSG00000079805 ENSG00000079805 HGNC:2974 DNMBP gene DNMBP Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal congenital cataract 30290152 False 3 100;0;0 1.2304 True ENSG00000107554 ENSG00000107554 HGNC:30373 DNMT1 gene DNMT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cerebellar ataxia, deafness, and narcolepsy, autosomal dominant, 604121;Neuropathy, hereditary sensory, type IE, 614116 22328086;21532572;31984424 False 3 100;0;0 1.2304 True ENSG00000130816 ENSG00000130816 HGNC:2976 DNMT3A gene DNMT3A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Tatton-Brown-Rahman syndrome, MIM# 615879;Heyn-Sproul-Jackson syndrome, MIM# 618724 30478443;24614070 False 3 100;0;0 1.2304 True Other ENSG00000119772 ENSG00000119772 HGNC:2978 DNMT3B gene DNMT3B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency-centromeric instability-facial anomalies syndrome 1 MIM# 242860;facial dysmorphic features;flat nasal bridge;developmental delay;macroglossia;bacterial/opportunistic infections (recurrent);malabsorption;cytopaenia;malignancies;multiradial configurations of chromosomes 1, 9, 16;Hypogammaglobulinaemia;agammaglobulinaemia;variable antibody deficiency;decreased immunoglobulin production;low T/B/NK cells 20587527;10555141;17359920;9718351;10647011;11102980;12239717 False 3 100;0;0 1.2304 True ENSG00000088305 ENSG00000088305 HGNC:2979 DOCK11 gene DOCK11 Expert Review Green;Literature Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Autoimmune disease with immune dysregulation, X-linked (ADMIDX), MIM#301109 36952639 False 3 100;0;0 1.2304 True ENSG00000147251 ENSG00000147251 HGNC:23483 DOCK2 gene DOCK2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 40 MIM# 616433;T/B-cell lymphopaenia;early-onset invasive herpes/viral/bacterial Infections;function defects in T/B/NK cells;immunodeficiency;defective IFN-mediated immunity;elevated IgM;normal IgG/IgA levels 26083206;29204803;33928462;30826364;30838481;11518968 False 3 100;0;0 1.2304 True ENSG00000134516 ENSG00000134516 HGNC:2988 DOCK3 gene DOCK3 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with impaired intellectual development, hypotonia, and ataxia, MIM#618292 28195318;29130632;30976111 False 3 100;0;0 1.2304 True ENSG00000088538 ENSG00000088538 HGNC:2989 DOCK4 gene DOCK4 Expert Review Green;Other Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown DOCK4-related neurodevelopmental disorder (MONDO:0060490) PMID: 38526744 False 3 100;0;0 1.2304 True ENSG00000128512 ENSG00000128512 HGNC:19192 DOCK6 gene DOCK6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Adams-Oliver syndrome 2, MIM#614219 21820096;23522784;25132448;25824905 False 3 100;0;0 1.2304 True ENSG00000130158 ENSG00000130158 HGNC:19189 DOCK7 gene DOCK7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 23 MIM#615859;MONDO:0014371 24814191;30771731;30807358 False 3 100;0;0 1.2304 True ENSG00000116641 ENSG00000116641 HGNC:19190 DOCK8 gene DOCK8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hyper-IgE recurrent infection syndrome, autosomal recessive MIM# 243700;T cell Lymphopaenia;decraese T/B/NK cells;Eosinophilia;low IgM;elevated IgE;recurrent cutaneous/ viral/ bacterial/ fungal/ infections;severe atopy/allergic disease;autoimmune haemolytic anaemia;eczema;cancer diathesis 19776401;20622910;21931011;26659092;19898472;25422492 False 3 100;0;0 1.2304 True ENSG00000107099 ENSG00000107099 HGNC:19191 DOHH gene DOHH Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly, cerebral atrophy, and visual impairment, MIM# 620066 PMID: 35858628 False 3 100;0;0 1.2304 True ENSG00000129932 ENSG00000129932 HGNC:28662 DOK7 gene DOK7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 10, MIM# 254300;Fetal akinesia deformation sequence 3, MIM# 618389 16917026;18626973;20147321;16794080;31453852;29395672;32360404;19261599;31880392 False 3 100;0;0 1.2304 True ENSG00000175920 ENSG00000175920 HGNC:26594 DOLK gene DOLK Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal DK1-CDG, MONDO:0012556;Congenital disorder of glycosylation, type Im, MIM# 610768 17273964;22242004;23890587;30653653;28816422;24144945 False 3 100;0;0 1.2304 True ENSG00000175283 ENSG00000175283 HGNC:23406 DONSON gene DONSON Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephaly, short stature, and limb abnormalities, MIM# 617604;Microcephaly-micromelia syndrome, MIM# 251230;MONDO:0009619 28191891;28630177;28191891 False 3 100;0;0 1.2304 True ENSG00000159147 ENSG00000159147 HGNC:2993 DOT1L gene DOT1L Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, DOT1L-related 37827158 False 3 100;0;0 1.2304 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000104885 ENSG00000104885 HGNC:24948 DPAGT1 gene DPAGT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Ij, MIM# 608093;DPAGT1-CDG MONDO:0011964;Myasthenic syndrome, congenital, 13, with tubular aggregates, MIM# 614750 12872255;22492991;22304930;31153949;30653653;30117111;22742743;29356258;28712839;28662078 False 3 100;0;0 1.2304 True ENSG00000172269 ENSG00000172269 HGNC:2995 DPF2 gene DPF2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Coffin-Siris syndrome 7, MIM#618027 29429572;31706665 False 3 100;0;0 1.2304 True ENSG00000133884 ENSG00000133884 HGNC:9964 DPH1 gene DPH1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Developmental delay with short stature, dysmorphic facial features, and sparse hair, MIM# 616901 29362492;29410513;25558065;26220823 False 3 100;0;0 1.2304 True ENSG00000108963 ENSG00000108963 HGNC:3003 DPH5 gene DPH5 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with short stature, prominent forehead, and feeding difficulties, MIM# 620070 35482014 False 3 100;0;0 1.2304 True ENSG00000117543 ENSG00000117543 HGNC:24270 DPM1 gene DPM1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Ie, 608799 23856421 False 3 100;0;0 1.2304 True ENSG00000000419 ENSG00000000419 HGNC:3005 DPM2 gene DPM2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Iu, MIM# 615042 23109149;33129689 False 3 100;0;0 1.2304 True ENSG00000136908 ENSG00000136908 HGNC:3006 DPM3 gene DPM3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 15 , MIM#612937;Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 15 618992 31266720;28803818;19576565;31266720;31469168 False 3 100;0;0 1.2304 True ENSG00000179085 ENSG00000179085 HGNC:3007 DPP9 gene DPP9 Expert Review;Expert Review Green Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hatipoglu immunodeficiency syndrome MIM#620331;Autoinflammatory syndrome MONDO:0019751, DPP9-related;recurrent fevers;repeated infections;herpes susceptibility;cytopenias 36112693;37544411 False 3 100;0;0 1.2304 True ENSG00000142002 ENSG00000142002 HGNC:18648 DPY19L2 gene DPY19L2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spermatogenic failure 9 - MIM#613958 False 3 100;0;0 1.2304 True ENSG00000177990 ENSG00000177990 HGNC:19414 DPYD gene DPYD Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal 5-fluorouracil toxicity 274270;Dihydropyrimidine dehydrogenase deficiency 274270 29152729 False 3 100;0;0 1.2304 True ENSG00000188641 ENSG00000188641 HGNC:3012 DPYS gene DPYS Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Dihydropyrimidinuria, MIM#222748 False 3 100;0;0 1.2304 True ENSG00000147647 ENSG00000147647 HGNC:3013 DPYSL5 gene DPYSL5 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ritscher-Schinzel syndrome 4, MIM# 619435;Neurodevelopmental disorder with corpus callosum agenesis and cerebellar abnormalities 33894126 False 3 100;0;0 1.2304 True ENSG00000157851 ENSG00000157851 HGNC:20637 DRAM2 gene DRAM2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cone-rod dystrophy 21 - MIM#616502 25983245;29555955;31394102 False 3 100;0;0 1.2304 True ENSG00000156171 ENSG00000156171 HGNC:28769 DRC1 gene DRC1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 21, MIM# 615294;Spermatogenic failure 80, MIM# 620222 31960620;34169321 False 3 100;0;0 1.2304 True ENSG00000157856 ENSG00000157856 HGNC:24245 DRG1 gene DRG1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "Tan-Almurshedi syndrome, MIM# 620641" PMID: 37179472 False 3 100;0;0 1.2304 True ENSG00000185721 ENSG00000185721 HGNC:3029 DRP2 gene DRP2 Expert list;Expert Review Green Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Charcot Marie Tooth, intermediate X-linked;HMSN 26227883;11430802;31217940;22764250;29473052 False 3 100;0;0 1.2304 True ENSG00000102385 ENSG00000102385 HGNC:3032 DSCAM gene DSCAM Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Autism MONDO:0005260 34253863;32807774;28600779;21904980;28191889;27824329;30095639;23671607 False 3 0;100;0 1.2304 True ENSG00000171587 ENSG00000171587 HGNC:3039 DSE gene DSE Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ehlers-Danlos syndrome, musculocontractural type 2 - MIM#615539 28306229;23704329;25703627;32130795 False 3 100;0;0 1.2304 True ENSG00000111817 ENSG00000111817 HGNC:21144 DSG1 gene DSG1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Erythroderma, congenital, with palmoplantar keratoderma, hypotrichosis, and hyper IgE, AR (MIM#615508);Keratosis palmoplantaris striata I, AD (MIM# 148700) 19558595;29315490;31192455;23974871;29229434;33666035 False 3 100;0;0 1.2304 True ENSG00000134760 ENSG00000134760 HGNC:3048 DSG4 gene DSG4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypotrichosis 6 - MIM#607903 12705872;16439973;16543896;16575393;17392831 False 3 100;0;0 1.2304 True ENSG00000175065 ENSG00000175065 HGNC:21307 DSPP gene DSPP Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Deafness, autosomal dominant 39, with dentinogenesis - MIM#605594;Dentin dysplasia, type II - MIM#125420;Dentinogenesis imperfecta, Shields type II - MIM#125490;Dentinogenesis imperfecta, Shields type III - MIM#125500 False 3 100;0;0 1.2304 True ENSG00000152591 ENSG00000152591 HGNC:3054 DST gene DST Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neuropathy, hereditary sensory and autonomic, type VI, MIM#614653;Epidermolysis bullosa simplex, autosomal recessive 2, MIM#615425 22522446;30371979;28468842 False 3 100;0;0 1.2304 True ENSG00000151914 ENSG00000151914 HGNC:1090 DTNA gene DTNA Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Muscular dystrophy, MONDO:0020121, DTNA-related;Left ventricular noncompaction 1, with or without congenital heart defects, MIM# 604169 29118297;11238270;16427346;36799992 False 3 50;0;50 1.2304 True ENSG00000134769 ENSG00000134769 HGNC:3057 DTNBP1 gene DTNBP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hermansky-Pudlak syndrome 7, MIM# 614076;MONDO:0013559 12923531;23364359;28259707;30990103 False 3 100;0;0 1.2304 True ENSG00000047579 ENSG00000047579 HGNC:17328 DTYMK gene DTYMK Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodegeneration, childhood-onset, with progressive microcephaly (MIM# 619847) 31271740;34918187 False 3 50;0;50 1.2304 True ENSG00000168393 ENSG00000168393 HGNC:3061 DUOX2 gene DUOX2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Thyroid dyshormonogenesis 6 - MIM#607200;Inflammatory bowel disease, MONDO:0005265, DUOX2-related 35429653;27373512;26301257;28683258 False 3 50;50;0 1.2304 True ENSG00000140279 ENSG00000140279 HGNC:13273 DUOXA2 gene DUOXA2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Thyroid dyshormonogenesis 5 - MIM#274900 False 3 100;0;0 1.2304 True ENSG00000140274 ENSG00000140274 HGNC:32698 DUT gene DUT Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Bone marrow failure and diabetes mellitus syndrome (MIM#620044) 28073829;35611808 False 3 100;0;0 1.2304 True ENSG00000128951 ENSG00000128951 HGNC:3078 DVL1 gene DVL1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed) Robinow syndrome, autosomal dominant 2 (MIM#616331) 25817014;25817016 False 3 100;0;0 1.2304 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000107404 ENSG00000107404 HGNC:3084 DVL3 gene DVL3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Robinow syndrome, autosomal dominant 3 MIM#616894 26924530 False 3 100;0;0 1.2304 True ENSG00000161202 ENSG00000161202 HGNC:3087 DYM gene DYM Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Smith-McCort dysplasia , MM#607326;Dyggve-Melchior-Clausen disease, MIM#223800 12491225;12554689;16470731;19005420 False 3 100;0;0 1.2304 True ENSG00000141627 ENSG00000141627 HGNC:21317 DYNC1H1 gene DYNC1H1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, axonal, type 20;Mental retardation, autosomal dominant 13;Spinal muscular atrophy, lower extremity-predominant 1 25512093;28196890 False 3 100;0;0 1.2304 True Other ENSG00000197102 ENSG00000197102 HGNC:2961 DYNC1I1 gene DYNC1I1 Expert Review;Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Split-hand/split-foot malformation (SHFM) MONDO:0016576, DYNC1I1-related 22914741;25231166;32219838 False 3 100;0;0 1.2304 True ENSG00000158560 ENSG00000158560 HGNC:2963 DYNC1I2 gene DYNC1I2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "Neurodevelopmental disorder with microcephaly and structural brain anomalies , MIM#618492" 31079899 False 3 100;0;0 1.2304 True ENSG00000077380 ENSG00000077380 HGNC:2964 DYNC2H1 gene DYNC2H1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Short-rib thoracic dysplasia 3 with or without polydactyly, MIM# 613091;MONDO:0013127 19442771;19361615;22499340;23456818;27925158;32753734 False 3 100;0;0 1.2304 True ENSG00000187240 ENSG00000187240 HGNC:2962 DYNC2LI1 gene DYNC2LI1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Short-rib thoracic dysplasia 15 with polydactyly (MIM#617088) 33030252 False 3 100;0;0 1.2304 True ENSG00000138036 ENSG00000138036 HGNC:24595 DYRK1A gene DYRK1A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 7 (MIM#614104) 25707398;31263215 False 3 100;0;0 1.2304 True ENSG00000157540 ENSG00000157540 HGNC:3091 DYSF gene DYSF Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Miyoshi muscular dystrophy 1 254130;Muscular dystrophy, limb-girdle, autosomal recessive 2 253601;Myopathy, distal, with anterior tibial onset 606768 27602406 False 3 100;0;0 1.2304 True ENSG00000135636 ENSG00000135636 HGNC:3097 DZIP1L gene DZIP1L Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Polycystic kidney disease 5, MIM#617610 28530676 False 3 100;0;0 1.2304 True ENSG00000158163 ENSG00000158163 HGNC:26551 EARS2 gene EARS2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Leigh syndrome MONDO:0009723;Combined oxidative phosphorylation deficiency 12 MIM#614924;leukoencephalopathy-thalamus and brainstem anomalies-high lactate syndrome MONDO:0013971 22492562;23008233;25854774;26619324;26893310;27206875;27571996;27117034 False 3 100;0;0 1.2304 True ENSG00000103356 ENSG00000103356 HGNC:29419 EBF3 gene EBF3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypotonia, ataxia, and delayed development syndrome, MIM# 617330 28017373;28017372;28017370;32366537 False 3 100;0;0 1.2304 True ENSG00000108001 ENSG00000108001 HGNC:19087 EBP gene EBP Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Chondrodysplasia punctata, X-linked dominant MIM#302960;Conradi-Hunermann syndrome;MEND syndrome, MIM#300960 10391218;10391219 False 3 100;0;0 1.2304 True ENSG00000147155 ENSG00000147155 HGNC:3133 ECEL1 gene ECEL1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Arthrogryposis, distal, type 5D, MIM# 615065 23261301;23236030;25099528;24782201 False 3 50;50;0 1.2304 True ENSG00000171551 ENSG00000171551 HGNC:3147 ECHS1 gene ECHS1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial short-chain enoyl-CoA hydratase 1 deficiency, MIM# 616277;Leigh syndrome MONDO:0009723;cerebral palsy MONDO:0006497;paroxysmal dystonia MONDO:0016058 33528536;34364746;32858208;31399326;25125611;25393721;32677093 False 3 100;0;0 1.2304 True ENSG00000127884 ENSG00000127884 HGNC:3151 ECM1 gene ECM1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Urbach-Wiethe disease #247100 11929856;28720532;33159951 False 3 100;0;0 1.2304 True ENSG00000143369 ENSG00000143369 HGNC:3153 EDA gene EDA Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Ectodermal dysplasia 1, hypohidrotic, X-linked MIM#305100;Tooth agenesis, selective, X-linked 1 MIM#313500 27144394;8696334;9507389;9683615;18657636 False 3 100;0;0 1.2304 True ENSG00000158813 ENSG00000158813 HGNC:3157 EDAR gene EDAR Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal autosomal dominant hypohidrotic ectodermal dysplasia MONDO:0015884;autosomal recessive hypohidrotic ectodermal dysplasia MONDO:0016619 10431241;20301291;16435307;20979233;23401279;18384562 False 3 100;0;0 1.2304 True ENSG00000135960 ENSG00000135960 HGNC:2895 EDARADD gene EDARADD Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal False 3 100;0;0 1.2304 True ENSG00000186197 ENSG00000186197 HGNC:14341 EDEM3 gene EDEM3 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type 2V, MIM# 619493 34143952 False 3 100;0;0 1.2304 True ENSG00000116406 ENSG00000116406 HGNC:16787 EDN3 gene EDN3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Central hypoventilation syndrome, congenital, MIM# 209880;Waardenburg syndrome, type 4B, MIM# 613265;{Hirschsprung disease, susceptibility to, 4}, MIM# 613712 8630502;11303518;9359047;10231870;30171849;27370713 False 3 100;0;0 1.2304 True ENSG00000124205 ENSG00000124205 HGNC:3178 EDNRA gene EDNRA Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mandibulofacial dysostosis with alopecia, MIM# 616367 25772936;27671791 False 3 100;0;0 1.2304 True ENSG00000151617 ENSG00000151617 HGNC:3179 EDNRB gene EDNRB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Waardenburg syndrome type 4A MONDO:0010192;sensorineural hearing loss;pigmentary abnormalities;Hirschsprung disease 28502583;25852447;21373256;16237557;11773966;11891690;8001158;10528251;10528251;19764031;28236341 False 3 100;0;0 1.2304 True ENSG00000136160 ENSG00000136160 HGNC:3180 EED gene EED Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cohen-Gibson syndrome, MIM# 617561 25787343;27193220;27868325;28229514 False 3 100;0;0 1.2304 True ENSG00000074266 ENSG00000074266 HGNC:3188 EEF1A2 gene EEF1A2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 38, MIM# 616393;MONDO:0014617;Developmental and epileptic encephalopathy 33, MIM# 616409;MONDO:0014625 24697219;32196822;32160274;32062104;31893083 False 3 100;0;0 1.2304 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000101210 ENSG00000101210 HGNC:3192 EEF1B2 gene EEF1B2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal neurodevelopmental disorder MONDO:0700092;non-syndromic ID and seizures;Intellectual disability 31845318;21937992;35015920 False 3 50;50;0 1.2304 True ENSG00000114942 ENSG00000114942 HGNC:3208 EEF2 gene EEF2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, macrocephaly, hydrocephalus;Spinocerebellar ataxia 26, MIM#609306 15732118;23001565;33355653 False 3 100;0;0 1.2304 True ENSG00000167658 ENSG00000167658 HGNC:3214 EEFSEC gene EEFSEC Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092, EEFSEC-related 39753114 False 3 100;0;0 1.2304 True ENSG00000132394 ENSG00000132394 HGNC:24614 EFCAB1 gene EFCAB1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 53, MIM# 620642 PMID: 36727596 False 3 100;0;0 1.2304 True ENSG00000034239 ENSG00000034239 HGNC:25678 EFEMP1 gene EFEMP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Doyne honeycomb degeneration of retina, MIM# 126600;Cutis laxa, autosomal recessive, type ID, MIM# 620780;Glaucoma 1, open angle, H, MIM# 611276 32006683;31792352;33807164 False 3 100;0;0 1.2304 True ENSG00000115380 ENSG00000115380 HGNC:3218 EFEMP2 gene EFEMP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Autosomal recessive cutis laxa type 1B (ARCL1B), MIM# 614437 30140196;23532871;31548410;19664000 False 3 100;0;0 1.2304 True ENSG00000172638 ENSG00000172638 HGNC:3219 EFL1 gene EFL1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Shwachman-Diamond syndrome 2, MIM# 617941 28331068;31151987 False 3 100;0;0 1.2304 True ENSG00000140598 ENSG00000140598 HGNC:25789 EFNB1 gene EFNB1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome Other Craniofrontonasal dysplasia, MIM# 304110 15166289;18627045;23335590 False 3 100;0;0 1.2304 True ENSG00000090776 ENSG00000090776 HGNC:3226 EFTUD2 gene EFTUD2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mandibulofacial dysostosis, Guion-Almeida type, MIM# 610536;Mandibulofacial dysostosis-microcephaly syndrome MONDO:0012516 22305528;23188108;33601405;33262786;26507355 False 3 100;0;0 1.2304 True ENSG00000108883 ENSG00000108883 HGNC:30858 EGLN1 gene EGLN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Erythrocytosis, familial, 3, MIM# 609820 19092153;16407130;17579185 False 3 100;0;0 1.2304 True ENSG00000135766 ENSG00000135766 HGNC:1232 EGR2 gene EGR2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, type 1D 607678 AD;Dejerine-Sottas disease 145900 AD, AR;Hypomyelinating neuropathy, congenital, 1 605253 AD, AR 11523566;31852952 False 3 100;0;0 1.2304 True Other ENSG00000122877 ENSG00000122877 HGNC:3239 EHBP1L1 gene EHBP1L1 Expert list;Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal non-immune hydrops fetalis MONDO:0009369, EHBP1L1-related 34645488;26833786 False 3 50;50;0 1.2304 True ENSG00000173442 ENSG00000173442 HGNC:30682 EHHADH gene EHHADH Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Fanconi renotubular syndrome 3;OMIM#615605 24401050;35738466;38310177 False 3 50;50;0 1.2304 True ENSG00000113790 ENSG00000113790 HGNC:3247 EHMT1 gene EHMT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Kleefstra syndrome 1 (MIM#610253) 19264732 False 3 100;0;0 1.2304 True ENSG00000181090 ENSG00000181090 HGNC:24650 EIF2AK2 gene EIF2AK2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability;white matter abnormalities;ataxia;regression with febrile illness;Dystonia 32197074;33866603;33236446 False 3 100;0;0 1.2304 True ENSG00000055332 ENSG00000055332 HGNC:9437 EIF2AK3 gene EIF2AK3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Wolcott-Rallison syndrome MONDO:0009192;neonatal diabetes mellitus;epiphyseal dysplasia/osteopenia;hepatic/renal dysfunction;intellectual disability/developmental delay 10932183;12960215;16813601;11997520;20202148 False 3 100;0;0 1.2304 True ENSG00000172071 ENSG00000172071 HGNC:3255 EIF2AK4 gene EIF2AK4 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Pulmonary venoocclusive disease 2, MIM#234810 False 3 100;0;0 1.2304 True ENSG00000128829 ENSG00000128829 HGNC:19687 EIF2B1 gene EIF2B1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal leukoencephalopathy with vanishing white matter MONDO:0011380;ataxia;spasticity;optic atrophy;Neonatal diabetes mellitus, MONDO:0016391, EIF2B1-related 31882561;11835386;26285592;15776425;18263758;25843247;25761052;30014503 False 3 100;0;0 1.2304 True ENSG00000111361 ENSG00000111361 HGNC:3257 EIF2B2 gene EIF2B2 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter, MIM#603896;Ovarioleukodystrophy, MIM# 603896 21484434;14566705;28041799;30266093;28597716 False 3 100;0;0 1.2304 True ENSG00000119718 ENSG00000119718 HGNC:3258 EIF2B3 gene EIF2B3 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal leukoencephalopathy with vanishing white matter MONDO:0011380;ataxia;spasticity;optic atrophy 11835386;19158808;21484434;18263758;25843247;25761052;28904586;28597716 False 3 100;0;0 1.2304 True ENSG00000070785 ENSG00000070785 HGNC:3259 EIF2B4 gene EIF2B4 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal "Leukoencephalopathy with vanishing white matter, MIM# 603896;leukoencephalopathy with vanishing white matter MONDO:0011380;ataxia;spasticity;optic atrophy;primary ovarian failure" 11835386;12707859;18263758;25843247;25761052;30014503 False 3 100;0;0 1.2304 True ENSG00000115211 ENSG00000115211 HGNC:3260 EIF2B5 gene EIF2B5 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal leukoencephalopathy with vanishing white matter MONDO:0011380;ataxia;spasticity;optic atrophy;primary ovarian failure 11704758;12325082;12707859;14694060;15136689;18263758;25843247;25761052 False 3 100;0;0 1.2304 True ENSG00000145191 ENSG00000145191 HGNC:3261 EIF2S3 gene EIF2S3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females MEHMO syndrome, MIM# 300148 23063529;27333055;28055140;32799315 False 3 100;0;0 1.2304 True ENSG00000130741 ENSG00000130741 HGNC:3267 EIF3F gene EIF3F Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Mental retardation, autosomal recessive 67, MIM# 618295" 30409806;33736665 False 3 100;0;0 1.2304 True ENSG00000175390 ENSG00000175390 HGNC:3275 EIF4A2 gene EIF4A2 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Neurodevelopmental disorder with hypotonia and speech delay, with or without seizures, MIM# 620455" PMID: 36528028 False 3 100;0;0 1.2304 True Other ENSG00000156976 ENSG00000156976 HGNC:3284 EIF4A3 gene EIF4A3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Robin sequence with cleft mandible and limb anomalies, MIM# 268305;Richieri-Costa-Pereira syndrome 24360810 False 3 100;0;0 1.2304 True ENSG00000141543 ENSG00000141543 HGNC:18683 EIF5A gene EIF5A Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Faundes-Banka syndrome, MIM# 619376;Intellectual disability;microcephaly;dysmorphism 33547280 False 3 100;0;0 1.2304 True ENSG00000132507 ENSG00000132507 HGNC:3300 ELAC2 gene ELAC2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 17, MIM#615440 23849775;31045291 False 3 100;0;0 1.2304 True ENSG00000006744 ENSG00000006744 HGNC:14198 ELANE gene ELANE Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neutropaenia, severe congenital 1, autosomal dominant, MIM# 202700;Neutropaenia, cyclic, MIM# 162800 19036076;33968054;3124897 False 3 100;0;0 1.2304 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000197561 ENSG00000197561 HGNC:3309 ELMO2 gene ELMO2 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Vascular malformation, primary intraosseous, MIM#606893 27476657 False 3 100;0;0 1.2304 True ENSG00000062598 ENSG00000062598 HGNC:17233 ELN gene ELN Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted cutis laxa, autosomal dominant 1 MONDO:0007411;supravalvular aortic stenosis MONDO:0008504 8132745;9580666;9873040;10190324;10190538;22573328;28383366 False 3 100;0;0 1.2304 True ENSG00000049540 ENSG00000049540 HGNC:3327 ELOVL1 gene ELOVL1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ichthyotic keratoderma, spasticity, hypomyelination, and dysmorphic facies MIM#618527 False 3 33;33;33 1.2304 True ENSG00000066322 ENSG00000066322 HGNC:14418 ELOVL4 gene ELOVL4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal congenital ichthyosis-intellectual disability-spastic quadriplegia syndrome MONDO:0013760;spinocerebellar ataxia type 34 MONDO:0007574;Stargardt disease MONDO:0019353 11138005;15028284;11726641;17208947;22100072;24566826;34227061;24571530;26010696 False 3 100;0;0 1.2304 True ENSG00000118402 ENSG00000118402 HGNC:14415 ELOVL5 gene ELOVL5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted spinocerebellar ataxia type 38 MONDO:0014417 25065913 False 3 100;0;0 1.2304 True ENSG00000012660 ENSG00000012660 HGNC:21308 ELP1 gene ELP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Dysautonomia, familial MIM#223900;paediatric medulloblastoma;neurodevelopmental disorder, MONDO:0700092, ELP1-related 11179008;32296180;36864284 False 3 67;0;33 1.2304 True ENSG00000070061 ENSG00000070061 HGNC:5959 ELP2 gene ELP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal intellectual disability, autosomal recessive 58 MONDO:0014996 21937992;25847581;32573669;34653680 False 3 100;0;0 1.2304 True ENSG00000134759 ENSG00000134759 HGNC:18248 EMC1 gene EMC1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Cerebellar atrophy, visual impairment, and psychomotor retardation, MIM# 616875 26942288;29271071;35234901 False 3 100;0;0 1.2304 True ENSG00000127463 ENSG00000127463 HGNC:28957 EMC10 gene EMC10 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with dysmorphic facies and variable seizures, MIM# 619264 32869858 False 3 100;0;0 1.2304 True ENSG00000161671 ENSG00000161671 HGNC:27609 EMD gene EMD Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Emery-Dreifuss muscular dystrophy 1, X-linked MIM#310300 21697856;31802929 False 3 100;0;0 1.2304 True ENSG00000102119 ENSG00000102119 HGNC:3331 EMILIN1 gene EMILIN1 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Neuronopathy, distal hereditary motor, type X, MIM# 620080;Arterial tortuosity-bone fragility syndrome, MIM# 620908" PMID: 31978608;26462740;36351433 False 3 33;67;0 1.2304 True ENSG00000138080 ENSG00000138080 HGNC:19880 EML1 gene EML1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Band heterotopia (MIM# 600348) 31710781 False 3 100;0;0 1.2304 True ENSG00000066629 ENSG00000066629 HGNC:3330 EN1 gene EN1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal ENDOVE syndrome, limb-only type, MIM# 619217;ENDOVE syndrome, limb-brain type, MIM# 619218 33568816 False 3 100;0;0 1.2304 True ENSG00000163064 ENSG00000163064 HGNC:3342 ENAM gene ENAM Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Amelogenesis imperfecta, type IB, MIM# 104500;Amelogenesis imperfecta, type IC, MIM# 204650 11487571;28334996;14684688;33864320 False 3 100;0;0 1.2304 True ENSG00000132464 ENSG00000132464 HGNC:3344 ENG gene ENG Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted hereditary hemorrhagic telangiectasia MONDO:0019180 34012068;30336550;7894484;10751092;20414677;30763665;17384219;20364125 False 3 100;0;0 1.2304 True ENSG00000106991 ENSG00000106991 HGNC:3349 ENO3 gene ENO3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal glycogen storage disease due to muscle beta-enolase deficiency MONDO:0013046 11506403;31741825;25267339;18070103 False 3 100;0;0 1.2304 True ENSG00000108515 ENSG00000108515 HGNC:3354 ENPP1 gene ENPP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Arterial calcification, generalized, of infancy, 1, MIM# 208000;Cole disease, MIM# 615522;Hypophosphatemic rickets, autosomal recessive, 2, MIM# 613312 24075184;26617416;28964717;32598042;35220637;12881724;15605415;33005041;20016754;20137773;20137772 False 3 100;0;0 1.2304 True ENSG00000197594 ENSG00000197594 HGNC:3356 ENTPD1 gene ENTPD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 64, autosomal recessive MIM#615683 24482476;30652007;35471564 False 3 100;0;0 1.2304 True ENSG00000138185 ENSG00000138185 HGNC:3363 EOGT gene EOGT Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Adams-Oliver syndrome 4, MIM#615297 23522784;31368252;29924900;31368252 False 3 100;0;0 1.2304 True ENSG00000163378 ENSG00000163378 HGNC:28526 EP300 gene EP300 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Rubinstein-Taybi syndrome 2 MIM#613684;Menke-Hennekam syndrome 2 MIM#618333 29460469;24381114 False 3 100;0;0 1.2304 True ENSG00000100393 ENSG00000100393 HGNC:3373 EP400 gene EP400 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal neurodevelopmental disorder with or without early-onset generalized epilepsy - MONDO:0030930 39708813 False 3 100;0;0 1.2304 True ENSG00000183495 ENSG00000183495 HGNC:11958 EPAS1 gene EPAS1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Familial erythrocytosis (MIM#611783), AD 27292716;19208626 False 3 100;0;0 1.2304 True Other ENSG00000116016 ENSG00000116016 HGNC:3374 EPB41 gene EPB41 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Elliptocytosis-1, MIM# 611804 33942936;32807033;27667160;21839655 False 3 100;0;0 1.2304 True ENSG00000159023 ENSG00000159023 HGNC:3377 EPB41L3 gene EPB41L3 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal neurodevelopmental disorder with seizures, hypotonia, and brain imaging abnormalities MONDO:0030063 39292993 False 3 100;0;0 1.2304 True ENSG00000082397 ENSG00000082397 HGNC:3380 EPB42 gene EPB42 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spherocytosis, type 5, MIM# 612690 1558976;7803799;7772513 False 3 100;0;0 1.2304 True ENSG00000166947 ENSG00000166947 HGNC:3381 EPCAM gene EPCAM Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Diarrhea 5, with tufting enteropathy, congenital, MIM# 613217 24142340 False 3 100;0;0 1.2304 True ENSG00000119888 ENSG00000119888 HGNC:11529 EPG5 gene EPG5 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Vici syndrome, MIM# 242840 23222957;26917586 False 3 100;0;0 1.2304 True ENSG00000152223 ENSG00000152223 HGNC:29331 EPHA2 gene EPHA2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal cataract 6 multiple types MONDO:0007288;microphthalmia, MONDO:0021129, EPHA2-related 19005574;19649315;19306328;33671840;35918037;34638995 False 3 100;0;0 1.2304 True ENSG00000142627 ENSG00000142627 HGNC:3386 EPHB4 gene EPHB4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Capillary malformation-arteriovenous malformation 2 (MIM#618196), AD;Lymphatic malformation 7 (MIM#617300), AD 27400125;28687708;29444212;29905864;30578106;30819650 False 3 100;0;0 1.2304 True ENSG00000196411 ENSG00000196411 HGNC:3395 EPHX1 gene EPHX1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary lipodystrophy, MONDO:0020087, EPHX1-related 34342583 False 3 50;50;0 1.2304 True ENSG00000143819 ENSG00000143819 HGNC:3401 EPM2A gene EPM2A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Lafora disease MONDO:0009697 9771710;9931343;11175283;12019207;12560877;14722920 False 3 100;0;0 1.2304 True ENSG00000112425 ENSG00000112425 HGNC:3413 EPO gene EPO Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted erythrocytosis, familial, 5 MONDO:0033483 27651169;29514032;25985138;28283061 False 3 100;0;0 1.2304 True Other ENSG00000130427 ENSG00000130427 HGNC:3415 EPOR gene EPOR Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted primary familial polycythemia due to EPO receptor mutation MONDO:0007572 8506290;11559951;17488692;18492694;30507031 False 3 100;0;0 1.2304 True Other ENSG00000187266 ENSG00000187266 HGNC:3416 EPRS gene EPRS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 15, MIM# 617951 29576217 False 3 100;0;0 1.2304 True ENSG00000136628 ENSG00000136628 HGNC:3418 EPS8 gene EPS8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Autosomal recessive nonsyndromic hearing loss 102 MONDO:0014428 24741995;27344577;30303587;34637946;21526224 False 3 100;0;0 1.2304 True ENSG00000151491 ENSG00000151491 HGNC:3420 EPS8L2 gene EPS8L2 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Deafness autosomal recessive 106, MIM# 617637" 26282398;23918390;28281779 False 3 100;0;0 1.2304 True ENSG00000177106 ENSG00000177106 HGNC:21296 ERBB3 gene ERBB3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Lethal congenital contractural syndrome 2, MIM# 607598;Visceral neuropathy, familial, 1, autosomal recessive, MIM# 243180;Hirschsprung disease;Arthrogryposis;Complex neurocristinopathy 17701904;31752936;33720042;33497358 False 3 100;0;0 1.2304 True ENSG00000065361 ENSG00000065361 HGNC:3431 ERBB4 gene ERBB4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 19, MIM# MIM#615515;Intellectual disability MONDO:0001071 24119685;28889094;33603162 False 3 0;100;0 1.2304 True ENSG00000178568 ENSG00000178568 HGNC:3432 ERCC1 gene ERCC1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cerebrooculofacioskeletal syndrome 4, MIM# 610758;MONDO:0012554 17273966;23623389;33315086 False 3 100;0;0 1.2304 True ENSG00000012061 ENSG00000012061 HGNC:3433 ERCC2 gene ERCC2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cerebrooculofacioskeletal syndrome 2, MIM# 610756;MONDO:0012553;Trichothiodystrophy 1, photosensitive, MIM# 601675;MONDO:0011125;Xeroderma pigmentosum, group D, MIM# 278730;MONDO:0010212 7849702;9758621;11443545;33733458 False 3 100;0;0 1.2304 True ENSG00000104884 ENSG00000104884 HGNC:3434 ERCC3 gene ERCC3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Trichothiodystrophy 2, photosensitive, MIM# 616390;Xeroderma pigmentosum, group B 61, MIM#0651 2167179;10447254;16947863;9012405;32557569;27004399 False 3 100;0;0 1.2304 True ENSG00000163161 ENSG00000163161 HGNC:3435 ERCC4 gene ERCC4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Fanconi anemia, complementation group Q, MIM# 615272;MONDO:0014108;Xeroderma pigmentosum, group F, MIM# 278760;MONDO:0010215;XFE progeroid syndrome, MIM# 610965;MONDO:0012590 23623386;8797827;23623389;17183314;29105242 False 3 100;0;0 1.2304 True ENSG00000175595 ENSG00000175595 HGNC:3436 ERCC5 gene ERCC5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cerebrooculofacioskeletal syndrome 3, MIM# 616570 MONDO:0014696 Xeroderma pigmentosum, group G/Cockayne syndrome, MIM# 278780 MONDO:0010216 30838033;24700531;7951246;9096355;9096355;33766032;33219753 False 3 100;0;0 1.2304 True ENSG00000134899 ENSG00000134899 HGNC:3437 ERCC6 gene ERCC6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cockayne syndrome, type B, MIM#133540;Cerebrooculofacioskeletal syndrome 1, MIM#214150;De Sanctis-Cacchione syndrome, MIM#278800 20301516;20456449;9443879;8566949 False 3 100;0;0 1.2304 True ENSG00000225830 ENSG00000225830 HGNC:3438 ERCC6L2 gene ERCC6L2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bone marrow failure syndrome 2, MIM# 615715 24507776;27185855 False 3 100;0;0 1.2304 True ENSG00000182150 ENSG00000182150 HGNC:26922 ERCC8 gene ERCC8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cockayne syndrome, type A, MIM# 216400;MONDO:0019569;UV-sensitive syndrome 2, MIM# 614621;MONDO:0013829 7664335;19894250 False 3 100;0;0 1.2304 True ENSG00000049167 ENSG00000049167 HGNC:3439 ERF gene ERF Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Craniosynostosis 4, MIM# 600775;Chitayat syndrome, MIM# 617180;Noonan syndrome-like, MONDO:0018997, with or without craniosynostosis, ERF-related 23354439;26097063;32370745;30758909;27738187 False 3 100;0;0 1.2304 True ENSG00000105722 ENSG00000105722 HGNC:3444 ERG gene ERG Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Lymphatic malformation 14, MIM# 620602;Myelodysplasia syndrome, MONDO:0018881, ERG-related 36928819 False 3 50;50;0 1.2304 True ENSG00000157554 ENSG00000157554 HGNC:3446 ERGIC1 gene ERGIC1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Arthrogryposis multiplex congenita 2, neurogenic type;OMIM # 208100 28317099;34037256;31230720 False 3 100;0;0 1.2304 True ENSG00000113719 ENSG00000113719 HGNC:29205 ERI1 gene ERI1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Hoxha-Aliu syndrome, MIM# 620662;Spondyloepimetaphyseal dysplasia, Guo-Salian type, MIM# 620663 37352860 False 3 100;0;0 1.2304 True ENSG00000104626 ENSG00000104626 HGNC:23994 ERLEC1 gene ERLEC1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted autosomal dominant prognathism MONDO:0008312 32442352 False 3 100;0;0 1.2304 True ENSG00000068912 ENSG00000068912 HGNC:25222 ERLIN1 gene ERLIN1 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 62 MIM#615681 24482476 False 3 100;0;0 1.2304 True ENSG00000107566 ENSG00000107566 HGNC:16947 ERLIN2 gene ERLIN2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Spastic paraplegia 18, autosomal recessive, MIM# 611225;Spastic paraplegia 18A, autosomal dominant, MIM# 620512 23109145;21330303;21796390;29528531;32094424;34734492 False 3 100;0;0 1.2304 True ENSG00000147475 ENSG00000147475 HGNC:1356 ESAM gene ESAM Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with intracranial haemorrhage, seizures, and spasticity, MIM# 620371 36996813 False 3 100;0;0 1.2304 True ENSG00000149564 ENSG00000149564 HGNC:17474 ESCO2 gene ESCO2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Juberg-Hayward syndrome, MIM# 216100;Roberts-SC phocomelia syndrome, MIM#268300 32977150 False 3 100;0;0 1.2304 True ENSG00000171320 ENSG00000171320 HGNC:27230 ESPN gene ESPN Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Deafness, autosomal recessive 36, MIM# 609006;Deafness, neurosensory, without vestibular involvement, autosomal dominant, MIM# 609006 15286153;18973245;26445815;28281779;10975527;15930085 False 3 100;0;0 1.2304 True ENSG00000187017 ENSG00000187017 HGNC:13281 ESR1 gene ESR1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Estrogen resistance, MIM# 615363 27754803;23841731;24152274 False 3 100;0;0 1.2304 True ENSG00000091831 ENSG00000091831 HGNC:3467 ESRRB gene ESRRB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 35, MIM#608565 18179891;31389194;32681043 False 3 100;0;0 1.2304 True ENSG00000119715 ENSG00000119715 HGNC:3473 ETFA gene ETFA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal multiple acyl-CoA dehydrogenase deficiency MONDO:0009282 1430199;1882842;21347544 False 3 100;0;0 1.2304 True ENSG00000140374 ENSG00000140374 HGNC:3481 ETFB gene ETFB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal multiple acyl-CoA dehydrogenase deficiency MONDO:0009282 7912128;12815589;27081516;12706375;30626930 False 3 100;0;0 1.2304 True ENSG00000105379 ENSG00000105379 HGNC:3482 ETFDH gene ETFDH Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal multiple acyl-CoA dehydrogenase deficiency MONDO:0009282 17412732;27038534;19249206;15710863;32804429 False 3 100;0;0 1.2304 True ENSG00000171503 ENSG00000171503 HGNC:3483 ETHE1 gene ETHE1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ethylmalonic encephalopathy, MIM#602473 14732903;28933811 False 3 100;0;0 1.2304 True ENSG00000105755 ENSG00000105755 HGNC:23287 ETV6 gene ETV6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Thrombocytopaenia 5, MIM# 616216 25581430;25807284 False 3 100;0;0 1.2304 True ENSG00000139083 ENSG00000139083 HGNC:3495 EVC gene EVC Expert Review;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ellis-van Creveld syndrome, MIM# 225500 23220543 False 3 33;67;0 1.2304 True ENSG00000072840 ENSG00000072840 HGNC:3497 EVC2 gene EVC2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ellis-van Creveld syndrome (MIM#225500) 23220543 False 3 100;0;0 1.2304 True ENSG00000173040 ENSG00000173040 HGNC:19747 EXOC3L2 gene EXOC3L2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Brain malformation renal syndrome, MIM# 620943 30327448;27894351;28749478 False 3 100;0;0 1.2304 True ENSG00000130201 ENSG00000283632 HGNC:30162 EXOC6B gene EXOC6B Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Spondyloepimetaphyseal dysplasia with joint laxity MONDO:0019675 26669664;30284759;36150098 False 3 100;0;0 1.2304 True ENSG00000144036 ENSG00000144036 HGNC:17085 EXOC7 gene EXOC7 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with seizures and brain atrophy MIM#619072;brain atrophy;seizures;developmental delay;microcephaly 32103185 False 3 100;0;0 1.2304 True ENSG00000182473 ENSG00000182473 HGNC:23214 EXOSC3 gene EXOSC3 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 1B, MIM# 614678 22544365;23284067;24524299 False 3 100;0;0 1.2304 True ENSG00000107371 ENSG00000107371 HGNC:17944 EXOSC5 gene EXOSC5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, brain abnormalities, and cardiac conduction defects, MIM# 619576;Short stature;Motor developmental delays;Cerebellar hypoplasia;Ataxia 32504085;29302074 False 3 100;0;0 1.2304 True ENSG00000077348 ENSG00000077348 HGNC:24662 EXOSC8 gene EXOSC8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 1C, MIM# 616081 24989451 False 3 100;0;0 1.2304 True ENSG00000120699 ENSG00000120699 HGNC:17035 EXOSC9 gene EXOSC9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 1D, MIM# 618065 30690203;29727687 False 3 100;0;0 1.2304 True ENSG00000123737 ENSG00000123737 HGNC:9137 EXPH5 gene EXPH5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Epidermolysis bullosa, nonspecific, autosomal recessive, MIM# 615028 23176819;32176379;27730671;27384765 False 3 100;0;0 1.2304 True ENSG00000110723 ENSG00000110723 HGNC:30578 EXT1 gene EXT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted hereditary multiple osteochondromas MONDO:0005508;exostoses, multiple, type 1 MONDO:0007585 7550340;8981950;20534475 False 3 100;0;0 1.2304 True ENSG00000182197 ENSG00000182197 HGNC:3512 EXT2 gene EXT2 Expert Review;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Seizures, scoliosis, and macrocephaly syndrome, MIM#616682 False 3 100;0;0 1.2304 True ENSG00000151348 ENSG00000151348 HGNC:3513 EXTL3 gene EXTL3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunoskeletal dysplasia with neurodevelopmental abnormalities, MIM# 617425 28132690;28148688;28331220 False 3 100;0;0 1.2304 True ENSG00000012232 ENSG00000012232 HGNC:3518 EYA1 gene EYA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Anterior segment anomalies with or without cataract MIM#602588;Branchiootic syndrome 1 MIM#602588;Branchiootorenal syndrome 1, with or without cataracts MIM#113650 9359046;13269867 False 3 100;0;0 1.2304 True ENSG00000104313 ENSG00000104313 HGNC:3519 EYA4 gene EYA4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Deafness, autosomal dominant 10, MIM# 601316;Cardiomyopathy, dilated, 1J, MIM# 605362 11159937; 17568404;25681523;25963406;25242383;26331839;18219393;27545760;15735644;10769282;30155266 False 3 100;0;0 1.2304 True ENSG00000112319 ENSG00000112319 HGNC:3522 EYS gene EYS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Retinitis pigmentosa 25 MONDO:0011272 18836446;18976725;34689181 False 3 100;0;0 1.2304 True ENSG00000188107 ENSG00000188107 HGNC:21555 EZH1 gene EZH1 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodevelopmental disorder (MONDO:0700092), EZH1-related 37433783 False 3 100;0;0 1.2304 True ENSG00000108799 ENSG00000108799 HGNC:3526 EZH2 gene EZH2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Weaver syndrome MIM#277590 29244146;23865096 False 3 100;0;0 1.2304 True ENSG00000106462 ENSG00000106462 HGNC:3527 F10 gene F10 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Factor X deficiency, MIM# 227600;MONDO:0009212 2790181;2567188;10746568;12028042 False 3 100;0;0 1.2304 True ENSG00000126218 ENSG00000126218 HGNC:3528 F11 gene F11 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Factor XI deficiency, autosomal dominant 612416;Factor XI deficiency, autosomal recessive, MIM#612416 18446632;15026311 False 3 100;0;0 1.2304 True ENSG00000088926 ENSG00000088926 HGNC:3529 F12 gene F12 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary angioedema type 3 MONDO:0012526 26193639;16638441;17381464;21849258;17186468;19178938;30463937;23994767 False 3 100;0;0 1.2304 True Other ENSG00000131187 ENSG00000131187 HGNC:3530 F13A1 gene F13A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Factor XIIIA deficiency, MIM# 613225;MONDO:0013187 1644910;7727776;10027709;33802692;32060721 False 3 100;0;0 1.2304 True ENSG00000124491 ENSG00000124491 HGNC:3531 F13B gene F13B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Factor XIIIB deficiency, 613235 20331752;26247044 False 3 100;0;0 1.2304 True ENSG00000143278 ENSG00000143278 HGNC:3534 F2 gene F2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal {Pregnancy loss, recurrent, susceptibility to, 2} 614390 AD;{Stroke, ischemic, susceptibility to} 601367 Mu;Dysprothrombinemia 613679 AR;Hypoprothrombinemia 613679 AR;Thrombophilia due to thrombin defect 188050 AD 30297698 False 3 100;0;0 1.2304 True ENSG00000180210 ENSG00000180210 HGNC:3535 F5 gene F5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Factor V deficiency, MIM# 227400;MONDO:0009210;Thrombophilia due to activated protein C resistance, MIM# 188055;MONDO:0008560;{Thrombophilia, susceptibility to, due to factor V Leiden}, MIM# 188055 False 3 100;0;0 1.2304 True ENSG00000198734 ENSG00000198734 HGNC:3542 F7 gene F7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Factor VII deficiency, MIM# 227500;MONDO:0009211 12181036 False 3 100;0;0 1.2304 True ENSG00000057593 ENSG00000057593 HGNC:3544 F8 gene F8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females "Haemophilia A, MIM# 306700;MONDO:0010602;Thrombophilia 13, X-linked, due to factor VIII defect, MIM# 301071" 2986011;3097553 False 3 100;0;0 1.2304 True ENSG00000185010 ENSG00000185010 HGNC:3546 F9 gene F9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Haemophilia B, MIM# 306900;Thrombophilia, X-linked, due to factor IX defect, MIM# 300807 19846852;34015304;33656538 False 3 100;0;0 1.2304 True ENSG00000101981 ENSG00000101981 HGNC:3551 FA2H gene FA2H Expert Review;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 35, autosomal recessive, MIM#611026 29423566;31135052;18463364;19068277;20104589 False 3 100;0;0 1.2304 True ENSG00000103089 ENSG00000103089 HGNC:21197 FADD gene FADD Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal FADD-related immunodeficiency MONDO:0013408 21109225;25794656;32350755;32971525 False 3 100;0;0 1.2304 True ENSG00000168040 ENSG00000168040 HGNC:3573 FAH gene FAH Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Tyrosinemia type I MONDO:0010161 8253378;1401056;8364576;8318997;25681080 False 3 100;0;0 1.2304 True ENSG00000103876 ENSG00000103876 HGNC:3579 FAM111A gene FAM111A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted autosomal dominant Kenny-Caffey syndrome MONDO:0007478 23684011;32996714;32765931;33010201 False 3 100;0;0 1.2304 True Other ENSG00000166801 ENSG00000166801 HGNC:24725 FAM111B gene FAM111B Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted hereditary sclerosing poikiloderma with tendon and pulmonary involvement MONDO:0014310 24268661;26471370;26495788;27406236 False 3 100;0;0 1.2304 True Other ENSG00000189057 ENSG00000189057 HGNC:24200 FAM126A gene FAM126A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal hypomyelinating leukodystrophy 5 MONDO:0012514 21911699;17928815;17683097;16951682;23998934;22749724 False 3 100;0;0 1.2304 True ENSG00000122591 ENSG00000122591 HGNC:24587 FAM149B1 gene FAM149B1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 36 MONDO:0032902;Ciliopathy PMID: 30905400 False 3 100;0;0 1.2304 True ENSG00000138286 ENSG00000138286 HGNC:29162 FAM161A gene FAM161A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal retinitis pigmentosa 28 MONDO:0011630 20705278;20705279;31236346;24833722 False 3 100;0;0 1.2304 True ENSG00000170264 ENSG00000170264 HGNC:25808 FAM177A1 gene FAM177A1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO_0100500, FAM177A1-related PMID: 38767059, 25558065 False 3 100;0;0 1.2304 True ENSG00000151327 ENSG00000151327 HGNC:19829 FAM20A gene FAM20A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Amelogenesis imperfecta, type IG (enamel-renal syndrome) MIM#204690 23434854;23697977;23468644;24756937;21549343;24259279;24196488;26502894;25827751;21990045 False 3 100;0;0 1.2304 True ENSG00000108950 ENSG00000108950 HGNC:23015 FAM20C gene FAM20C Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Raine syndrome, MIM# 259775;MONDO:0009821 19250384;32299476;20825432;33676444;32833257 False 3 100;0;0 1.2304 True ENSG00000177706 ENSG00000177706 HGNC:22140 FAM46A gene FAM46A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Osteogenesis imperfecta, type XVIII MIM#617952 29358272 False 3 100;0;0 1.2304 True ENSG00000112773 ENSG00000112773 HGNC:18345 FAM50A gene FAM50A Expert Review Green;Literature Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Mental retardation syndrome, X-linked, Armfield type (MIM #300261) 32703943 False 3 100;0;0 1.2304 True ENSG00000071859 ENSG00000071859 HGNC:18786 FAM57B gene FAM57B Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Cone-rod dystrophy 22, MIM# 619531;Maculopathy 33077892 False 3 100;0;0 1.2304 True ENSG00000149926 ENSG00000149926 HGNC:25295 FAM58A gene FAM58A Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) syndactyly-telecanthus-anogenital and renal malformations syndrome MONDO:0010408 18297069;8818947;28322501;8818947 False 3 100;0;0 1.2304 True - ENSG00000262919 HGNC:28434 FAM83H gene FAM83H Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amelogenesis imperfecta, type IIIA MIM#130900 18484629;19407157;19825039;26481691;21702852;20160442;26142250;22414746;19828885;19220331;26502894;18252228;21597265;21118793;26788537;26171361 False 3 100;0;0 1.2304 True ENSG00000180921 ENSG00000180921 HGNC:24797 FAN1 gene FAN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Interstitial nephritis, karyomegalic, MIM# 614817 22772369;16678356;7847351;8546134 False 3 100;0;0 1.2304 True ENSG00000198690 ENSG00000198690 HGNC:29170 FANCA gene FANCA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Fanconi anaemia, complementation group A, MIM# 227650;MONDO:0009215 10094191 False 3 100;0;0 1.2304 True ENSG00000187741 ENSG00000187741 HGNC:3582 FANCB gene FANCB Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Fanconi anaemia, complementation group B, MIM# 300514;MONDO:0010351 15502827 False 3 100;0;0 1.2304 True ENSG00000181544 ENSG00000181544 HGNC:3583 FANCC gene FANCC Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Fanconi anemia, complementation group C, MIM# 227645;MONDO:0009213 31044565;30792206;28717661 False 3 100;0;0 1.2304 True ENSG00000158169 ENSG00000158169 HGNC:3584 FANCD2 gene FANCD2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Fanconi anemia, complementation group D2, MIM#227646;MONDO:0009214 False 3 100;0;0 1.2304 True ENSG00000144554 ENSG00000144554 HGNC:3585 FANCE gene FANCE Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Fanconi anaemia, complementation group E, MIM# 600901;MONDO:0010953 11001585;31586946;7662964;9382107;9147877;10205272 False 3 100;0;0 1.2304 True ENSG00000112039 ENSG00000112039 HGNC:3586 FANCF gene FANCF Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Fanconi anaemia, complementation group F 603467;MONDO:0011325 10615118;31288759 False 3 100;0;0 1.2304 True ENSG00000183161 ENSG00000183161 HGNC:3587 FANCG gene FANCG Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Fanconi anaemia, complementation group G, MIM# 614082;MONDO:0013565 9806548;12552564 False 3 100;0;0 1.2304 True ENSG00000221829 ENSG00000221829 HGNC:3588 FANCI gene FANCI Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Fanconi anemia, complementation group I, MIM# 609053;MONDO:0012186;primary ovarian failure MONDO:0005387, FANCI-related 17452773 False 3 50;50;0 1.2304 True ENSG00000140525 ENSG00000140525 HGNC:25568 FANCL gene FANCL Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Fanconi anemia, complementation group L, MIM# 614083;MONDO:0013566 19405097;25754594;33394227;33224012 False 3 100;0;0 1.2304 True ENSG00000115392 ENSG00000115392 HGNC:20748 FANCM gene FANCM Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spermatogenic failure 28, MIM# 618086;Premature ovarian failure 15 MIM#618096 30075111;29895858;28837162;29231814;33036707;25010009 False 3 50;50;0 1.2304 True ENSG00000187790 ENSG00000187790 HGNC:23168 FAR1 gene FAR1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Peroxisomal fatty acyl-CoA reductase 1 disorder, MIM#616154;Cataracts, spastic paraparesis, and speech delay, MIM#619338 25439727;33239752 False 3 100;0;0 1.2304 True ENSG00000197601 ENSG00000197601 HGNC:26222 FARS2 gene FARS2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal combined oxidative phosphorylation defect type 14 MONDO:0013986;hereditary spastic paraplegia 77 MONDO:0014882 30250868;30177229;29126765;28043061 False 3 100;0;0 1.2304 True ENSG00000145982 ENSG00000145982 HGNC:21062 FARSA gene FARSA Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Rajab interstitial lung disease with brain calcifications 2, MIM# 619013" 31355908 False 3 100;0;0 1.2304 True ENSG00000179115 ENSG00000179115 HGNC:3592 FARSB gene FARSB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Rajab interstitial lung disease with brain calcifications 1 MONDO:0100215 29573043;30014610;29979980 False 3 100;0;0 1.2304 True ENSG00000116120 ENSG00000116120 HGNC:17800 FAS gene FAS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal autoimmune lymphoproliferative syndrome MONDO:0017979 7540117;7539157;15459302;33995372;34171534 False 3 100;0;0 1.2304 True ENSG00000026103 ENSG00000026103 HGNC:11920 FASLG gene FASLG Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal autoimmune lymphoproliferative syndrome MONDO:0017979 16627752;17605793;19794494;8787672;22857792;33356695;26334989;25451160 False 3 100;0;0 1.2304 True ENSG00000117560 ENSG00000117560 HGNC:11936 FASTKD2 gene FASTKD2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 44, MIM# 618855;FASTKD2-related infantile mitochondrial encephalomyopathy MONDO:0015632 18771761;28499982;31944455;34234304 False 3 100;0;0 1.2304 True ENSG00000118246 ENSG00000118246 HGNC:29160 FAT1 gene FAT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal syndromic disease MONDO:0002254, FAT1-related;facial dysmorphism;colobomatous microphthalmia;ptosis;syndactyly with or without nephropathy 30862798 False 3 100;0;0 1.2304 True ENSG00000083857 ENSG00000083857 HGNC:3595 FAT2 gene FAT2 Expert list;Expert Review Green;GeneReviews;Royal Melbourne Hospital Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 45, MIM#617769 33884300;29053796 False 3 33;67;0 1.2304 True ENSG00000086570 ENSG00000086570 HGNC:3596 FAT4 gene FAT4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hennekam lymphangiectasia-lymphedema syndrome 2 MIM#616006;Van Maldergem syndrome 2 MIM#615546 29681106 False 3 100;0;0 1.2304 True ENSG00000196159 ENSG00000196159 HGNC:23109 FBLN5 gene FBLN5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Cutis laxa, autosomal recessive, type IA, MIM#219100;Neuropathy, hereditary, with or without age-related macular degeneration (MIM#608895) 12618961;3232707;22829427;11805835;32757322;31945625;23328402;28332470 False 3 100;0;0 1.2304 True ENSG00000140092 ENSG00000140092 HGNC:3602 FBN2 gene FBN2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Contractural arachnodactyly, congenital 121050;Macular degeneration, early-onset 616118 19473076;11068201;27007659;24899048;33571691 False 3 100;0;0 1.2304 True ENSG00000138829 ENSG00000138829 HGNC:3604 FBP1 gene FBP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal fructose-1,6-bisphosphatase deficiency MONDO:0009251 9382095;12126934;27101822;30858132 False 3 100;0;0 1.2304 True ENSG00000165140 ENSG00000165140 HGNC:3606 FBRSL1 gene FBRSL1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown syndromic disease MONDO:0002254, FBRSL1-related;Malformation and intellectual disability syndrome PMID: 32424618 False 3 100;0;0 1.2304 True ENSG00000112787 ENSG00000112787 HGNC:29308 FBXL3 gene FBXL3 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Intellectual developmental disorder with short stature, facial anomalies, and speech defects;OMIM #606220 30481285 False 3 100;0;0 1.2304 True ENSG00000005812 ENSG00000005812 HGNC:13599 FBXL4 gene FBXL4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 13 (encephalomyopathic type) MIM#615471 28940506 False 3 100;0;0 1.2304 True ENSG00000112234 ENSG00000112234 HGNC:13601 FBXO11 gene FBXO11 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual Developmental Disorder with Dysmorphic Facies and Behavioural Abnormalities, MIM#618089 30679813;30057029;29796876 False 3 100;0;0 1.2304 True ENSG00000138081 ENSG00000138081 HGNC:13590 FBXO28 gene FBXO28 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 100, MIM# 619777 33280099 False 3 100;0;0 1.2304 True ENSG00000143756 ENSG00000143756 HGNC:29046 FBXO31 gene FBXO31 Expert list;Expert Review Green Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Intellectual developmental disorder, autosomal recessive 45 (MIM#615979;Cerebral palsy, MONDO:0006497, FBXO31-related;Spastic-dystonic cerebral palsy, intellectual disability, de novo dominant 24623383;32989326;35019165;33675180 False 3 50;50;0 1.2304 True Other ENSG00000103264 ENSG00000103264 HGNC:16510 FBXO7 gene FBXO7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal parkinsonian-pyramidal syndrome MONDO:0009830 18513678;19038853;34781237 False 3 100;0;0 1.2304 True ENSG00000100225 ENSG00000100225 HGNC:13586 FBXW11 gene FBXW11 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental, eye, jaw, and digital syndrome (NDEJD), MIM#618914;Intellectual disability;developmental eye anomalies;digital anomalies PMID: 31402090 False 3 100;0;0 1.2304 True ENSG00000072803 ENSG00000072803 HGNC:13607 FBXW7 gene FBXW7 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental delay, hypotonia, and impaired language, MIM# 620012;Wilms tumour predisposition 33057194;30885698;26482194 False 3 67;33;0 1.2304 True ENSG00000109670 ENSG00000109670 HGNC:16712 FCHO1 gene FCHO1 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 76, MIM# 619164;Combined immunodeficiency;T cells: low, poor proliferation;B cells: normal number;Recurrent infections (viral, mycobacteria, bacterial, fungal);lymphoproliferation;Failure to thrive;Increased activation-induced T-cell death;Defective clathrin-mediated endocytosis 32098969;30822429 False 3 100;0;0 1.2304 True ENSG00000130475 ENSG00000130475 HGNC:29002 FDFT1 gene FDFT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal squalene synthase deficiency MONDO:0032566 29909962 False 3 100;0;0 1.2304 True ENSG00000079459 ENSG00000079459 HGNC:3629 FDX2 gene FDX2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal inborn mitochondrial myopathy MONDO:0009637 24281368;28803783;30010796;35079622;34905296 False 3 100;0;0 1.2304 True ENSG00000267673 ENSG00000267673 HGNC:30546 FDXR gene FDXR Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Auditory neuropathy and optic atrophy, MIM#617717;Neurodevelopmental disorder with mitochondrial abnormalities, optic atrophy, and developmental regression, MIM# 620887 30250212;28965846;29040572;33348459;37046037;37481223 False 3 100;0;0 1.2304 True ENSG00000161513 ENSG00000161513 HGNC:3642 FECH gene FECH Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Protoporphyria, erythropoietic, 1 177000 AR 20105171;23016163 False 3 100;0;0 1.2304 True ENSG00000066926 ENSG00000066926 HGNC:3647 FEM1B gene FEM1B Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Syndromic disease MONDO:0002254, FEM1B-related 31036916;38465576 False 3 50;50;0 1.2304 True ENSG00000169018 ENSG00000169018 HGNC:3649 FEM1C gene FEM1C Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder, FEM1C-related MONDO:0700092 36336956;28135719;33398170;33398168 False 3 100;0;0 1.2304 True ENSG00000145780 ENSG00000145780 HGNC:16933 FERMT1 gene FERMT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Kindler syndrome, MIM# 173650 12789646 False 3 100;0;0 1.2304 True ENSG00000101311 ENSG00000101311 HGNC:15889 FERMT3 gene FERMT3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Leukocyte adhesion deficiency, type III, MIM# 612840 19234460;19064721 False 3 100;0;0 1.2304 True ENSG00000149781 ENSG00000149781 HGNC:23151 FEZF2 gene FEZF2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted neurodevelopmental disorder MONDO:0700092, FEZF2-related 38425142 False 3 100;0;0 1.2304 True ENSG00000153266 ENSG00000153266 HGNC:13506 FGA gene FGA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Afibrinogenemia, congenital (MIM#202400), AR;Amyloidosis, familial visceral (MIM#105200), AD 31064749;17295221;19073821;11739173 False 3 100;0;0 1.2304 True ENSG00000171560 ENSG00000171560 HGNC:3661 FGB gene FGB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Afibrinogenaemia, congenital, MIM# 202400;Hypofibrinogenaemia, congenital, MIM# 202400;Dysfibrinogenaemia, congenital, MIM# 616004 12393540;16195396 False 3 100;0;0 1.2304 True ENSG00000171564 ENSG00000171564 HGNC:3662 FGD1 gene FGD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Aarskog-Scott syndrome, MIM # 305400;Mental retardation, X-linked syndromic 16, MIM# 305400 7954831;20082460 False 3 100;0;0 1.2304 True ENSG00000102302 ENSG00000102302 HGNC:3663 FGD4 gene FGD4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Charcot Marie Tooth disease, type 4H, 609311;MONDO:0012250 17564959;31152969;28847448;28543957 False 3 100;0;0 1.2304 True ENSG00000139132 ENSG00000139132 HGNC:19125 FGF10 gene FGF10 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted congenital alveolar dysplasia due to FGF10 MONDO:0100090;acinar dysplasia caused by mutation in FGF10 MONDO:0600017 9916808;15654336;16501574;16630169;17213838;33967277;30639323 False 3 100;0;0 1.2304 True ENSG00000070193 ENSG00000070193 HGNC:3666 FGF12 gene FGF12 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 47, MIM# 617166 32645220;27164707;27830185;27872899 False 3 100;0;0 1.2304 True ENSG00000114279 ENSG00000114279 HGNC:3668 FGF13 gene FGF13 Expert Review Green;Literature Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Developmental and epileptic encephalopathy 90, MIM# 301058;Intellectual developmental disorder, X-linked 110, MIM# 301095 33245860;34184986 False 3 100;0;0 1.2304 True Other ENSG00000129682 ENSG00000129682 HGNC:3670 FGF14 gene FGF14 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 27, MIM# 609307;Vestibulocerebellar disorder with predominant ocular signs, MIM# 193003 12123606;12489043;15470364;29253853;30017992;32112487;32162847 False 3 100;0;0 1.2304 True ENSG00000102466 ENSG00000102466 HGNC:3671 FGF16 gene FGF16 Expert list;Expert Review Green Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females "Metacarpal 4-5 fusion, MIM# 309630" False 3 100;0;0 1.2304 True ENSG00000196468 ENSG00000196468 HGNC:3672 FGF17 gene FGF17 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypogonadotropic hypogonadism 20 with or without anosmia MIM#615270 31200363;31748124;23643382 False 3 100;0;0 1.2304 True ENSG00000158815 ENSG00000158815 HGNC:3673 FGF23 gene FGF23 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal autosomal dominant hypophosphatemic rickets MONDO:0008660;familial hyperphosphatemic tumoral calcinosis/hyperphosphatemic hyperostosis syndrome MONDO:0100251 11062477;14966565;15590700;16151858;16030159;25378588;34444516 False 3 100;0;0 1.2304 True Other ENSG00000118972 ENSG00000118972 HGNC:3680 FGF3 gene FGF3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, congenital with inner ear agenesis, microtia, and microdontia, MIM#610706 21480479;21306635;18435799;17236138;21306635;18701883;8223243;26995070;29902227;30504125 False 3 100;0;0 1.2304 True ENSG00000186895 ENSG00000186895 HGNC:3681 FGF5 gene FGF5 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal hypertrichosis MONDO:0019280 24989505 False 3 100;0;0 1.2304 True ENSG00000138675 ENSG00000138675 HGNC:3683 FGF8 gene FGF8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypogonadotropic hypogonadism 6 with or without anosmia, MIM# 612702;Hypoplastic femurs and pelvis, MIM#619545 34433009 False 3 50;50;0 1.2304 True ENSG00000107831 ENSG00000107831 HGNC:3686 FGF9 gene FGF9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Multiple synostoses syndrome 3, OMIM # 612961;Craniosynostosis 33140402;28730625;19589401;33174625;19219044;28730625 False 3 100;0;0 1.2304 True ENSG00000102678 ENSG00000102678 HGNC:3687 FGFR1 gene FGFR1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Encephalocraniocutaneous lipomatosis, somatic mosaic 613001;Hartsfield syndrome 615465;Hypogonadotropic hypogonadism 2 with or without anosmia 147950;Jackson-Weiss syndrome 123150;Osteoglophonic dysplasia 166250;Pfeiffer syndrome 101600;Trigonocephaly 1 190440 18034870;23812909;26942290 False 3 100;0;0 1.2304 True Other ENSG00000077782 ENSG00000077782 HGNC:3688 FGFR2 gene FGFR2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Antley-Bixler syndrome without genital anomalies or disordered steroidogenesis,MIM# 207410;Apert syndrome, MIM# 101200;Beare-Stevenson cutis gyrata syndrome, MIM# 123790;Bent bone dysplasia syndrome, MIM# 614592;Craniofacial-skeletal-dermatologic dysplasia, MIM# 101600;Craniosynostosis, nonspecific;Crouzon syndrome , MIM#123500;Jackson-Weiss syndrome,MIM# 123150;LADD syndrome, MIM# 149730;Pfeiffer syndrome,MIM# 101600;Saethre-Chotzen syndrome 101400" 29848297;32879300;27323706 False 3 100;0;0 1.2304 True ENSG00000066468 ENSG00000066468 HGNC:3689 FGFR3 gene FGFR3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted achondroplasia MONDO:0007037;Thanatophoric dysplasia type 1 MONDO:0008546;Thanatophoric dysplasia type 2 MONDO:0008547;hypochondroplasia MONDO:0007793;Muenke syndrome MONDO:0011274;FGFR3-related chondrodysplasia MONDO:0019685;severe achondroplasia-developmental delay-acanthosis nigricans syndrome MONDO:0014658;Crouzon syndrome-acanthosis nigricans syndrome MONDO:0012833;camptodactyly-tall stature-scoliosis-hearing loss syndrome MONDO:0012504 8630492;32641982;27139183;24864036;17033969;20301331;20301540;20301650;20301628 False 3 50;50;0 1.2304 True Other ENSG00000068078 ENSG00000068078 HGNC:3690 FGG gene FGG Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal congenital fibrinogen deficiency MONDO:0018060 2713997;11001902;11001903;9746756;23560673;28992465;10980108;15304068 False 3 100;0;0 1.2304 True ENSG00000171557 ENSG00000171557 HGNC:3694 FH gene FH Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal hereditary leiomyomatosis and renal cell cancer MONDO:0007888;fumaric aciduria MONDO:0011730 11865300;28300276;20301430;8200987;20549362;31746132;20301679 False 3 100;0;0 1.2304 True ENSG00000091483 ENSG00000091483 HGNC:3700 FHL1 gene FHL1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Reducing body myopathy MONDO:0019948;X-linked Emery-Dreifuss muscular dystrophy MONDO:0010680 19716112;20186852;20301609;18179901;25274776;34366191;18274675;19181672 False 3 100;0;0 1.2304 True ENSG00000022267 ENSG00000022267 HGNC:3702 FHOD3 gene FHOD3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cardiomyopathy, familial hypertrophic, 28, MIM# 619402 32335906;31742804;30442288 False 3 100;0;0 1.2304 True ENSG00000134775 ENSG00000134775 HGNC:26178 FICD gene FICD Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 92, autosomal recessive, MIM# 620911" 36136088 False 3 100;0;0 1.2304 True ENSG00000198855 ENSG00000198855 HGNC:18416 FIG4 gene FIG4 Expert Review;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Yunis-Varon syndrome - MIM#216340;Polymicrogyria with epilepsy MIM# 612691;Charcot-Marie-Tooth disease, type 4J 611228;Amyotrophic lateral sclerosis 11, MIM# 612577 23623387;17572665;21705420;24878229;18758830;24598713 False 3 100;0;0 1.2304 True ENSG00000112367 ENSG00000112367 HGNC:16873 FIGLA gene FIGLA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Premature ovarian failure 6, MIM# 612310 18499083;25314148;29914564 False 3 100;0;0 1.2304 True ENSG00000183733 ENSG00000183733 HGNC:24669 FILIP1 gene FILIP1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neuromuscular disorder, congenital, with dysmorphic facies, MIM# 620775 36943452 False 3 100;0;0 1.2304 True ENSG00000118407 ENSG00000118407 HGNC:21015 FITM2 gene FITM2 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Siddiqi syndrome MIM#618635;dystonia;deafness 28067622;30214770;30288795 False 3 100;0;0 1.2304 True ENSG00000197296 ENSG00000197296 HGNC:16135 FKBP10 gene FKBP10 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bruck syndrome 1, MONDO:0009806;Osteogenesis imperfecta, type XI, OMIM:610968;Osteogenesis imperfecta type 11, MONDO:0012592;Bruck syndrome 1, OMIM:259450 20696291;20362275;20839288;21567934;21567934;23712425;22718341 False 3 100;0;0 1.2304 True ENSG00000141756 ENSG00000141756 HGNC:18169 FKBP14 gene FKBP14 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ehlers-Danlos syndrome, kyphoscoliotic type, 2, MIM# 614557 22265013;24773188;27149304;31132235;30561154;28617417 False 3 100;0;0 1.2304 True ENSG00000106080 ENSG00000106080 HGNC:18625 FKBP6 gene FKBP6 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Spermatogenic failure 77, MIM# 620103 PMID: 36150389 False 3 100;0;0 1.2304 True ENSG00000077800 ENSG00000077800 HGNC:3722 FKRP gene FKRP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy MONDO:0018276 11592034;11741828;14647208;19299310;19155270 False 3 100;0;0 1.2304 True ENSG00000181027 ENSG00000181027 HGNC:17997 FKTN gene FKTN Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy MONDO:0018276 9690476;19017726;20301385;28680109 False 3 100;0;0 1.2304 True ENSG00000106692 ENSG00000106692 HGNC:3622 FLAD1 gene FLAD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Lipid storage myopathy due to flavin adenine dinucleotide synthetase deficiency MIM#255100 34454814;34718578;31392824;30982706;30311138;30427553;28433476;27259049;25058219 False 3 100;0;0 1.2304 True ENSG00000160688 ENSG00000160688 HGNC:24671 FLCN gene FLCN Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Birt-Hogg-Dube syndrome (MIM#135150);Pneumothorax, primary spontaneous (MIM#173600) 17124507;30586397;31625278 False 3 100;0;0 1.2304 True ENSG00000154803 ENSG00000154803 HGNC:27310 FLG gene FLG Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Ichthyosis vulgaris MONDO:0024304 16444271;19349982;34608691 False 3 100;0;0 1.2304 True ENSG00000143631 ENSG00000143631 HGNC:3748 FLG2 gene FLG2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "Peeling skin syndrome 6, MIM# 618084" 29758285;28884927;29505760 False 3 100;0;0 1.2304 True ENSG00000143520 ENSG00000143520 HGNC:33276 FLI1 gene FLI1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Bleeding disorder, platelet-type, 21 MONDO:0054577 10891501;10981960;24100448;28255014;26316623 False 3 100;0;0 1.2304 True ENSG00000151702 ENSG00000151702 HGNC:3749 FLII gene FLII Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Cardiomyopathy, dilated, 2J, MIM# 620635 32870709;11971982;32980309 False 3 100;0;0 1.2304 True ENSG00000177731 ENSG00000177731 HGNC:3750 FLNA gene FLNA Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) ?FG syndrome 2, XL;Cardiac valvular dysplasia, X-linked;Congenital short bowel syndrome;Frontometaphyseal dysplasia 1;Heterotopia, periventricular, 1;Intestinal pseudoobstruction, neuronal Melnick-Needles syndrome;Otopalatodigital syndrome, type I;Otopalatodigital syndrome, type II;Terminal osseous dysplasia 30089473 False 3 100;0;0 1.2304 True ENSG00000196924 ENSG00000196924 HGNC:3754 FLNB gene FLNB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal spondylocarpotarsal synostosis syndrome MONDO:0010094;filamin-related bone disorder MONDO:0019690 14991055;17360453;20301736;29566257;16801345;22190451 False 3 100;0;0 1.2304 True ENSG00000136068 ENSG00000136068 HGNC:3755 FLNC gene FLNC Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myofibrillar myopathy MONDO:0018943;Dilated cardiomyopathy MONDO:0005021;distal myopathy with posterior leg and anterior hand involvement MONDO:0013550 15929027;32112656 False 3 100;0;0 1.2304 True ENSG00000128591 ENSG00000128591 HGNC:3756 FLT4 gene FLT4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Congenital heart defects, multiple types, 7, MIM# 618780;Lymphatic malformation 1, MIM# 153100 9817924;10835628;12960217;30232381 False 3 100;0;0 1.2304 True ENSG00000037280 ENSG00000037280 HGNC:3767 FLVCR1 gene FLVCR1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal posterior column ataxia-retinitis pigmentosa syndrome MONDO:0012177;Neurodevelopmental disorder with microcephaly, absent speech, and hypotonia, MIM#621060 21070897;22279524;21267618 False 3 100;0;0 1.2304 True ENSG00000162769 ENSG00000162769 HGNC:24682 FLVCR2 gene FLVCR2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Proliferative vasculopathy and hydranencephaly-hydrocephaly syndrome, MIM# 225790 30712878;20206334;20518025;20690116;25677735 False 3 100;0;0 1.2304 True ENSG00000119686 ENSG00000119686 HGNC:20105 FMN2 gene FMN2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Intellectual developmental disorder, autosomal recessive 47, MIM#616193 25480035;32162566;24161494 False 3 100;0;0 1.2304 True ENSG00000155816 ENSG00000155816 HGNC:14074 FMO3 gene FMO3 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Trimethylaminuria, MIM#602079 28649550;31240165 False 3 100;0;0 1.2304 True ENSG00000007933 ENSG00000007933 HGNC:3771 FMR1 gene FMR1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Fragile X syndrome MONDO:0010383 8156595;28176767;29178241 False 3 100;0;0 1.2304 True ENSG00000102081 ENSG00000102081 HGNC:3775 FN1 gene FN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Glomerulopathy with fibronectin deposits 2 (MIM#601894);Spondylometaphyseal dysplasia, corner fracture type (MIM#184255) 29100092 False 3 100;0;0 1.2304 True ENSG00000115414 ENSG00000115414 HGNC:3778 FNIP1 gene FNIP1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 93 and hypertrophic cardiomyopathy, MIM# 619705 32181500;32905580 False 3 100;0;0 1.2304 True ENSG00000217128 ENSG00000217128 HGNC:29418 FOCAD gene FOCAD Expert Review;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Liver disease, severe congenital, MIM# 619991 35864190 False 3 100;0;0 1.2304 True ENSG00000188352 ENSG00000188352 HGNC:23377 FOLR1 gene FOLR1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodegeneration due to cerebral folate transport deficiency, MIM# 613068 19732866;30420205;27743887 False 3 100;0;0 1.2304 True ENSG00000110195 ENSG00000110195 HGNC:3791 FOSL2 gene FOSL2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Aplasia cutis-enamel dysplasia syndrome, MIM# 620789 36197437 False 3 100;0;0 1.2304 True ENSG00000075426 ENSG00000075426 HGNC:3798 FOXA2 gene FOXA2 Expert Review;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hyperinsulinism MONDO:0002177 29329447;28973288;11445544;33999151 False 3 100;0;0 1.2304 True ENSG00000125798 ENSG00000125798 HGNC:5022 FOXC1 gene FOXC1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Axenfeld-Rieger syndrome, type 3, MIM# 602482 9792859;10713890;19668217;32720677 False 3 100;0;0 1.2304 True ENSG00000054598 ENSG00000054598 HGNC:3800 FOXC2 gene FOXC2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Lymphoedema-distichiasis syndrome, MIM# 153400 11078474;11694548;11371511 False 3 100;0;0 1.2304 True ENSG00000176692 ENSG00000176692 HGNC:3801 FOXE1 gene FOXE1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bamforth-Lazarus syndrome, MIM# 241850;MONDO:0009437 9697705;12165566;16882747;24219130;20484477 False 3 100;0;0 1.2304 True ENSG00000178919 ENSG00000178919 HGNC:3806 FOXE3 gene FOXE3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Anterior segment dysgenesis 2, multiple subtypes, MIM#610256;Cataract 34, multiple types, MIM#612968;Aortic aneurysm, familial thoracic 11, susceptibility to}, MIM#617349 26854927;27218149;16826526;19708017;20140963;20664696;20361012;24019743;27669367;29878917;32436650;34046667;11159941;19708017;20806047;21150893;11980846;34046667 False 3 100;0;0 1.2304 True ENSG00000186790 ENSG00000186790 HGNC:3808 FOXF1 gene FOXF1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alveolar capillary dysplasia with misalignment of pulmonary veins, MIM# 265380 23505205;27071622;27855150;19500772 False 3 100;0;0 1.2304 True ENSG00000103241 ENSG00000103241 HGNC:3809 FOXG1 gene FOXG1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Rett syndrome, congenital variant, MIM# 613454" 18571142;30842224 False 3 100;0;0 1.2304 True ENSG00000176165 ENSG00000176165 HGNC:3811 FOXI1 gene FOXI1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal autosomal recessive distal renal tubular acidosis MONDO:0018440 9843211;12642503;29242249;17503324;30268946;27997596;22285650;23965030;24860705;32447495;19204907 False 3 100;0;0 1.2304 True ENSG00000168269 ENSG00000168269 HGNC:3815 FOXI3 gene FOXI3 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dysostosis with predominant craniofacial involvement (MONDO:0800085) 36260083 False 3 100;0;0 1.2304 True ENSG00000214336 ENSG00000214336 HGNC:35123 FOXJ1 gene FOXJ1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ciliary dyskinesia, primary, 43, MIM#618699;hydrocephalus;chronic destructive airway disease;randomization of left/right body asymmetry 31630787 False 3 100;0;0 1.2304 True ENSG00000129654 ENSG00000129654 HGNC:3816 FOXL2 gene FOXL2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Blepharophimosis, epicanthus inversus, and ptosis, type 1 with premature ovarian insufficiency (POI) and type II without POI (MIM# 110100) 31077882;18642388;17089161 False 3 100;0;0 1.2304 True ENSG00000183770 ENSG00000183770 HGNC:1092 FOXN1 gene FOXN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal T-cell immunodeficiency, congenital alopecia, and nail dystrophy MONDO:0011132 10206641;20978268;20978268;28636882;31566583;31447097 False 3 100;0;0 1.2304 True ENSG00000109101 ENSG00000109101 HGNC:12765 FOXP1 gene FOXP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation with language impairment and with or without autistic features, MIM# 613670 26633542;28741757;34109629 False 3 100;0;0 1.2304 True ENSG00000114861 ENSG00000114861 HGNC:3823 FOXP2 gene FOXP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Speech-language disorder-1, MIM# 602081 15877281;15983371;27336128 False 3 100;0;0 1.2304 True ENSG00000128573 ENSG00000128573 HGNC:13875 FOXP3 gene FOXP3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Immunodysregulation, polyendocrinopathy, and enteropathy, X-linked, 304790 11295725;11137993;33668198;33614561;33330291;32234571 False 3 100;0;0 1.2304 True ENSG00000049768 ENSG00000049768 HGNC:6106 FOXP4 gene FOXP4 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder;multiple congenital abnormalities 33110267 False 3 100;0;0 1.2304 True ENSG00000137166 ENSG00000137166 HGNC:20842 FOXRED1 gene FOXRED1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 19 MIM#618241 33613441 False 3 100;0;0 1.2304 True ENSG00000110074 ENSG00000110074 HGNC:26927 FRA10AC1 gene FRA10AC1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with growth retardation, dysmorphic facies, and corpus callosum abnormalities, MIM# 620113 15203205;34694367 False 3 100;0;0 1.2304 True ENSG00000148690 ENSG00000148690 HGNC:1162 FRAS1 gene FRAS1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Fraser syndrome 1, MIM#219000 12766769;18671281 False 3 100;0;0 1.2304 True ENSG00000138759 ENSG00000138759 HGNC:19185 FREM1 gene FREM1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Manitoba oculotrichoanal syndrome 248450;Bifid nose with or without anorectal and renal anomalies, MIM# 608980;Trigonocephaly 2, MIM# 614485 32016392;21931569;21507892;19732862;20301721;28111185 False 3 100;0;0 1.2304 True ENSG00000164946 ENSG00000164946 HGNC:23399 FREM2 gene FREM2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cryptophthalmos, unilateral or bilateral, isolated MIM#123570;Fraser syndrome 2 MIM#617666 15838507;18203166;29688405;33082983 False 3 100;0;0 1.2304 True ENSG00000150893 ENSG00000150893 HGNC:25396 FRMD5 gene FRMD5 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with eye movement abnormalities and ataxia, MIM# 620094 36206744 False 3 100;0;0 1.2304 True ENSG00000171877 ENSG00000171877 HGNC:28214 FRMD7 gene FRMD7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Nystagmus 1, congenital, X-linked 310700;Nystagmus, infantile periodic alternating, X-linked 310700 19072571;23406872 False 3 100;0;0 1.2304 True ENSG00000165694 ENSG00000165694 HGNC:8079 FRMPD4 gene FRMPD4 Expert list;Expert Review Green Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Mental retardation, X-linked 104, MIM#300983 25644381;29267967 False 3 100;0;0 1.2304 True ENSG00000169933 ENSG00000169933 HGNC:29007 FRRS1L gene FRRS1L Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy, 37 MONDO:0014859 27236917;27239025;30692144 False 3 100;0;0 1.2304 True ENSG00000260230 ENSG00000260230 HGNC:1362 FRYL gene FRYL Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Pan-Chung-Bellen syndrome, MIM# 621049 38479391 False 3 100;0;0 1.2304 True ENSG00000075539 ENSG00000075539 HGNC:29127 FSD1L gene FSD1L Expert Review Green;Other Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092, FSD1L-related False 3 100;0;0 1.2304 True ENSG00000106701 ENSG00000106701 HGNC:13753 FSHB gene FSHB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypogonadotropic hypogonadism 24 without anosmia MONDO:0009239 8220432;9280841;9624193;9806482;9271483;16630814 False 3 100;0;0 1.2304 True ENSG00000131808 ENSG00000131808 HGNC:3964 FSHR gene FSHR Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Ovarian dysgenesis 1 MONDO:0024463;Ovarian hyperstimulation syndrome MONDO:0011972 16630814;7553856;9020851;9769327;20087398;9854118;12930928;12930927;17721928;26911863 False 3 100;0;0 1.2304 True ENSG00000170820 ENSG00000170820 HGNC:3969 FTCD gene FTCD Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Glutamate formiminotransferase deficiency MIM#229100;Disorders of histidine, tryptophan or lysine metabolism http://iembase.com/disorder/47 False 3 100;0;0 1.2304 True ENSG00000160282 ENSG00000160282 HGNC:3974 FTH1 gene FTH1 Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hemochromatosis, type 5, MIM# 615517;Neurodegeneration with brain iron accumulation 9, MIM# 620669 11389486;37660254 False 3 0;50;50 1.2304 True Other ENSG00000167996 ENSG00000167996 HGNC:3976 FTO gene FTO Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Growth retardation, developmental delay, facial dysmorphism MIM#612938 19234441;19559399;26378117;26697951;26378117;26740239 False 3 100;0;0 1.2304 True ENSG00000140718 ENSG00000140718 HGNC:24678 FTSJ1 gene FTSJ1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Intellectual developmental disorder, X-linked 9 MIM#309549 33771871;15342698;18081026;15162322;26310293 False 3 100;0;0 1.2304 True ENSG00000068438 ENSG00000068438 HGNC:13254 FUCA1 gene FUCA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Fucosidosis, MIM# 230000;MONDO:0009254 10094192 False 3 100;0;0 1.2304 True ENSG00000179163 ENSG00000179163 HGNC:4006 FUK gene FUK Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation with defective fucosylation 2, MIM# 618324 30503518;35718084;36426412 False 3 100;0;0 1.2304 True ENSG00000157353 ENSG00000157353 HGNC:29500 FUT8 gene FUT8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation with defective fucosylation 1 MONDO:0020775 29304374;34389986;32049367;16236725 False 3 100;0;0 1.2304 True ENSG00000033170 ENSG00000033170 HGNC:4019 FUZ gene FUZ Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "{Neural tube defects, susceptibility to} MIM#182940;craniosynostosis, FUZ-related MONDO#0015469;Ciliopathy_MONDO_0005308, FUZ-related;skeletal ciliopathy" 21840926;38702430;29068549;34719684 False 3 33;0;67 1.2304 True ENSG00000010361 ENSG00000010361 HGNC:26219 FXN gene FXN Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Friedreich ataxia MONDO:0100339 20301458;26704351 False 3 100;0;0 1.2304 True ENSG00000165060 ENSG00000165060 HGNC:3951 FXR1 gene FXR1 Expert Review Green;NHS GMS Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital multi-minicore myopathy;myopathy, congenital proximal, with minicore lesions MONDO:0032937 30770808 False 3 100;0;0 1.2304 True ENSG00000114416 ENSG00000114416 HGNC:4023 FYB1 gene FYB1 Expert Review;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Thrombocytopenia 3, MIM# 273900 25516138;25876182 False 3 100;0;0 1.2304 True ENSG00000082074 ENSG00000082074 HGNC:4036 FYCO1 gene FYCO1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cataract 18, MIM#610019 32355443 False 3 100;0;0 1.2304 True ENSG00000163820 ENSG00000163820 HGNC:14673 FZD2 gene FZD2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Autosomal dominant omodysplasia MONDO:0008123 25759469;30455931;29383834;29230162 False 3 100;0;0 1.2304 True ENSG00000180340 ENSG00000180340 HGNC:4040 FZD4 gene FZD4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Exudative vitreoretinopathy 1, MIM# 133780 21097938;33302760;31999491 False 3 100;0;0 1.2304 True ENSG00000174804 ENSG00000174804 HGNC:4042 FZD5 gene FZD5 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Microphthalmia/coloboma 11, MIM# 620731 32737437;26908622 False 3 100;0;0 1.2304 True ENSG00000163251 ENSG00000163251 HGNC:4043 FZD6 gene FZD6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Nail disorder, nonsyndromic congenital, 1, MIM# 161050;Hydrops fetalis, MONDO:0015193, FZD6-related 21665003;23374899;33082562;26036949;28425981 False 3 100;0;0 1.2304 True ENSG00000164930 ENSG00000164930 HGNC:4044 FZR1 gene FZR1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 109, MIM# 620145 34788397 False 3 100;0;0 1.2304 True ENSG00000105325 ENSG00000105325 HGNC:24824 G6PC gene G6PC Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease Ia, MIM# 232200 8733042 False 3 100;0;0 1.2304 True ENSG00000131482 ENSG00000131482 HGNC:4056 G6PC3 gene G6PC3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Dursun syndrome 612541;Neutropenia, severe congenital 4, autosomal recessive 612541 21385794 False 3 100;0;0 1.2304 True ENSG00000141349 ENSG00000141349 HGNC:24861 G6PD gene G6PD Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Haemolytic anaemia, G6PD deficient (favism), MIM# 300908 18177777 False 3 100;0;0 1.2304 True ENSG00000160211 ENSG00000160211 HGNC:4057 GAA gene GAA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease II, MIM# 232300;MONDO:0009290 False 3 100;0;0 1.2304 True ENSG00000171298 ENSG00000171298 HGNC:4065 GABBR1 gene GABBR1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with language delay and variable cognitive abnormalities, MIM#620502 36103875 False 3 100;0;0 1.2304 True ENSG00000204681 ENSG00000204681 HGNC:4070 GABBR2 gene GABBR2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with poor language and loss of hand skills, 617903 29100083;28061363;28135719;28856709;29369404;29377213 False 3 100;0;0 1.2304 True ENSG00000136928 ENSG00000136928 HGNC:4507 GABRA1 gene GABRA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Epileptic encephalopathy, early infantile, 19 615744;Rett syndrome;Rett-like phenotypes;idiopathic generalized Epilepsy;Dravet syndrome" 11992121;21714819;24623842;30842224 False 3 100;0;0 1.2304 True ENSG00000022355 ENSG00000022355 HGNC:4075 GABRA2 gene GABRA2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 78, MIM# 618557 29422393 False 3 100;0;0 1.2304 True ENSG00000151834 ENSG00000151834 HGNC:4076 GABRA3 gene GABRA3 Expert Review Green;Literature Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Epilepsy, X-linked 2, with or without impaired intellectual development and dysmorphic features, MIM# 301091 PMID: 29053855 False 3 100;0;0 1.2304 True ENSG00000011677 ENSG00000011677 HGNC:4077 GABRA4 gene GABRA4 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder MONDO:0700092, GABRA4-related 35152403;38565639 False 3 100;0;0 1.2304 True ENSG00000109158 ENSG00000109158 HGNC:4078 GABRA5 gene GABRA5 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 79;OMIM #618559 31056671;29961870 False 3 100;0;0 1.2304 True ENSG00000186297 ENSG00000186297 HGNC:4079 GABRB1 gene GABRB1 Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Epileptic encephalopathy, early infantile, 45, MIM# 617153" 23934111;27273810;31618474 False 3 100;0;0 1.2304 True ENSG00000163288 ENSG00000163288 HGNC:4081 GABRB2 gene GABRB2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, infantile or early childhood, 2, MIM# 617829 27789573;29100083 False 3 100;0;0 1.2304 True Other ENSG00000145864 ENSG00000145864 HGNC:4082 GABRB3 gene GABRB3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 43, MIM# 617113 23934111;27476654 False 3 100;0;0 1.2304 True ENSG00000166206 ENSG00000166206 HGNC:4083 GABRD gene GABRD Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Susceptibility to epilepsy, MIM#613060 15115768;34633442 False 3 100;0;0 1.2304 True ENSG00000187730 ENSG00000187730 HGNC:4084 GABRG2 gene GABRG2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 74 618396;Epilepsy, generalized, with febrile seizures plus, type 3 607681 11326274;11326275;27864268 False 3 100;0;0 1.2304 True ENSG00000113327 ENSG00000113327 HGNC:4087 GAD1 gene GAD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cerebral palsy, spastic quadriplegic, 1, MIM#603513;Developmental and epileptic encephalopathy 89, MIM# 619124 15571623 False 3 100;0;0 1.2304 True ENSG00000128683 ENSG00000128683 HGNC:4092 GALC gene GALC Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Krabbe disease, MIM# 245200;MONDO:0009499 20886637 False 3 100;0;0 1.2304 True ENSG00000054983 ENSG00000054983 HGNC:4115 GALE gene GALE Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Galactose epimerase deficiency MIM#230350;Thrombocytopenia 12, syndromic, MIM#620776 27604308;9700591;30247636;34159722;36395340 False 3 100;0;0 1.2304 True ENSG00000117308 ENSG00000117308 HGNC:4116 GALK1 gene GALK1 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Galactokinase deficiency with cataracts MIM#230200;Disorders of galactose metabolism 27604308;5129682 False 3 100;0;0 1.2304 True ENSG00000108479 ENSG00000108479 HGNC:4118 GALM gene GALM Expert Review Green;Literature;NHS GMS Mendeliome BIALLELIC, autosomal or pseudoautosomal galactosaemia;type IV galactosaemia PMID: 30451973;30910422 False 3 100;0;0 1.2304 True ENSG00000143891 ENSG00000143891 HGNC:24063 GALNS gene GALNS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mucopolysaccharidosis IVA, MIM# 253000;MONDO:0009659 9298823 False 3 100;0;0 1.2304 True ENSG00000141012 ENSG00000141012 HGNC:4122 GALNT2 gene GALNT2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation MONDO:0015286 32293671 False 3 100;0;0 1.2304 True ENSG00000143641 ENSG00000143641 HGNC:4124 GALNT3 gene GALNT3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Tumoral calcinosis, hyperphosphatemic, familial, 1, MIM# 211900 15133511;20358599;32125652 False 3 100;0;0 1.2304 True ENSG00000115339 ENSG00000115339 HGNC:4125 GALT gene GALT Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Galactosaemia MIM#230400;Disorders of galactose metabolism 27604308;2011574 False 3 100;0;0 1.2304 True ENSG00000213930 ENSG00000213930 HGNC:4135 GAMT gene GAMT Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cerebral creatine deficiency syndrome 2 MIM#612736;Disorders of creatinine metabolism 27604308;8651275 False 3 100;0;0 1.2304 True ENSG00000130005 ENSG00000130005 HGNC:4136 GAN gene GAN Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Giant axonal neuropathy-1, MIM# 256850 11062483 False 3 100;0;0 1.2304 True ENSG00000261609 ENSG00000261609 HGNC:4137 GANAB gene GANAB Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Polycystic kidney disease 3, MIM# 600666 27259053 False 3 100;0;0 1.2304 True ENSG00000089597 ENSG00000089597 HGNC:4138 GARS gene GARS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial disease (MONDO:0044970), GARS1-related;Spinal muscular atrophy, infantile, James type, MIM# 619042;Charcot-Marie-Tooth disease, type 2D, MIM# 601472;Neuronopathy, distal hereditary motor, type VA, MIM# 600794;Multi-system mitochondrial disorder 17101916;22462675;31985473;32181591;12690580;25168514;26503042;29648643;16982418;24669931;28594869 False 3 100;0;0 1.2304 True ENSG00000106105 ENSG00000106105 HGNC:4162 GAS8 gene GAS8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 33, MIM#616726 26387594;27120127 False 3 100;0;0 1.2304 True ENSG00000141013 ENSG00000141013 HGNC:4166 GATA1 gene GATA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Thrombocytopaenia, X-linked, with or without dyserythropoietic anaemia, MIM# 300367;Haemolytic anaemia due to elevated adenosine deaminase, MIM# 301083;Anemia, X-linked, with/without neutropenia and/or platelet abnormalities, MIM# 300835;Diamond-Blackfan anemia (MONDO:0015253) 36029112 False 3 100;0;0 1.2304 True ENSG00000102145 ENSG00000102145 HGNC:4170 GATA2 gene GATA2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Immunodeficiency 21, MIM# 614172;GATA2 deficiency with susceptibility to MDS/AML MONDO:0042982;Emberger syndrome, MIM# 614038;Deafness-lymphoedema-leukaemia syndrome MONDO:0013540 21670465;21242295;21892158 False 3 100;0;0 1.2304 True ENSG00000179348 ENSG00000179348 HGNC:4171 GATA3 gene GATA3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypoparathyroidism, sensorineural deafness, and renal dysplasia, MIM# 146255 10935639;11389161;21120445;26316437;25771973;27387476;30396722 False 3 100;0;0 1.2304 True ENSG00000107485 ENSG00000107485 HGNC:4172 GATA4 gene GATA4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Atrial septal defect 2 MIM#607941;Atrioventricular septal defect 4 MIM#614430;Ventricular septal defect 1 MIM#614429 12845333;18055909;15689439;33413087;30455927 False 3 100;0;0 1.2304 True ENSG00000136574 ENSG00000136574 HGNC:4173 GATA6 gene GATA6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Pancreatic agenesis and congenital heart defects, 600001;Atrial septal defect 9, 614475;Atrioventricular septal defect 5, 614474;Tetralogy of Fallot, 187500;Persistent truncus arteriosus, 217095 20581743;19666519 False 3 100;0;0 1.2304 True Other ENSG00000141448 ENSG00000141448 HGNC:4174 GATAD2A gene GATAD2A Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, GATAD2A-related 37181331;17565372 False 3 100;0;0 1.2304 True ENSG00000167491 ENSG00000167491 HGNC:29989 GATAD2B gene GATAD2B Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 18, OMIM # 615074 31949314 False 3 100;0;0 1.2304 True ENSG00000143614 ENSG00000143614 HGNC:30778 GATM gene GATM Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Cerebral creatine deficiency syndrome 3, MIM# 612718;Fanconi renotubular syndrome 1, MIM# 134600 12468279;20682460;22386973;29654216 False 3 100;0;0 1.2304 True ENSG00000171766 ENSG00000171766 HGNC:4175 GBA2 gene GBA2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 46, autosomal recessive, MIM# 614409;MONDO:0013737 23332916;23332917;29524657 False 3 100;0;0 1.2304 True ENSG00000070610 ENSG00000070610 HGNC:18986 GBE1 gene GBE1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease IV, MIM# 232500;Polyglucosan body disease, adult form MIM#263570 8613547 False 3 100;0;0 1.2304 True ENSG00000114480 ENSG00000114480 HGNC:4180 GBF1 gene GBF1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Charcot-Marie-Tooth disease, dominant intermediate A, MIM# 606483;Axonal Neuropathy 32937143 False 3 67;0;33 1.2304 True ENSG00000107862 ENSG00000107862 HGNC:4181 GCDH gene GCDH Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Glutaric aciduria, type I MIM#231670;Organic acidurias 27604308;8541831;8900227 False 3 100;0;0 1.2304 True ENSG00000105607 ENSG00000105607 HGNC:4189 GCGR gene GCGR Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Mahvash disease, MIM# 619290" 19657311;25695890;27933176;30032256;30294546 False 3 100;0;0 1.2304 True ENSG00000215644 ENSG00000215644 HGNC:4192 GCH1 gene GCH1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hyperphenylalaninemia, BH4-deficient, B, MIM# 233910;Dystonia, DOPA-responsive, with or without hyperphenylalaninemia, MIM# 128230;Hereditary spastic paraplegia MONDO:0019064, GCH1-related 21935284;24509643;33713342;7874165;11113234;15753436;9667588;10987649;32170445;32278297;32746945;30314816 False 3 100;0;0 1.2304 True ENSG00000131979 ENSG00000131979 HGNC:4193 GCK gene GCK Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Diabetes mellitus, noninsulin-dependent, late onset, AD (MIM#125853);Diabetes mellitus, permanent neonatal 1, AR (MIM#606176);Hyperinsulinemic hypoglycemia, familial, 3, AD (MIM#602485);MODY, type II, AD (MIM#125851) 19790256 False 3 100;0;0 1.2304 True ENSG00000106633 ENSG00000106633 HGNC:4195 GCLC gene GCLC Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Haemolytic anaemia due to gamma-glutamylcysteine synthetase deficiency MIM#230450;Disorders of the gamma-glutamyl cycle 28571779;27604308;10515893;18024385;11118286;10733484;12663448 False 3 100;0;0 1.2304 True ENSG00000001084 ENSG00000001084 HGNC:4311 GCM2 gene GCM2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hyperparathyroidism 4, OMIM #617343 27745835 False 3 100;0;0 1.2304 True Other ENSG00000124827 ENSG00000124827 HGNC:4198 GCNA gene GCNA Expert Review Green;Literature Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Spermatogenic failure, X-linked, 4, MIM# 301077 33963445 False 3 100;0;0 1.2304 True ENSG00000147174 ENSG00000147174 HGNC:15805 GCNT2 gene GCNT2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cataract 13 with adult i phenotype, OMIM # 116700 15161861;27936067;12424189;28224043 False 3 100;0;0 1.2304 True ENSG00000111846 ENSG00000111846 HGNC:4204 GCSH gene GCSH Expert Review Green;Literature;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal "Multiple mitochondrial dysfunctions syndrome 7, MIM# 620423" 1671321;27604308;36190515 False 3 33;0;67 1.2304 True ENSG00000140905 ENSG00000140905 HGNC:4208 GDAP1 gene GDAP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, axonal, type 2K 607831, MIM# Charcot-Marie-Tooth disease, axonal, with vocal cord paresis, MIM# 607706;Charcot-Marie-Tooth disease, recessive intermediate, A, MIM# 608340;Charcot-Marie-Tooth disease, type 4A, MIM# 214400 16172208;21753178;21365284;20232219;11743580 False 3 100;0;0 1.2304 True ENSG00000104381 ENSG00000104381 HGNC:15968 GDAP2 gene GDAP2 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 27, MIM#618369 30084953 False 3 100;0;0 1.2304 True ENSG00000196505 ENSG00000196505 HGNC:18010 GDF1 gene GDF1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Congenital heart defects, multiple types, 6 613854;Right atrial isomerism (Ivemark) 208530 32144877 False 3 50;0;50 1.2304 True ENSG00000130283 ENSG00000130283 HGNC:4214 GDF11 gene GDF11 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Vertebral hypersegmentation and orofacial anomalies (VHO), MIM#619122 31215115 False 3 100;0;0 1.2304 True ENSG00000135414 ENSG00000135414 HGNC:4216 GDF2 gene GDF2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Telangiectasia, hereditary hemorrhagic, type 5 OMIM # 615506;pulmonary arteriovenous malformations 23972370;27081547;32573726;32992168;34611981;33834622;32669404;26056270;23972370 False 3 100;0;0 1.2304 True ENSG00000128802 ENSG00000263761 HGNC:4217 GDF5 gene GDF5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Type A1C brachydactyly (MIM#615072);Type A2 brachydactyly, (MIM#112600);Type C brachydactyly (MIM#113100);Grebe type chondrodysplasia (MIM#200700);Du Pan syndrome (MIM#228900);Multiple synostoses syndrome 2 (MIM#610017);Proximal Symphalangism 1B (MIM#615298) 33333243 False 3 67;0;33 1.2304 True ENSG00000125965 ENSG00000125965 HGNC:4220 GDF6 gene GDF6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Klippel-Feil syndrome 1, autosomal dominant 118100;Leber congenital amaurosis 17 615360;Microphthalmia with coloboma 6, digenic 613703;Microphthalmia, isolated 4 613094;Multiple synostoses syndrome 4 617898;CAKUT 18425797;19129173;32737436 False 3 67;0;33 1.2304 True ENSG00000156466 ENSG00000156466 HGNC:4221 GDF9 gene GDF9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Premature ovarian failure 14, OMIM# 618014 29044499;8849725;33036707 False 3 100;0;0 1.2304 True ENSG00000164404 ENSG00000164404 HGNC:4224 GDI1 gene GDI1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Intellectual developmental disorder, X-linked 41 MIM#300849 28863211;22002931;9620768;9668174 False 3 100;0;0 1.2304 True ENSG00000203879 ENSG00000203879 HGNC:4226 GEMIN4 gene GEMIN4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly, cataracts, and renal abnormalities, MIM# 617913 25558065;30237576;27878435 False 3 100;0;0 1.2304 True ENSG00000179409 ENSG00000179409 HGNC:15717 GEMIN5 gene GEMIN5 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with cerebellar atrophy and motor dysfunction, MIM# 619333 33963192 False 3 100;0;0 1.2304 True ENSG00000082516 ENSG00000082516 HGNC:20043 GFAP gene GFAP Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Alexander disease, MIM# 203450" 11138011;12034785;31004048;15732097 False 3 100;0;0 1.2304 True ENSG00000131095 ENSG00000131095 HGNC:4235 GFER gene GFER Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Myopathy, mitochondrial progressive, with congenital cataract, hearing loss, and developmental delay (MIM #613076) 28155230 False 3 100;0;0 1.2304 True ENSG00000127554 ENSG00000127554 HGNC:4236 GFI1 gene GFI1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neutropaenia, severe congenital 2, autosomal dominant, MIM# 613107 12778173;20560965;11810106;22684987 False 3 100;0;0 1.2304 True ENSG00000162676 ENSG00000162676 HGNC:4237 GFI1B gene GFI1B Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Bleeding disorder, platelet-type, 17 MIM#187900 24325358;23927492;28041820;11825872 False 3 100;0;0 1.2304 True ENSG00000165702 ENSG00000165702 HGNC:4238 GFM1 gene GFM1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 1 MIM#609060 31680380;25852744;26937387 False 3 100;0;0 1.2304 True ENSG00000168827 ENSG00000168827 HGNC:13780 GFM2 gene GFM2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 39, OMIM #618397 22700954;26016410;29075935 False 3 100;0;0 1.2304 True ENSG00000164347 ENSG00000164347 HGNC:29682 GFPT1 gene GFPT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Myasthenia, congenital, 12, with tubular aggregates, 610542;Limb-girdle congenital myasthenic syndrome;Leukoencephalopathy 21310273;30635494 False 3 100;0;0 1.2304 True ENSG00000198380 ENSG00000198380 HGNC:4241 GFRA1 gene GFRA1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Renal hypodysplasia/aplasia 4, MIM# 619887 33020172;34737117 False 3 100;0;0 1.2304 True ENSG00000151892 ENSG00000151892 HGNC:4243 GGCX gene GGCX Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Vitamin K-dependent clotting factors, combined deficiency of, 1, MIM# 277450 32785662;30531603;26758921 False 3 100;0;0 1.2304 True ENSG00000115486 ENSG00000115486 HGNC:4247 GGPS1 gene GGPS1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518;Muscular dystrophy;Deafness;Ovarian insufficiency 32403198 False 3 100;0;0 1.2304 True ENSG00000152904 ENSG00000152904 HGNC:4249 GH1 gene GH1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Growth hormone deficiency, isolated, type IA, MIM# 262400;Growth hormone deficiency, isolated, type II, MIM# 173100;Kowarski syndrome, MIM# 262650 2840669;1603635;12655557;15671105;8552145;9276733;15713716 False 3 100;0;0 1.2304 True ENSG00000259384 ENSG00000259384 HGNC:4261 GHR gene GHR Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Growth hormone insensitivity, partial, MIM# 604271;Laron dwarfism, MIM# 262500 1999489;8488849;7565946 False 3 100;0;0 1.2304 True ENSG00000112964 ENSG00000112964 HGNC:4263 GHRHR gene GHRHR Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Growth hormone deficiency, isolated, type IV, MIM# 618157 8528260;10084571;11232012 False 3 100;0;0 1.2304 True ENSG00000106128 ENSG00000106128 HGNC:4266 GIF gene GIF Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Intrinsic factor deficiency MIM#261000;Disorders of cobalamin absorption, transport and metabolism 27604308;14695536;14576042 False 3 100;0;0 1.2304 True ENSG00000134812 ENSG00000134812 HGNC:4268 GIGYF1 gene GIGYF1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Autism spectrum disorder (MONDO:0005258), GIGYF1-related 33057194;35917186 False 3 50;50;0 1.2304 True ENSG00000146830 ENSG00000146830 HGNC:9126 GIMAP5 gene GIMAP5 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Portal hypertension, noncirrhotic, 2, MIM# 619463" 33956074 False 3 100;0;0 1.2304 True ENSG00000196329 ENSG00000196329 HGNC:18005 GIMAP6 gene GIMAP6 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Autoinflammatory syndrome MONDO:0019751, GIMAP6-related PMID: 35551368;33328581 False 3 50;50;0 1.2304 True ENSG00000133561 ENSG00000133561 HGNC:21918 GINS1 gene GINS1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 55, OMIM #617827 28414293 False 3 100;0;0 1.2304 True ENSG00000101003 ENSG00000101003 HGNC:28980 GINS3 gene GINS3 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Meier-Gorlin syndrome, MONDO:0016817, GINS3-related 35603789 False 3 100;0;0 1.2304 True ENSG00000181938 ENSG00000181938 HGNC:25851 GIPC3 gene GIPC3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 15, MIM# 601869 21326233;21660509 False 3 100;0;0 1.2304 True ENSG00000179855 ENSG00000179855 HGNC:18183 GJA1 gene GJA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Oculodentodigital dysplasia, autosomal recessive, MIM# 257850;Oculodentodigital dysplasia, MIM# 164200 19338053 False 3 100;0;0 1.2304 True ENSG00000152661 ENSG00000152661 HGNC:4274 GJA3 gene GJA3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cataract 14, multiple types MIM#601885 10205266;15286166;15448617;21681855;22312188;22550389;22876138 False 3 100;0;0 1.2304 True ENSG00000121743 ENSG00000121743 HGNC:4277 GJA4 gene GJA4 Expert Review;Expert Review Green Mendeliome Other Cavernous hemangioma, MONDO:0003155, GJA4-related 33912852 False 3 100;0;0 1.2304 True ENSG00000187513 ENSG00000187513 HGNC:4278 GJA8 gene GJA8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cataract 1, multiple types, MIM# 116200;Microphthalmia 30498267;29464339;10480374;18006672 False 3 100;0;0 1.2304 True ENSG00000121634 ENSG00000121634 HGNC:4281 GJB1 gene GJB1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Charcot-Marie-Tooth neuropathy, X-linked dominant, 1, MIM# 302800;MONDO:0010549;reversible posterior leukoencephalopathy 8266101;17100997;17353473;31842800 False 3 100;0;0 1.2304 True ENSG00000169562 ENSG00000169562 HGNC:4283 GJB2 gene GJB2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Bart-Pumphrey syndrome, MIM#149200;Deafness, autosomal dominant 3A, MIM#601544;Deafness, autosomal recessive 1A, MIM#220290;Hystrix-like ichthyosis with deafness, MIM#602540;Keratitis-ichthyosis-deafness syndrome, MIM#148210;Keratoderma, palmoplantar, with deafness, MIM#148350;Vohwinkel syndrome, MIM# 124500 11179004;9529365;14985372;19941053;11354642 False 3 100;0;0 1.2304 True ENSG00000165474 ENSG00000165474 HGNC:4284 GJB3 gene GJB3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Erythrokeratodermia variabilis et progressiva 1, MIM# 133200 9843209;10798362;10594760;17446259;9843210 False 3 100;0;0 1.2304 True ENSG00000188910 ENSG00000188910 HGNC:4285 GJB4 gene GJB4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Erythrokeratodermia variabilis et progressiva 2, MIM# 617524 11017804;12648223;19291775 False 3 100;0;0 1.2304 True ENSG00000189433 ENSG00000189433 HGNC:4286 GJB6 gene GJB6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Deafness, autosomal dominant 3B, MIM# 612643;Deafness, autosomal recessive 1B, MIM# 612645;Ectodermal dysplasia 2, Clouston type, MIM# 129500 11017065;23219093;11874494;18717672;27137747;25808784;19416251;26620415;17227867 False 3 100;0;0 1.2304 True ENSG00000121742 ENSG00000121742 HGNC:4288 GJC2 gene GJC2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 44, autosomal recessive MIM#613206;Leukodystrophy, hypomyelinating, 2 MIM#608804;Lymphatic malformation 3 MIM#613480 19056803;31431325;25059390;20537300;21266381 False 3 100;0;0 1.2304 True ENSG00000198835 ENSG00000198835 HGNC:17494 GK gene GK Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Glycerol kinase deficiency MIM#307030;Disorders of glycerol metabolism 27604308;8499912;8651297 False 3 100;0;0 1.2304 True ENSG00000198814 ENSG00000198814 HGNC:4289 GLB1 gene GLB1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal GM1-gangliosidosis, type I MIM#230500;GM1-gangliosidosis, type II MIM# 230600;GM1-gangliosidosis, type III MIM#230650;Mucopolysaccharidosis type IVB (Morquio) MIM#253010 24156116 False 3 100;0;0 1.2304 True ENSG00000170266 ENSG00000170266 HGNC:4298 GLDC gene GLDC Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Glycine encephalopathy (MIM#605899) 27362913 False 3 100;0;0 1.2304 True ENSG00000178445 ENSG00000178445 HGNC:4313 GLDN gene GLDN Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Lethal congenital contracture syndrome 11, MIM# 617194;MONDO:0014965 27616481;32812332;28726266 False 3 100;0;0 1.2304 True ENSG00000186417 ENSG00000186417 HGNC:29514 GLE1 gene GLE1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Lethal congenital contracture syndrome 1, MIM# 253310 18204449;22357925 False 3 100;0;0 1.2304 True ENSG00000119392 ENSG00000119392 HGNC:4315 GLI1 gene GLI1 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Polydactyly, postaxial, type A8 MIM#618123;Polydactyly, preaxial I MIM#174400" 34721536;31621941;31549748;30620395 False 3 100;0;0 1.2304 True ENSG00000111087 ENSG00000111087 HGNC:4317 GLI2 gene GLI2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Culler-Jones syndrome, MIM#615849;Holoprosencephaly 9, MIM# 61082) 14581620;17096318;33235745;27585885;15994174;20685856;30629636;30583238 False 3 100;0;0 1.2304 True ENSG00000074047 ENSG00000074047 HGNC:4318 GLI3 gene GLI3 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Polydactyly, postaxial, types A1 and B, MIM#174200;Greig cephalopolysyndactyly syndrome MIM#175700;Polydactyly, preaxial, type IV MIM#174700;Pallister-Hall syndrome MIM#146510 32591344;18000979;24736735 False 3 100;0;0 1.2304 True ENSG00000106571 ENSG00000106571 HGNC:4319 GLIS2 gene GLIS2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Nephronophthisis 7, OMIM#611498;MONDO:0012680 17618285;23559409;31676329 False 3 100;0;0 1.2304 True ENSG00000126603 ENSG00000126603 HGNC:29450 GLIS3 gene GLIS3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Diabetes mellitus, neonatal, with congenital hypothyroidism, MIM#610199 21139041;35410112;35394098;34093443 False 3 100;0;0 1.2304 True ENSG00000107249 ENSG00000107249 HGNC:28510 GLMN gene GLMN Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Glomuvenous malformations MIM#138000 11845407;24961656;32538359 False 3 100;0;0 1.2304 True ENSG00000174842 ENSG00000174842 HGNC:14373 GLRA1 gene GLRA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hyperekplexia 1, MIM# 149400 8298642;16832093 False 3 100;0;0 1.2304 True ENSG00000145888 ENSG00000145888 HGNC:4326 GLRA2 gene GLRA2 Expert list;Expert Review Green Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) "Intellectual developmental disorder, X-linked, syndromic, Pilorge type, MIM# 301076" 26370147;20479760;35294868 False 3 100;0;0 1.2304 True ENSG00000101958 ENSG00000101958 HGNC:4327 GLRB gene GLRB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hyperekplexia 2, MIM# 614619 21391991;11929858;27843043 False 3 100;0;0 1.2304 True ENSG00000109738 ENSG00000109738 HGNC:4329 GLRX5 gene GLRX5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Anemia, sideroblastic, 3, pyridoxine-refractory;Spasticity, childhood-onset, with hyperglycinemia False 3 100;0;0 1.2304 True ENSG00000182512 ENSG00000182512 HGNC:20134 GLS gene GLS Expert list;Expert Review Green Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Epileptic encephalopathy, early infantile, 71, MIM# 618328;Global developmental delay, progressive ataxia, and elevated glutamine, MIM# 618412;Cataract" 30575854;30970188;30239721 False 3 100;0;0 1.2304 True ENSG00000115419 ENSG00000115419 HGNC:4331 GLUD1 gene GLUD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hyperinsulinism-hyperammonemia syndrome, MIM# 606762 11214910;11297618 False 3 100;0;0 1.2304 True ENSG00000148672 ENSG00000148672 HGNC:4335 GLUL gene GLUL Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 116, MIM# 620806;Glutamine deficiency, congenital MIM#610015;disorder of amino acid metabolism 16267323;21353613;33150193 False 3 100;0;0 1.2304 True ENSG00000135821 ENSG00000135821 HGNC:4341 GLYCTK gene GLYCTK Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal D-glyceric aciduria MIM#220120;Disorders of serine, glycine or glycerate metabolism 20949620;31837836 False 3 100;0;0 1.2304 True ENSG00000168237 ENSG00000168237 HGNC:24247 GM2A gene GM2A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal GM2-gangliosidosis, AB variant MIM#272750 28417072;28192816;27402091;33819415 False 3 100;0;0 1.2304 True ENSG00000196743 ENSG00000196743 HGNC:4367 GMNN gene GMNN Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Meier-Gorlin syndrome 6, MIM# 616835 26637980 False 3 100;0;0 1.2304 True ENSG00000112312 ENSG00000112312 HGNC:17493 GMPPA gene GMPPA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Alacrima, achalasia, and impaired intellectual development syndrome (MIM# 615510) 24035193;28574218 False 3 100;0;0 1.2304 True ENSG00000144591 ENSG00000144591 HGNC:22923 GMPPB gene GMPPB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 14 (MIM# 615350);Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 14 (MIM# 615351);Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 14 (MIM# 615352) False 3 100;0;0 1.2304 True ENSG00000173540 ENSG00000173540 HGNC:22932 GNA11 gene GNA11 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypocalcemia, autosomal dominant 2 MIM#615361;Hypocalciuric hypercalcemia, type II MIM#145981 23802536;23802516;24823460;26818911;27334330 False 3 100;0;0 1.2304 True Other ENSG00000088256 ENSG00000088256 HGNC:4379 GNAI1 gene GNAI1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with hypotonia, impaired speech, and behavioral abnormalities, MIM# 619854 28135719;33473207 False 3 100;0;0 1.2304 True ENSG00000127955 ENSG00000127955 HGNC:4384 GNAI3 gene GNAI3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Auriculocondylar syndrome 1, OMIM #602483 22560091 False 3 100;0;0 1.2304 True ENSG00000065135 ENSG00000065135 HGNC:4387 GNAL gene GNAL Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia 25, MIM# 615073;MONDO:0014033 23222958;33175450;32180288 False 3 100;0;0 1.2304 True ENSG00000141404 ENSG00000141404 HGNC:4388 GNAO1 gene GNAO1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 17, MIM#615473;Neurodevelopmental disorder with involuntary movements, MIM# 617493 28747448;30682224 False 3 100;0;0 1.2304 True Other ENSG00000087258 ENSG00000087258 HGNC:4389 GNAQ gene GNAQ Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Sturge-Weber syndrome, somatic, mosaic 185300;Capillary malformations, congenital, 1, somatic, mosaic 163000;Phacomatosis pigmentovascularis 30920161;34124757 False 3 100;0;0 1.2304 True Other ENSG00000156052 ENSG00000156052 HGNC:4390 GNAS gene GNAS Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Osseous heteroplasia, progressive (166350) AD;Pituitary adenoma 3, multiple types, somatic (617686);Pseudohypoparathyroidism Ia (103580) AD;Pseudohypoparathyroidism Ib (603233) AD;Pseudohypoparathyroidism Ic (612462) AD;Pseudopseudohypoparathyroidism (612463) False 3 100;0;0 1.2304 True ENSG00000087460 ENSG00000087460 HGNC:4392 GNAT1 gene GNAT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Night blindness, congenital stationary, autosomal dominant 3, MIM# 610444;Night blindness, congenital stationary, type 1G, MIM# 616389 8673138;17584859;22190596;26472407;11095744;11095744;30051303 False 3 100;0;0 1.2304 True ENSG00000114349 ENSG00000114349 HGNC:4393 GNAT2 gene GNAT2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Achromatopsia 4, MIM#613856 32203983;17251445 False 3 100;0;0 1.2304 True ENSG00000134183 ENSG00000134183 HGNC:4394 GNB1 gene GNB1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 42, MIM# 616973 27108799;30194818;27668284;31034681 False 3 100;0;0 1.2304 True ENSG00000078369 ENSG00000078369 HGNC:4396 GNB2 gene GNB2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Neurodevelopmental disorder with hypotonia and dysmorphic facies 619503" 31698099;33971351;34183358;33057194 False 3 33;67;0 1.2304 True ENSG00000172354 ENSG00000172354 HGNC:4398 GNB3 gene GNB3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Night blindness, congenital stationary, type 1H, MIM# 617024 27063057;17065478 False 3 100;0;0 1.2304 True ENSG00000111664 ENSG00000111664 HGNC:4400 GNB4 gene GNB4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, dominant intermediate F, MIM# 615185;MONDO:0014074 23434117;28642160;27908631 False 3 100;0;0 1.2304 True ENSG00000114450 ENSG00000114450 HGNC:20731 GNB5 gene GNB5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Intellectual developmental disorder with cardiac arrhythmia, 617173;Language delay and ADHD/cognitive impairment with or without cardiac arrhythmia, 617182;Early infantile epileptic encephalopathy (EIEE) 27523599;27677260;28697420;29368331 False 3 100;0;0 1.2304 True ENSG00000069966 ENSG00000069966 HGNC:4401 GNE gene GNE Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Thrombocytopenia 12 with or without myopathy, MIM#620757;Nonaka myopathy 605820;Sialuria MIM#269921;ADUDP-GlcNAc epimerase/kinase deficiency (Disorders of multiple glycosylation and other glycosylation pathways) 12177386;12473753;32053088;29923088;10356312;11326336;11486897;27142465 False 3 100;0;0 1.2304 True ENSG00000159921 ENSG00000159921 HGNC:23657 GNMT gene GNMT Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Glycine N-methyltransferase deficiency MIM#606664;Disorders of the metabolism of sulphur amino acids 11810299;14739680;17937387;27207470 False 3 100;0;0 1.2304 True ENSG00000124713 ENSG00000124713 HGNC:4415 GNPAT gene GNPAT Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Rhizomelic chondrodysplasia punctata, type 2, MIM# 222765;MONDO:0009112 9536089;11152660;21990100 False 3 100;0;0 1.2304 True ENSG00000116906 ENSG00000116906 HGNC:4416 GNPTAB gene GNPTAB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mucolipidosis II alpha/beta, MIM# 252500;MONDO:0009650;Mucolipidosis III alpha/beta, MIM# 252600;MONDO:0018931 20301728;16465621 False 3 100;0;0 1.2304 True ENSG00000111670 ENSG00000111670 HGNC:29670 GNPTG gene GNPTG Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mucolipidosis III gamma, MIM# 252605;MONDO:0009652 10712439;19370764;19659762;33507475;33023972;32651481 False 3 100;0;0 1.2304 True ENSG00000090581 ENSG00000090581 HGNC:23026 GNRH1 gene GNRH1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypogonadotropic hypogonadism 12 with or without anosmia, MIM# 614841 19535795;19567835;32134721;31200363;26595427 False 3 100;0;0 1.2304 True ENSG00000147437 ENSG00000147437 HGNC:4419 GNRHR gene GNRHR Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypogonadotropic hypogonadism 7 without anosmia, MIM#146110 28348023;9371856 False 3 100;0;0 1.2304 True ENSG00000109163 ENSG00000109163 HGNC:4421 GNS gene GNS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mucopolysaccharidosis type IIID, MIM# 252940;Sanfilippo syndrome type D, MONDO:0009658 12573255;12624138;31536183;25851924 False 3 100;0;0 1.2304 True ENSG00000135677 ENSG00000135677 HGNC:4422 GOLGA2 gene GOLGA2 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Developmental delay with hypotonia, myopathy, and brain abnormalities, MIM 620240 PMID: 30237576;26742501;34424553 False 3 100;0;0 1.2304 True ENSG00000167110 ENSG00000167110 HGNC:4425 GON4L gene GON4L Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal complex neurodevelopmental disorder MONDO:0100038 39500882;21937992;31785789;34011629;33077954 False 3 100;0;0 1.2304 True ENSG00000116580 ENSG00000116580 HGNC:25973 GON7 gene GON7 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Galloway-Mowat syndrome 9, MIM# 619603 31481669 False 3 100;0;0 1.2304 True ENSG00000170270 ENSG00000170270 HGNC:20356 GORAB gene GORAB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Geroderma osteodysplasticum, MIM#231070 False 3 100;0;0 1.2304 True ENSG00000120370 ENSG00000120370 HGNC:25676 GOSR2 gene GOSR2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 6 , MIM#614018;Muscular dystrophy, congenital, with or without seizures, MIM# 620166 21549339;24458321;30363482 False 3 50;0;50 1.2304 True ENSG00000108433 ENSG00000108433 HGNC:4431 GOT2 gene GOT2 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Epileptic encephalopathy, early infantile, 82, MIM# 618721" 31422819 False 3 100;0;0 1.2304 True ENSG00000125166 ENSG00000125166 HGNC:4433 GP1BA gene GP1BA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Bernard-Soulier syndrome, type A1 (recessive), (MIM#231200), AR (AR BSS);von Willebrand disease, platelet-type, (MIM#177820), AD (VWD);MONDO:0008332;Bernard-Soulier syndrome, type A2 (dominant), (MIM#153670) (AD BSS);MONDO:0007930 24934643 False 3 100;0;0 1.2304 True ENSG00000185245 ENSG00000185245 HGNC:4439 GP1BB gene GP1BB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Bernard-Soulier syndrome, type B, MIM# 231200;Macrothrombocytopaenia 8703016;9116284;10887115;33813986;33657022;33216977;31997307;1730088;11222377 False 3 100;0;0 1.2304 True ENSG00000203618 ENSG00000203618 HGNC:4440 GP6 gene GP6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bleeding disorder, platelet-type, 11, MIM# 614201;MONDO:0013623 19549989;19552682;23815599 False 3 100;0;0 1.2304 True ENSG00000088053 ENSG00000088053 HGNC:14388 GP9 gene GP9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bernard-Soulier syndrome, type C, MIM# 231200 8049428;33553065;32030720;31484196 False 3 100;0;0 1.2304 True ENSG00000169704 ENSG00000169704 HGNC:4444 GPAA1 gene GPAA1 Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Glycosylphosphatidylinositol biosynthesis defect 15, MIM#617810 29100095 False 3 100;0;0 1.2304 True ENSG00000197858 ENSG00000197858 HGNC:4446 GPATCH11 gene GPATCH11 Expert Review Green;Other Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092, GPATCH11-related;Leber congenital amaurosis and developmental delay 39572588 False 3 100;0;0 1.2304 True ENSG00000152133 ENSG00000152133 HGNC:26768 GPC3 gene GPC3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Simpson-Golabi-Behmel syndrome, type 1, MIM# 312870 False 3 100;0;0 1.2304 True ENSG00000147257 ENSG00000147257 HGNC:4451 GPC4 gene GPC4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Keipert syndrome OMIM# 301026 30982611 False 3 100;0;0 1.2304 True ENSG00000076716 ENSG00000076716 HGNC:4452 GPC6 gene GPC6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Omodysplasia 1 (MIM#258315), AR 19481194;32655339 False 3 100;0;0 1.2304 True ENSG00000183098 ENSG00000183098 HGNC:4454 GPD1 gene GPD1 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypertriglyceridemia, transient infantile MIM#614480;glycerol-3-phosphate dehydrogenase deficiency 32591995;22226083;33447932;24549054;35365473;34484308 False 3 100;0;0 1.2304 True ENSG00000167588 ENSG00000167588 HGNC:4455 GPHN gene GPHN Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Molybdenum cofactor deficiency C, MIM# 615501;Epilepsy;Autism;Intellectual disability 22040219;11095995;26613940;24561070;23393157;27604308;9812897 False 3 100;0;0 1.2304 True ENSG00000171723 ENSG00000171723 HGNC:15465 GPI gene GPI Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hemolytic anemia, nonspherocytic, due to glucose phosphate isomerase deficiency, MIM# 613470 False 3 100;0;0 1.2304 True ENSG00000105220 ENSG00000105220 HGNC:4458 GPIHBP1 gene GPIHBP1 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Hyperlipoproteinemia, type 1D MIM#615947;familial chylomicronemia syndrome 17883852;19304573;20026666;17403372 False 3 100;0;0 1.2304 True ENSG00000182851 ENSG00000277494 HGNC:24945 GPNMB gene GPNMB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Amyloidosis, primary localized cutaneous, 3, MIM# 617920 29336782 False 3 100;0;0 1.2304 True ENSG00000136235 ENSG00000136235 HGNC:4462 GPR143 gene GPR143 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females congenital nystagmus 6, MIM 300814;type I ocular albinism, Nettleship-Falls type, MIM 300500 30555098;29761529 False 3 100;0;0 1.2304 True ENSG00000101850 ENSG00000101850 HGNC:20145 GPR156 gene GPR156 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 121, MIM# 620551 PMID: 36928819 False 3 100;0;0 1.2304 True ENSG00000175697 ENSG00000175697 HGNC:20844 GPR161 gene GPR161 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Predisposition to paediatric medulloblastoma 31609649 False 3 100;0;0 1.2304 True ENSG00000143147 ENSG00000143147 HGNC:23694 GPR179 gene GPR179 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Night blindness, congenital stationary (complete), 1E, autosomal recessive (MIM#614565) 22325361 False 3 100;0;0 1.2304 True ENSG00000188888 ENSG00000277399 HGNC:31371 GPR68 gene GPR68 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Amelogenesis imperfecta, hypomaturation type, IIA6 MIM#617217 27693231;32279993 False 3 100;0;0 1.2304 True ENSG00000119714 ENSG00000119714 HGNC:4519 GPRC5B gene GPRC5B Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Megalencephalic leukoencephalopathy with subcortical cysts 3 620447" 37143309 False 3 100;0;0 1.2304 True ENSG00000167191 ENSG00000167191 HGNC:13308 GPSM2 gene GPSM2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Chudley-McCullough syndrome, MIM# 604213 20602914;22578326;28387217;27180139;27064331 False 3 100;0;0 1.2304 True ENSG00000121957 ENSG00000121957 HGNC:29501 GPT2 gene GPT2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly and spastic paraplegia, MIM# 616281 27601654;25758935 False 3 100;0;0 1.2304 True ENSG00000166123 ENSG00000166123 HGNC:18062 GPX4 gene GPX4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spondylometaphyseal dysplasia, Sedaghatian type MIM#250220 24706940;32827718 False 3 100;0;0 1.2304 True ENSG00000167468 ENSG00000167468 HGNC:4556 GREB1L gene GREB1L Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Renal hypodysplasia/aplasia 3, OMIM# 617805;Deafness, autosomal dominant 80, MIM# 619274 29100091;29955957;32585897 False 3 100;0;0 1.2304 True ENSG00000141449 ENSG00000141449 HGNC:31042 GRHL2 gene GRHL2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Ectodermal dysplasia/short stature syndrome MIM#616029;Corneal dystrophy, posterior polymorphous, 4, MIM# 618031;Deafness, autosomal dominant 28, MIM# 608641 25152456;29499165;27612988;19415813 False 3 100;0;0 1.2304 True ENSG00000083307 ENSG00000083307 HGNC:2799 GRHL3 gene GRHL3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Van der Woude syndrome 2 MIM#606713 24360809;29500247 False 3 0;0;0 1.2304 True ENSG00000158055 ENSG00000158055 HGNC:25839 GRHPR gene GRHPR Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hyperoxaluria, primary, type II, MIM# 260000;MONDO:0009824 10484776;11030416;24116921 False 3 100;0;0 1.2304 True ENSG00000137106 ENSG00000137106 HGNC:4570 GRIA1 gene GRIA1 Expert list;Expert Review Green Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Intellectual developmental disorder, autosomal dominant 67, MIM# 619927;Intellectual developmental disorder, autosomal recessive 76, MIM# 619931 28628100;23033978;26350204;24896178;35675825 False 3 100;0;0 1.2304 True ENSG00000155511 ENSG00000155511 HGNC:4571 GRIA2 gene GRIA2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Intellectual disability;autism;Rett-like features;epileptic encephalopathy;Neurodevelopmental disorder with language impairment and behavioral abnormalities, MIM# 618917" 31300657 False 3 100;0;0 1.2304 True ENSG00000120251 ENSG00000120251 HGNC:4572 GRIA3 gene GRIA3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Intellectual developmental disorder, X-linked, syndromic, Wu type (MIM#300699) 32977175;17989220;38038360 False 3 100;0;0 1.2304 True ENSG00000125675 ENSG00000125675 HGNC:4573 GRIA4 gene GRIA4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with or without seizures and gait abnormalities MIM#617864 35518358;29220673 False 3 100;0;0 1.2304 True ENSG00000152578 ENSG00000152578 HGNC:4574 GRID2 gene GRID2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome Unknown Spinocerebellar ataxia, autosomal recessive 18 MIM#616204 32622959;32170608 False 3 100;0;0 1.2304 True ENSG00000152208 ENSG00000152208 HGNC:4576 GRIK2 gene GRIK2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mental retardation, autosomal recessive, 6 MIM# 611092;Neurodevelopmental disorder with impaired language and ataxia and with or without seizures, MIM# 619580 34375587;17847003;25039795 False 3 100;0;0 1.2304 True ENSG00000164418 ENSG00000164418 HGNC:4580 GRIN1 gene GRIN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Developmental and epileptic encephalopathy 101, MIM# 619814;Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254;Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820" 29365063;27164704;27164704;28051072 False 3 100;0;0 1.2304 True ENSG00000176884 ENSG00000176884 HGNC:4584 GRIN2A gene GRIN2A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Epilepsy, focal, with speech disorder and with or without mental retardation, MIM# 245570 30544257;35983985 False 3 100;0;0 1.2304 True Other ENSG00000183454 ENSG00000183454 HGNC:4585 GRIN2B gene GRIN2B Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 6, MIM# 613970;Epileptic encephalopathy, early infantile, 27, MIM# 616139 28377535 False 3 100;0;0 1.2304 True ENSG00000273079 ENSG00000273079 HGNC:4586 GRIN2D gene GRIN2D Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 46 MIM#617162 27616483;30280376 False 3 100;0;0 1.2304 True ENSG00000105464 ENSG00000105464 HGNC:4588 GRIP1 gene GRIP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Fraser syndrome 3 MIM#617667;CAKUT 24700879;24357607;22510445;31982235;27859469 False 3 100;0;0 1.2304 True ENSG00000155974 ENSG00000155974 HGNC:18708 GRK1 gene GRK1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Oguchi disease-2, 613411 17070587;33252155 False 3 100;0;0 1.2304 True ENSG00000185974 ENSG00000185974 HGNC:10013 GRM1 gene GRM1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Spinocerebellar ataxia 44 MIM#617691;Spinocerebellar ataxia, autosomal recessive 13 MIM#614831 22901947;26308914;31319223 False 3 100;0;0 1.2304 True ENSG00000152822 ENSG00000152822 HGNC:4593 GRM6 gene GRM6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Night blindness, congenital stationary (complete), 1B, autosomal recessive 257270 22008250 False 3 100;0;0 1.2304 True ENSG00000113262 ENSG00000113262 HGNC:4598 GRM7 gene GRM7 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Epilepsy, microcephaly, developmental delay;neurodevelopmental disorder with seizures, hypotonia, and brain imaging abnormalities (NEDSHBA), MIM#618922 32286009;32248644 False 3 100;0;0 1.2304 True ENSG00000196277 ENSG00000196277 HGNC:4599 GRXCR1 gene GRXCR1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 25, MIM# 613285 20137778;25802247;26226137;26445815;26969326;20137774 False 3 100;0;0 1.2304 True ENSG00000215203 ENSG00000215203 HGNC:31673 GRXCR2 gene GRXCR2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 101, MIM# 615837 24619944;33528103 False 3 100;0;0 1.2304 True ENSG00000204928 ENSG00000204928 HGNC:33862 GSC gene GSC Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Short stature, auditory canal atresia, mandibular hypoplasia, skeletal abnormalities, MIM# 602471 24290375 False 3 100;0;0 1.2304 True ENSG00000133937 ENSG00000133937 HGNC:4612 GSN gene GSN Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Amyloidosis, Finnish type, MIM# 105120 2176164;28139293 False 3 100;0;0 1.2304 True ENSG00000148180 ENSG00000148180 HGNC:4620 GSS gene GSS Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Glutathione synthetase deficiency MIM#266130;Hemolytic anemia due to glutathione synthetase deficiency MIM#231900;Disorders of the gamma-glutamyl cycle 8896573;9215686 False 3 100;0;0 1.2304 True ENSG00000100983 ENSG00000100983 HGNC:4624 GTF2H5 gene GTF2H5 Expert Review Green;Literature;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Trichothiodystrophy 3, photosensitive, MIM# 616395;MONDO:0014619 30359777;28833524;15220921;8213812;24986372 False 3 100;0;0 1.2304 True ENSG00000272047 ENSG00000272047 HGNC:21157 GTF3C3 gene GTF3C3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder MONDO:0700092, GTF3C3-related 28940097;28097321;30552426 False 3 100;0;0 1.2304 True ENSG00000119041 ENSG00000119041 HGNC:4666 GTF3C5 gene GTF3C5 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal neurodevelopmental disorder MONDO:0700092, GTF3C5-related 38520561;35503477 False 3 100;0;0 1.2304 True ENSG00000148308 ENSG00000148308 HGNC:4668 GTPBP1 gene GTPBP1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with characteristic facial and ectodermal features and tetraparesis 1, MIM# 620888 38118446 False 3 100;0;0 1.2304 True ENSG00000100226 ENSG00000100226 HGNC:4669 GTPBP2 gene GTPBP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Jaberi-Elahi syndrome, MIM#617988 26675814;29449720;30790272 False 3 100;0;0 1.2304 True ENSG00000172432 ENSG00000172432 HGNC:4670 GTPBP3 gene GTPBP3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 23 MIM#616198 34276756;25434004 False 3 100;0;0 1.2304 True ENSG00000130299 ENSG00000130299 HGNC:14880 GUCA1A gene GUCA1A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cone dystrophy-3, MIM# 602093;Cone-rod dystrophy 14, MIM# 602093 9425234;15953638;11146732;28125083 False 3 100;0;0 1.2304 True ENSG00000048545 ENSG00000048545 HGNC:4678 GUCY1A3 gene GUCY1A3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Moyamoya 6 with achalasia, MIM# 615750 24581742;26777256;34381413;33109895 False 3 100;0;0 1.2304 True ENSG00000164116 ENSG00000164116 HGNC:4685 GUCY2C gene GUCY2C Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Diarrhoea 6, MIM# 614616;Meconium ileus, MIM# 614665 22521417;22436048;25994218;30353760;28957388;22521417;33883099;31079856 False 3 100;0;0 1.2304 True ENSG00000070019 ENSG00000070019 HGNC:4688 GUCY2D gene GUCY2D Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Cone-rod dystrophy 6, MIM# 601777;Leber congenital amaurosis 1, MIM# 204000;Night blindness, congenital stationary, type 1I, MIM# 618555 35314386;35205358 False 3 100;0;0 1.2304 True ENSG00000132518 ENSG00000132518 HGNC:4689 GUK1 gene GUK1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 21, MIM# 621071 39230499 False 3 100;0;0 1.2304 True ENSG00000143774 ENSG00000143774 HGNC:4693 GUSB gene GUSB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mucopolysaccharidosis VII, MIM# 253220;MONDO:0009662 False 3 100;0;0 1.2304 True ENSG00000169919 ENSG00000169919 HGNC:4696 GYG1 gene GYG1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Polyglucosan body myopathy 2, MIM# 616199;Glycogen storage disease XV , MIM# 613507 32905144;31791869;29422440;25272951;20357282 False 3 100;0;0 1.2304 True ENSG00000163754 ENSG00000163754 HGNC:4699 GYS1 gene GYS1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease 0, muscle, MIM# 611556 17928598;19699667;21958591 False 3 100;0;0 1.2304 True ENSG00000104812 ENSG00000104812 HGNC:4706 GYS2 gene GYS2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease 0, liver (MIM#240600) 32395408;28245189 False 3 100;0;0 1.2304 True ENSG00000111713 ENSG00000111713 HGNC:4707 GZF1 gene GZF1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Joint laxity, short stature, and myopia, MIM# 617662;Larsen-like syndrome 33009817;28475863 False 3 100;0;0 1.2304 True ENSG00000125812 ENSG00000125812 HGNC:15808 H3F3A gene H3F3A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability;regression;seizures 33057194;31942419;33268356 False 3 50;50;0 1.2304 True ENSG00000163041 ENSG00000163041 HGNC:4764 H3F3B gene H3F3B Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability;regression;seizures 33268356 False 3 100;0;0 1.2304 True ENSG00000132475 ENSG00000132475 HGNC:4765 H6PD gene H6PD Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cortisone reductase deficiency 1, MIM# 604931 18628520 False 3 100;0;0 1.2304 True ENSG00000049239 ENSG00000049239 HGNC:4795 HAAO gene HAAO Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Vertebral, cardiac, renal, and limb defects syndrome 1 MIM#617660;NAD deficiency 28792876 False 3 100;0;0 1.2304 True ENSG00000162882 ENSG00000162882 HGNC:4796 HACD1 gene HACD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital myopathy, MONDO:0019952 15829503;23933735;32426512 False 3 100;0;0 1.2304 True ENSG00000165996 ENSG00000165996 HGNC:9639 HACE1 gene HACE1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia and psychomotor retardation with or without seizures, 616756;MONDO:0014764 26424145;26437029;31321300 False 3 100;0;0 1.2304 True ENSG00000085382 ENSG00000085382 HGNC:21033 HADH gene HADH Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal 3-hydroxyacyl-CoA dehydrogenase deficiency, MIM# 231530;Hyperinsulinemic hypoglycemia, familial, 4, MIM# 609975 False 3 100;0;0 1.2304 True ENSG00000138796 ENSG00000138796 HGNC:4799 HADHA gene HADHA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal LCHAD deficiency, MIM# 609016;MONDO:0012173 False 3 100;0;0 1.2304 True ENSG00000084754 ENSG00000084754 HGNC:4801 HADHB gene HADHB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Trifunctional protein deficiency, MIM# 609015 30682426;28515471 False 3 100;0;0 1.2304 True ENSG00000138029 ENSG00000138029 HGNC:4803 HAMP gene HAMP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Haemochromatosis, type 2B, MIM# 613313 12469120;34828384;15198949 False 3 100;0;0 1.2304 True ENSG00000105697 ENSG00000105697 HGNC:15598 HARS gene HARS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Charcot-Marie-Tooth disease, axonal, type 2W MIM#616625;Usher syndrome type 3B MIM#614504;Multisystemic ataxic syndrome 32333447;32940403;26072516 False 3 100;0;0 1.2304 True ENSG00000170445 ENSG00000170445 HGNC:4816 HARS2 gene HARS2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Perrault syndrome 2, MIM# 614926 31827252 False 3 100;0;0 1.2304 True ENSG00000112855 ENSG00000112855 HGNC:4817 HAVCR2 gene HAVCR2 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "T-cell lymphoma, subcutaneous panniculitis-like, MIM# 618398" 30374066;30792187 False 3 100;0;0 1.2304 True ENSG00000135077 ENSG00000135077 HGNC:18437 HAX1 gene HAX1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neutropaenia, severe congenital 3, autosomal recessive, MIM# 610738;Kostmann syndrome MONDO:0012548 17187068;18611981;19036076 False 3 100;0;0 1.2304 True ENSG00000143575 ENSG00000143575 HGNC:16915 HBA1 gene HBA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Erythrocytosis 7, MIM# 617981;Heinz body anemias, alpha-, MIM# 140700;Methemoglobinemia, alpha type , MIM#617973;Thalassemias, alpha-, MIM# 604131;Hemoglobin H disease, nondeletional, MIM# 613978 False 3 100;0;0 1.2304 True ENSG00000206172 ENSG00000206172 HGNC:4823 HBA2 gene HBA2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Erythrocytosis 7, MIM# 617981;Heinz body anaemia, MIM# 140700;Haemoglobin H disease, deletional and nondeletional, MIM# 613978;Thalassaemia, alpha-, MIM# 604131 False 3 100;0;0 1.2304 True ENSG00000188536 ENSG00000188536 HGNC:4824 HBB gene HBB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Delta-beta thalassemia 141749;Erythrocytosis 6 617980;Heinz body anemia 140700;Hereditary persistence of fetal hemoglobin 141749;Methemoglobinemia, beta type 617971;Sickle cell anemia 603903;Thalassemia-beta, dominant inclusion-body 603902;Thalassemia, beta 613985 31788855;20301599;29700171 False 3 100;0;0 1.2304 True ENSG00000244734 ENSG00000244734 HGNC:4827 HBG1 gene HBG1 Expert Review;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Fetal haemoglobin quantitative trait locus 1, 141749 26500940 False 3 100;0;0 1.2304 True ENSG00000213934 ENSG00000213934 HGNC:4831 HBG2 gene HBG2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Fetal hemoglobin quantitative trait locus 1, MIM# 141749;Cyanosis, transient neonatal, MIM# 613977 26500940 False 3 100;0;0 1.2304 True ENSG00000196565 ENSG00000196565 HGNC:4832 HCCS gene HCCS Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Linear skin defects with multiple congenital anomalies 1, MIM# 309801 17033964;30068298;24735900 False 3 100;0;0 1.2304 True ENSG00000004961 ENSG00000004961 HGNC:4837 HCFC1 gene HCFC1 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Mental retardation, X-linked 3 (methylmalonic acidemia and homocysteinemia, cblX type ) 309541 23000143 False 3 100;0;0 1.2304 True ENSG00000172534 ENSG00000172534 HGNC:4839 HCN1 gene HCN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 24, MIM# 615871;Generalized epilepsy with febrile seizures plus, type 10, MIM# 618482 24747641;30351409;30351409 False 3 100;0;0 1.2304 True ENSG00000164588 ENSG00000164588 HGNC:4845 HCN2 gene HCN2 Australian Genomics Health Alliance Epilepsy Flagship;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Febrile seizures, familial, 2, MIM# 602477;Genetic epilepsy with febrile seizures plus;Other seizure disorders;Neurodevelopmental disorder (MONDO#0700092), HCN2-related 22131395;30986657;29064616;20437590;12514127;17931874 False 3 100;0;0 1.2304 True ENSG00000099822 ENSG00000099822 HGNC:4846 HDAC3 gene HDAC3 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, HDAC3-related 39047730 False 3 100;0;0 1.2304 True ENSG00000171720 ENSG00000171720 HGNC:4854 HDAC4 gene HDAC4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Brachydactyly mental retardation syndrome;Brachydactyly without intellectual disability;Intellectual disability syndrome 24715439;20691407;31209962;33537682 False 3 50;50;0 1.2304 True Other ENSG00000068024 ENSG00000068024 HGNC:14063 HDAC8 gene HDAC8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Cornelia de Lange syndrome 5, MIM# 300882 30614194;24403048 False 3 100;0;0 1.2304 True ENSG00000147099 ENSG00000147099 HGNC:13315 HEATR3 gene HEATR3 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Diamond Blackfan anaemia, MONDO:0015253, HEATR3 related PMID: 35213692 False 3 100;0;0 1.2304 True ENSG00000155393 ENSG00000155393 HGNC:26087 HECTD1 gene HECTD1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder MONDO:0700092 PMID: 39879987 False 3 100;0;0 1.2304 True ENSG00000092148 ENSG00000092148 HGNC:20157 HECTD4 gene HECTD4 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with seizures, spasticity, and complete or partial agenesis of the corpus callosum, MIM# 620250 PMID: 36401616 False 3 100;0;0 1.2304 True ENSG00000173064 ENSG00000173064 HGNC:26611 HECW2 gene HECW2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Neurodevelopmental disorder with hypotonia, seizures, and absent language, MIM# 617268;intellectual disability;epilepsy;regression;microcephaly" 29807643;29395664;27334371;27389779 False 3 50;50;0 1.2304 True Other ENSG00000138411 ENSG00000138411 HGNC:29853 HELLS gene HELLS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency-centromeric instability-facial anomalies syndrome 4, MIM# 616911;MONDO:0014829 26216346 False 3 100;0;0 1.2304 True ENSG00000119969 ENSG00000119969 HGNC:4861 HEPACAM gene HEPACAM Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Megalencephalic leukoencephalopathy with subcortical cysts 2A, MIM# 613925;Megalencephalic leukoencephalopathy with subcortical cysts 2B, remitting, with or without mental retardation, MIM# 613926 21419380;21419380 False 3 100;0;0 1.2304 True ENSG00000165478 ENSG00000165478 HGNC:26361 HERC1 gene HERC1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Macrocephaly, dysmorphic facies, and psychomotor retardation, MIM# 617011 28323226;27108999;26153217;26138117;20041218 False 3 100;0;0 1.2304 True ENSG00000103657 ENSG00000103657 HGNC:4867 HERC2 gene HERC2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mental retardation, autosomal recessive 38 (MIM 615516) 23065719;23243086;30902390;32571899;27848944;26077850;27759030 False 3 100;0;0 1.2304 True ENSG00000128731 ENSG00000128731 HGNC:4868 HES7 gene HES7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spondylocostal dysostosis 4, autosomal recessive MIM#613686 29459493;23897666;18775957;20087400 False 3 0;0;0 1.2304 True ENSG00000179111 ENSG00000179111 HGNC:15977 HESX1 gene HESX1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Growth hormone deficiency with pituitary anomalies, MIM#182230;Pituitary hormone deficiency, combined, 5, MIM#182230;Septooptic dysplasia, MIM#182230 False 3 100;0;0 1.2304 True ENSG00000163666 ENSG00000163666 HGNC:4877 HEXA gene HEXA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal GM2-gangliosidosis, several forms 272800;Tay-Sachs disease 272800;MONDO:0010100 31388111 False 3 100;0;0 1.2304 True ENSG00000213614 ENSG00000213614 HGNC:4878 HEXB gene HEXB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Sandhoff disease, infantile, juvenile, and adult forms, MIM# 268800;MONDO:0010006 False 3 100;0;0 1.2304 True ENSG00000049860 ENSG00000049860 HGNC:4879 HFE gene HFE Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Haemochromatosis, MIM# 235200 False 3 100;0;0 1.2304 True ENSG00000010704 ENSG00000010704 HGNC:4886 HFE2 gene HFE2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hemochromatosis, type 2A, MIM# 602390 False 3 100;0;0 1.2304 True ENSG00000168509 ENSG00000168509 HGNC:4887 HFM1 gene HFM1 Expert list;Expert Review Green Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Premature ovarian failure 9 MIM#615724 23555294;24597873;31279343 False 3 100;0;0 1.2304 True ENSG00000162669 ENSG00000162669 HGNC:20193 HGD gene HGD Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Alkaptonuria MIM#203500;Disorders of phenylalanine or tyrosine metabolism 8782815;27604308 False 3 100;0;0 1.2304 True ENSG00000113924 ENSG00000113924 HGNC:4892 HGF gene HGF Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Deafness, autosomal recessive 39, MIM# 608265;Lymphoedema, MONDO:0019297, HGF-related 19576567;38676400;38791500 False 3 100;0;0 1.2304 True ENSG00000019991 ENSG00000019991 HGNC:4893 HGSNAT gene HGSNAT Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mucopolysaccharidosis type IIIC (Sanfilippo C), MIM# 252930;MONDO:0009657;Retinitis pigmentosa 73, MIM# 616544;MONDO:0014687 19479962;31228227;20825431;20583299;17033958;25859010 False 3 100;0;0 1.2304 True ENSG00000165102 ENSG00000165102 HGNC:26527 HHAT gene HHAT Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Nivelon-Nivelon-Mabille syndrome 600092 24784881;30912300 False 3 100;0;0 1.2304 True ENSG00000054392 ENSG00000054392 HGNC:18270 HIBCH gene HIBCH Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal 3-hydroxyisobutryl-CoA hydrolase deficiency, MIM# 250620 26026795;25251209;24299452;32677093 False 3 100;0;0 1.2304 True ENSG00000198130 ENSG00000198130 HGNC:4908 HID1 gene HID1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Syndromic infantile encephalopathy;Hypopituitarism 33999436 False 3 100;0;0 1.2304 True ENSG00000167861 ENSG00000167861 HGNC:15736 HIKESHI gene HIKESHI Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 13, MIM# 616881 26545878 False 3 100;0;0 1.2304 True ENSG00000149196 ENSG00000149196 HGNC:26938 HINT1 gene HINT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neuromyotonia and axonal neuropathy, autosomal recessive, MIM# 137200;Gamstorp-Wohlfart syndrome, MONDO:0007646 22961002;33663550;33404983;31848916 False 3 100;0;0 1.2304 True ENSG00000169567 ENSG00000169567 HGNC:4912 HIRA gene HIRA Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder 33417013;28135719;25363760 False 3 100;0;0 1.2304 True ENSG00000100084 ENSG00000100084 HGNC:4916 HIST1H1E gene HIST1H1E Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Rahman syndrome, MIM# 617537 28475857;33270410;31910894;31400068 False 3 100;0;0 1.2304 True ENSG00000168298 ENSG00000168298 HGNC:4718 HIST1H4C gene HIST1H4C Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Tessadori-van Haaften neurodevelopmental syndrome 1 MIM#619758 28920961;35202563 False 3 100;0;0 1.2304 True ENSG00000197061 ENSG00000197061 HGNC:4787 HIST1H4E gene HIST1H4E Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Tessadori-van Haaften neurodevelopmental syndrome 3, MIM# 619950 35202563 False 3 100;0;0 1.2304 True - - HGNC:4790 HIST1H4I gene HIST1H4I Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental syndrome, MONDO:0700092, HIST1H4I-related PMID: 35202563 False 3 100;0;0 1.2304 True ENSG00000198339 ENSG00000276180 HGNC:4793 HIVEP2 gene HIVEP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 43 MIM#616977 26153216;27003583;16836985;31602191;31207095 False 3 100;0;0 1.2304 True ENSG00000010818 ENSG00000010818 HGNC:4921 HK1 gene HK1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neuropathy, hereditary motor and sensory, Russe type , MIM#605285;Haemolytic anaemia due to hexokinase deficiency, MIM# 235700;Neurodevelopmental disorder with visual defects and brain anomalies, MIM# 618547;Retinitis pigmentosa 79, MIM# 617460 19536174;30778173;25316723;25190649;31621442;32814480;7655856;12393545;33361148;31119733;27282571 False 3 100;0;0 1.2304 True ENSG00000156515 ENSG00000156515 HGNC:4922 HLCS gene HLCS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Holocarboxylase synthetase deficiency, MIM# 253270 10190325 False 3 100;0;0 1.2304 True ENSG00000159267 ENSG00000159267 HGNC:4976 HMBS gene HMBS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Porphyria, acute intermittent, MIM#176000;Porphyria, acute intermittent, non-erythroid variant, MIM#176000;Encephalopathy, porphyria-related MIM#620704;Leukoencephalopathy, porphyria-related, MIM#620711 False 3 100;0;0 1.2304 True ENSG00000256269 ENSG00000256269 HGNC:4982 HMGA2 gene HMGA2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Silver-Russel syndrome, MIM#618908 29655892;25809938;29453418;29655892;28796236 False 3 100;0;0 1.2304 True ENSG00000149948 ENSG00000149948 HGNC:5009 HMGB1 gene HMGB1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown brachyphalangy, polydactyly, and tibial aplasia/hypoplasia MIM#163905;Neurodevelopmental disorder MONDO:0700092, HMGB1-related 34159400;34164801;36755093 False 3 100;0;0 1.2304 True ENSG00000189403 ENSG00000189403 HGNC:4983 HMGCL gene HMGCL Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal HMG-CoA lyase deficiency, MIM# 246450 8617516 False 3 100;0;0 1.2304 True ENSG00000117305 ENSG00000117305 HGNC:5005 HMGCR gene HMGCR Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal autosomal recessive limb-girdle muscular dystrophy (MONDO: 0015152), HMGCR-related 18354102;29480216;37167966;36745799 False 3 50;0;50 1.2304 True ENSG00000113161 ENSG00000113161 HGNC:5006 HMGCS1 gene HMGCS1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Rigid spine syndrome, MONDO:0019951, HMGCS1-related 39531736 False 3 100;0;0 1.2304 True ENSG00000112972 ENSG00000112972 HGNC:5007 HMGCS2 gene HMGCS2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal HMG-CoA synthase-2 deficiency, MIM# 605911 33045405 False 3 100;0;0 1.2304 True ENSG00000134240 ENSG00000134240 HGNC:5008 HMOX1 gene HMOX1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Heme oxygenase-1 deficiency, MIM# 614034;Asplenia 21088618;9884342;20844238;33066778 False 3 100;0;0 1.2304 True ENSG00000100292 ENSG00000100292 HGNC:5013 HMX1 gene HMX1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Oculoauricular syndrome, MIM#612109 18423520;25574057;33465110;32552830;31691317 False 3 100;0;0 1.2304 True ENSG00000215612 ENSG00000215612 HGNC:5017 HNF1A gene HNF1A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Diabetes mellitus, insulin-dependent, 20, MIM# 612520;MODY, type III , MIM#600496 9097962;9112026 False 3 100;0;0 1.2304 True ENSG00000135100 ENSG00000135100 HGNC:11621 HNF1B gene HNF1B Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Renal cysts and diabetes syndrome, MIM# 137920 False 3 100;0;0 1.2304 True ENSG00000108753 ENSG00000275410 HGNC:11630 HNF4A gene HNF4A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Fanconi renotubular syndrome 4, with maturity-onset diabetes of the young, OMIM #616026;MODY, type I, OMIM # 125850 31875549;24285859;22802087;30005691;28458902 False 3 100;0;0 1.2304 True ENSG00000101076 ENSG00000101076 HGNC:5024 HNMT gene HNMT Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mental retardation, autosomal recessive 51, MIM#616739 26206890;30744146;33310825;33739554 False 3 100;0;0 1.2304 True ENSG00000150540 ENSG00000150540 HGNC:5028 HNRNPA1 gene HNRNPA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 20 MIM#615426 23455423;34291734 False 3 100;0;0 1.2304 True ENSG00000135486 ENSG00000135486 HGNC:5031 HNRNPA2B1 gene HNRNPA2B1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted oculopharyngeal muscular dystrophy, MONDO:0008116, OMIM#620460;Inclusion body myopathy with early-onset Paget disease with or without frontotemporal dementia 2 MIM#615422 23455423;30279180;29358076;26744327;23635965 False 3 50;50;0 1.2304 True ENSG00000122566 ENSG00000122566 HGNC:5033 HNRNPC gene HNRNPC Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder-74, MIM#620688 37541189 False 3 100;0;0 1.2304 True ENSG00000092199 ENSG00000092199 HGNC:5035 HNRNPD gene HNRNPD Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder 33057194;33874999 False 3 50;50;0 1.2304 True ENSG00000138668 ENSG00000138668 HGNC:5036 HNRNPDL gene HNRNPDL Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Muscular dystrophy, limb-girdle, autosomal dominant 3 MIM#609115 24647604;31267206;31995753;32407983;32904822;32367994 False 3 100;0;0 1.2304 True ENSG00000152795 ENSG00000152795 HGNC:5037 HNRNPH1 gene HNRNPH1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with craniofacial dysmorphism and skeletal defects, MIM# 620083 32335897;29938792;35989590 False 3 50;50;0 1.2304 True ENSG00000169045 ENSG00000169045 HGNC:5041 HNRNPH2 gene HNRNPH2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Intellectual developmental disorder, X-linked, syndromic, Bain type MIM#300986 34907471;33728377;31670473;31236915;30887513 False 3 100;0;0 1.2304 True ENSG00000126945 ENSG00000126945 HGNC:5042 HNRNPK gene HNRNPK Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Au-Kline syndrome MIM#616580 30998304;26173930;29904177;26954065;28771707 False 3 100;0;0 1.2304 True ENSG00000165119 ENSG00000165119 HGNC:5044 HNRNPR gene HNRNPR Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Neurodevelopmental disorder with dysmorphic facies and skeletal and brain abnormalities, MIM# 620073" 26795593;31079900 False 3 100;0;0 1.2304 True ENSG00000125944 ENSG00000125944 HGNC:5047 HNRNPU gene HNRNPU Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 54 MIM# 617391 28944577;28393272 False 3 100;0;0 1.2304 True ENSG00000153187 ENSG00000153187 HGNC:5048 HOGA1 gene HOGA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hyperoxaluria, primary, type III MIM#613616 20797690;21896830;22391140 False 3 100;0;0 1.2304 True ENSG00000241935 ENSG00000241935 HGNC:25155 HOMER2 gene HOMER2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Deafness, autosomal dominant 68, MIM# 616707 25816005;30047143;25816005 False 3 100;0;0 1.2304 True ENSG00000103942 ENSG00000103942 HGNC:17513 HOXA1 gene HOXA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Athabaskan brainstem dysgenesis syndrome MIM#601536;Bosley-Salih-Alorainy syndrome MIM#601536 16155570;18412118;32864817 False 3 100;0;0 1.2304 True ENSG00000105991 ENSG00000105991 HGNC:5099 HOXA13 gene HOXA13 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hand-foot-uterus syndrome, MIM# 140000 10839976;9020844 False 3 100;0;0 1.2304 True ENSG00000106031 ENSG00000106031 HGNC:5102 HOXA2 gene HOXA2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Microtia with or without hearing impairment, MIM# 612290 18394579;23775976;27503514;32649979;31567444 False 3 100;0;0 1.2304 True ENSG00000105996 ENSG00000105996 HGNC:5103 HOXB1 gene HOXB1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Facial paresis, hereditary congenital, 3, MIM# 614744;MONDO:0013880 22770981;26007620;27144914 False 3 100;0;0 1.2304 True ENSG00000120094 ENSG00000120094 HGNC:5111 HOXC13 gene HOXC13 Expert Review Green;Literature;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ectodermal dysplasia 9, hair/nail type MIM#614931 23063621;23315978;29278420 False 3 100;0;0 1.2304 True ENSG00000123364 ENSG00000123364 HGNC:5125 HOXD13 gene HOXD13 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Brachydactyly, type E 113300 Brachydactyly, type D, MIM# 113200;Syndactyly, type V, MIM# 186300;Synpolydactyly 1, MIM# 186000;Brachydactyly-syndactyly syndrome, MIM# 610713 34777468;32509852 False 3 100;0;0 1.2304 True ENSG00000128714 ENSG00000128714 HGNC:5136 HPCA gene HPCA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Dystonia 2, torsion, autosomal recessive, MIM# 224500;MONDO:0009141 25799108;30991467;30145809 False 3 100;0;0 1.2304 True ENSG00000121905 ENSG00000121905 HGNC:5144 HPD gene HPD Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Hawkinsinuria (MIM#140350), AD;Tyrosinemia type III (MIM#276710), AR 10942115;17560158 False 3 100;0;0 1.2304 True ENSG00000158104 ENSG00000158104 HGNC:5147 HPDL gene HPDL Expert Review;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia-83 (SPG83), MIM#619027;Neurodevelopmental disorder with progressive spasticity and brain white matter abnormalities (NEDSWMA), MIM#619026;Progressive neurological disorder;Leigh-like syndrome 32707086 False 3 100;0;0 1.2304 True ENSG00000186603 ENSG00000186603 HGNC:28242 HPGD gene HPGD Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypertrophic osteoarthropathy, primary, autosomal recessive 1 MIM#259100;Cranioosteoarthropathy MIM#259100 20406614;32282352;31878983;29282707 False 3 100;0;0 1.2304 True ENSG00000164120 ENSG00000164120 HGNC:5154 HPRT1 gene HPRT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females HPRT-related gout (MIM# 300323);Lesch-Nyhan syndrome (MIM# 300322) 20176575 False 3 100;0;0 1.2304 True ENSG00000165704 ENSG00000165704 HGNC:5157 HPS1 gene HPS1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hermansky-Pudlak syndrome 1, MIM# 203300;MONDO:0008748 9497254 False 3 100;0;0 1.2304 True ENSG00000107521 ENSG00000107521 HGNC:5163 HPS3 gene HPS3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hermansky-Pudlak syndrome 3, MIM# 614072;MONDO:0013555 11455388;31880485;31621111;30990103 False 3 100;0;0 1.2304 True ENSG00000163755 ENSG00000163755 HGNC:15597 HPS4 gene HPS4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hermansky-Pudlak syndrome 4, MIM# 614073;MONDO:0013556 11836498;12664304 False 3 100;0;0 1.2304 True ENSG00000100099 ENSG00000100099 HGNC:15844 HPS5 gene HPS5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hermansky-Pudlak syndrome 5 (MIM#614074) 28296950;32725903 False 3 100;0;0 1.2304 True ENSG00000110756 ENSG00000110756 HGNC:17022 HPS6 gene HPS6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hermansky-Pudlak syndrome 6, MIM# 614075;MONDO:0013558 12548288;17041891;19843503 False 3 100;0;0 1.2304 True ENSG00000166189 ENSG00000166189 HGNC:18817 HPSE2 gene HPSE2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Urofacial syndrome 1 MIM#236730 25145936;23313374;33558177 False 3 100;0;0 1.2304 True ENSG00000172987 ENSG00000172987 HGNC:18374 HR gene HR Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Alopecia universalis MIM#203655;Atrichia with papular lesions MIM#209500 False 3 100;0;0 1.2304 True ENSG00000168453 ENSG00000168453 HGNC:5172 HRAS gene HRAS Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Costello syndrome, MIM# 218040 16329078;16372351;16443854 False 3 100;0;0 1.2304 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000174775 ENSG00000174775 HGNC:5173 HRG gene HRG Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Thrombophilia 11 due to HRG deficiency, MIM# 613116 8236132;11057869;11057869;29108964 False 3 100;0;0 1.2304 True ENSG00000113905 ENSG00000113905 HGNC:5181 HS2ST1 gene HS2ST1 Expert Review Green;Literature;NHS GMS Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurofacioskeletal syndrome with or without renal agenesis, MIM#619194;Intellectual disability;dysmorphic features;congenital anomalies 33159882 False 3 100;0;0 1.2304 True ENSG00000153936 ENSG00000153936 HGNC:5193 HSD11B2 gene HSD11B2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Apparent mineralocorticoid excess, MIM# 218030;MONDO:0009025 7670488;9683587;17314322 False 3 100;0;0 1.2304 True ENSG00000176387 ENSG00000176387 HGNC:5209 HSD17B10 gene HSD17B10 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) HSD10 mitochondrial disease, MIM# 300438 False 3 100;0;0 1.2304 True ENSG00000072506 ENSG00000072506 HGNC:4800 HSD17B3 gene HSD17B3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pseudohermaphroditism, male, with gynecomastia MIM#264300 8550739;11158067 False 3 100;0;0 1.2304 True ENSG00000130948 ENSG00000130948 HGNC:5212 HSD17B4 gene HSD17B4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal D-bifunctional protein deficiency, AR (MIM#261515);Perrault syndrome 1, AR (MIM#233400) 27790638 False 3 100;0;0 1.2304 True ENSG00000133835 ENSG00000133835 HGNC:5213 HSD3B2 gene HSD3B2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Adrenal hyperplasia, congenital, due to 3-beta-hydroxysteroid dehydrogenase 2 deficiency, MIM# 201810 1363812;18252794 False 3 100;0;0 1.2304 True ENSG00000203859 ENSG00000203859 HGNC:5218 HSD3B7 gene HSD3B7 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bile acid synthesis defect, congenital, 1 MIM#607765;Disorders of bile acid biosynthesis 11067870;27604308 False 3 100;0;0 1.2304 True ENSG00000099377 ENSG00000099377 HGNC:18324 HSF2BP gene HSF2BP Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Premature ovarian failure, OMIM#619245 32845237;35174157 False 3 100;0;0 1.2304 True ENSG00000160207 ENSG00000160207 HGNC:5226 HSF4 gene HSF4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Cataract 5, multiple types, 116800 31815953;29243736;26490182 False 3 100;0;0 1.2304 True ENSG00000102878 ENSG00000102878 HGNC:5227 HSPA9 gene HSPA9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Anemia, sideroblastic, 4, MIM# 182170;Even-plus syndrome, MIM#616854;skeletal anomalies;congenital cardiac and renal anomalies: marked small nose 26598328;32869452;26491070 False 3 50;50;0 1.2304 True ENSG00000113013 ENSG00000113013 HGNC:5244 HSPB1 gene HSPB1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot Marie Tooth disease, axonal, type 2F, 606595;MONDO:0011687;Neuropathy, distal hereditary motor, type IIB, 608634;MONDO:0012080 21785432;15122254;18832141;32639100;32334137 False 3 100;0;0 1.2304 True ENSG00000106211 ENSG00000106211 HGNC:5246 HSPB8 gene HSPB8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myopathy, myofibrillar, 13, with rimmed vacuoles, MIM# 621078;Distal myopathy;Vacuolar myopathy;Neuropathy, distal hereditary motor type IIA, 158590;Charcot-Marie-Tooth disease, axonal, type 2L, MIM# 608673 32165108;31403083;28780615;15122253;26718575 False 3 100;0;0 1.2304 True ENSG00000152137 ENSG00000152137 HGNC:30171 HSPD1 gene HSPD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 4, MIM# 612233;Spastic paraplegia 13, autosomal dominant, MIM# 605280 18571143;27405012;32532876;28377887;27405012;11898127;17420924 False 3 100;0;0 1.2304 True ENSG00000144381 ENSG00000144381 HGNC:5261 HSPG2 gene HSPG2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Schwartz-Jampel syndrome, type 1, MIM# 255800;MONDO:0009717;Dyssegmental dysplasia, Silverman-Handmaker type, MIM# 224410;MONDO:0009140 11101850;16927315;11279527 False 3 100;0;0 1.2304 True ENSG00000142798 ENSG00000142798 HGNC:5273 HTR2C gene HTR2C Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Obesity disorder, MONDO:0011122, HTR2C-related 36536256 False 3 100;0;0 1.2304 True ENSG00000147246 ENSG00000147246 HGNC:5295 HTRA1 gene HTRA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal {Macular degeneration, age-related, 7}, 6101493;{Macular degeneration, age-related, neovascular type}, 610149;CARASIL syndrome, 600142;Cerebral arteriopathy, autosomal dominant, with subcortical infarcts and leukoencephalopathy, type 2, 616779 29895533;19387015 False 3 100;0;0 1.2304 True Other ENSG00000166033 ENSG00000166033 HGNC:9476 HTRA2 gene HTRA2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria, type VIII, MIM# 617248 27208207;27696117 False 3 100;0;0 1.2304 True ENSG00000115317 ENSG00000115317 HGNC:14348 HUWE1 gene HUWE1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Mental retardation, X-linked syndromic, Turner type;Say-Meyer syndrome;Juberg-Marsidi syndrome 30797980;29180823 False 3 100;0;0 1.2304 True ENSG00000086758 ENSG00000086758 HGNC:30892 HYAL2 gene HYAL2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Muggenthaler-Chowdhury-Chioza syndrome, MIM# 621063 28081210;23172227;26515055;34906488 False 3 50;50;0 1.2304 True ENSG00000068001 ENSG00000068001 HGNC:5321 HYDIN gene HYDIN Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 5 (MIM#608647) 23022101;23849777;28441829;31116566 False 3 100;0;0 1.2304 True ENSG00000157423 ENSG00000157423 HGNC:19368 HYLS1 gene HYLS1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hydrolethalus syndrome (MIM#236680) 15843405;18648327;19400947;19656802;32509774 False 3 0;100;0 1.2304 True Other ENSG00000198331 ENSG00000198331 HGNC:26558 HYOU1 gene HYOU1 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Immunodeficiency 59 and hypoglycemia, MIM# 233600" 27913302 False 3 100;0;0 1.2304 True ENSG00000149428 ENSG00000149428 HGNC:16931 IARS gene IARS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Growth retardation, impaired intellectual development, hypotonia, and hepatopathy, MIM#617093 27426735 False 3 100;0;0 1.2304 True ENSG00000196305 ENSG00000196305 HGNC:5330 IARS2 gene IARS2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cataracts, growth hormone deficiency, sensory neuropathy, sensorineural hearing loss, and skeletal dysplasia, MIM# 616007 28328135;30419932;25130867;30041933 False 3 100;0;0 1.2304 True ENSG00000067704 ENSG00000067704 HGNC:29685 IBA57 gene IBA57 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Multiple mitochondrial dysfunctions syndrome 3, MIM#615330;Spastic paraplegia 74, autosomal recessive MIM#616451 23462291;25971455;27785568;28671726;28913435;25609768;30258207 False 3 100;0;0 1.2304 True ENSG00000181873 ENSG00000181873 HGNC:27302 ICK gene ICK Expert Review;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Endocrine-cerebroosteodysplasia (MIM#612651) 19185282;27069622;27466187;24797473;24853502 False 3 100;0;0 1.2304 True ENSG00000112144 ENSG00000112144 HGNC:21219 ICOS gene ICOS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency, common variable, 1 MIM# 607594 12577056;15507387;19380800;28861081;31858365;11343122;16982935 False 3 100;0;0 1.2304 True ENSG00000163600 ENSG00000163600 HGNC:5351 IDH1 gene IDH1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome Other Ollier disease MONDO:0008145;Maffucci syndrome MONDO:0013808 34393643;34588213;34624834;34720940;32727816 False 3 100;0;0 1.2304 True ENSG00000138413 ENSG00000138413 HGNC:5382 IDH2 gene IDH2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted D-2-hydroxyglutaric aciduria 2, MIM# 613657 25778941;27142242;20847235;24049096 False 3 100;0;0 1.2304 True ENSG00000182054 ENSG00000182054 HGNC:5383 IDH3A gene IDH3A Expert Review Green;NHS GMS Mendeliome BIALLELIC, autosomal or pseudoautosomal Retinitis pigmentosa 90, MIM#619007 31012789;30478029;30058936;28412069 False 3 100;0;0 1.2304 True ENSG00000166411 ENSG00000166411 HGNC:5384 IDH3B gene IDH3B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Retinitis pigmentosa 46, MIM# 612572 18806796;31736247 False 3 100;0;0 1.2304 True ENSG00000101365 ENSG00000101365 HGNC:5385 IDS gene IDS Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Mucopolysaccharidosis II, MIM# 309900;MONDO:0010674;Hunter syndrome 9921913;9762601;8940265;1901826 False 3 100;0;0 1.2304 True ENSG00000010404 ENSG00000010404 HGNC:5389 IDUA gene IDUA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mucopolysaccharidosis Ih (MIM#607014);Mucopolysaccharidosis Ih/s (MIM#607015);Mucopolysaccharidosis Is (MIM#6070);Mucopolysaccharidosis type 1, MONDO:0001586 28752568;12865757 False 3 100;0;0 1.2304 True ENSG00000127415 ENSG00000127415 HGNC:5391 IER3IP1 gene IER3IP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephaly, epilepsy, and diabetes syndrome, MIM# 614231;Primary microcephaly-epilepsy-permanent neonatal diabetes syndrome, MONDO:0013647 21835305;22991235;24138066;28711742 False 3 100;0;0 1.2304 True ENSG00000134049 ENSG00000134049 HGNC:18550 IFIH1 gene IFIH1 Expert Review;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Aicardi-Goutieres syndrome 7, MIM#615846;Early-onset Inflammatory Bowel Disease 24686847;34185153 False 3 100;0;0 1.2304 True ENSG00000115267 ENSG00000115267 HGNC:18873 IFITM5 gene IFITM5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Osteogenesis imperfecta, type V MIM#610967 22863190;22863195;32383316;24519609 False 3 100;0;0 1.2304 True Other ENSG00000206013 ENSG00000206013 HGNC:16644 IFNAR1 gene IFNAR1 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 106, susceptibility to viral infections, MIM# 619935;Severe disease caused by Yellow Fever vaccine and Measles vaccine 31270247;35442418 False 3 100;0;0 1.2304 True ENSG00000142166 ENSG00000142166 HGNC:5432 IFNAR2 gene IFNAR2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 45, MIM# 616669 26424569;35442417 False 3 100;0;0 1.2304 True ENSG00000159110 ENSG00000159110 HGNC:5433 IFNGR1 gene IFNGR1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Immunodeficiency 27A, mycobacteriosis, AR, MIM# 209950;Immunodeficiency 27B, mycobacteriosis, AD, MIM# 615978 7815885;8960475;9389728;10811850;10192386;12244188;15589309 False 3 100;0;0 1.2304 True ENSG00000027697 ENSG00000027697 HGNC:5439 IFNGR2 gene IFNGR2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 28, mycobacteriosis, MIM# 614889 15924140;18625743;31222290 False 3 100;0;0 1.2304 True ENSG00000159128 ENSG00000159128 HGNC:5440 IFT122 gene IFT122 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cranioectodermal dysplasia 1, MIM# MIM#218330;MONDO:0021093 29037998;20493458;23826986;26792575;29220510;28370949;27681595;27681595 False 3 100;0;0 1.2304 True ENSG00000163913 ENSG00000163913 HGNC:13556 IFT140 gene IFT140 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Short-rib thoracic dysplasia 9 with or without polydactyly, MIM# 266920;MONDO:0009964;Retinitis pigmentosa 80, MIM# 617781;Cystic Kidney Disease, MONDO: 0002473 34890546;22503633;23418020;28288023;28724397;26216056;26968735 False 3 100;0;0 1.2304 True ENSG00000187535 ENSG00000187535 HGNC:29077 IFT172 gene IFT172 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Retinitis pigmentosa 71 616394;Short-rib thoracic dysplasia 10 with or without polydactyly - 615630;Bardet-Biedl syndrome 20, MIM# 619471 26763875 False 3 100;0;0 1.2304 True ENSG00000138002 ENSG00000138002 HGNC:30391 IFT27 gene IFT27 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 19, MIM#615996 24488770;30761183;26763875;25443296 False 3 100;0;0 1.2304 True ENSG00000100360 ENSG00000100360 HGNC:18626 IFT43 gene IFT43 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Short-rib thoracic dysplasia 18 with polydactyly, MIM# 617866;Retinitis pigmentosa 81 , MIM#617871;Cranioectodermal dysplasia 3, MIM# 614099 28400947;28973684;21378380;29896747 False 3 100;0;0 1.2304 True ENSG00000119650 ENSG00000119650 HGNC:29669 IFT52 gene IFT52 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Short-rib thoracic dysplasia 16 with or without polydactyly, MIM# 617102 26880018;27466190;30242358;31042281 False 3 100;0;0 1.2304 True ENSG00000101052 ENSG00000101052 HGNC:15901 IFT74 gene IFT74 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Bardet-Biedl syndrome 20, MIM# 617119;Joubert syndrome 40, MIM# 619582;Spermatogenic failure 58, MIM# 619585" 27486776;32144365;33531668 False 3 100;0;0 1.2304 True ENSG00000096872 ENSG00000096872 HGNC:21424 IFT80 gene IFT80 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Short-rib thoracic dysplasia 2 with or without polydactyly, MIM# 611263;MONDO:0012644 17468754;19648123;30767363 False 3 100;0;0 1.2304 True ENSG00000068885 ENSG00000068885 HGNC:29262 IFT81 gene IFT81 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Short-rib thoracic dysplasia 19 with or without polydactyly, MIM# 617895 27666822;26275418;30080953;28460050 False 3 0;100;0 1.2304 True ENSG00000122970 ENSG00000122970 HGNC:14313 IGF1 gene IGF1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Growth retardation with deafness and mental retardation due to IGF1 deficiency, MIM # 608747 8857020;15769976;14684690;31539878;28768959;34125705;22832530 False 3 100;0;0 1.2304 True ENSG00000017427 ENSG00000017427 HGNC:5464 IGF1R gene IGF1R Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Insulin-like growth factor I, resistance to, MIM# 270450 31586944 False 3 100;0;0 1.2304 True ENSG00000140443 ENSG00000140443 HGNC:5465 IGF2 gene IGF2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) Growth restriction, severe, with distinctive facies, MIM#616489 31544945;26154720 False 3 100;0;0 1.2304 True ENSG00000167244 ENSG00000167244 HGNC:5466 IGFALS gene IGFALS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Acid-labile subunit, deficiency of, MIM# 615961 14762184;21396577;34136918 False 3 100;0;0 1.2304 True ENSG00000099769 ENSG00000099769 HGNC:5468 IGHM gene IGHM Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Agammaglobulinemia 1, MIM# 601495" 12370281;8890099 False 3 100;0;0 1.2304 True ENSG00000211899 ENSG00000211899 HGNC:5541 IGHMBP2 gene IGHMBP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neuronopathy, distal hereditary motor, type VI, MIM# 604320;Charcot-Marie-Tooth disease, axonal, type 2S, MIM# 616155 25439726 False 3 100;0;0 1.2304 True ENSG00000132740 ENSG00000132740 HGNC:5542 IGLL1 gene IGLL1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Agammaglobulinaemia 2, MIM# 613500 9419212;25502423;27576013 False 3 100;0;0 1.2304 True ENSG00000128322 ENSG00000128322 HGNC:5870 IGSF1 gene IGSF1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Hypothyroidism, central, and testicular enlargement, MIM# 300888 27310681;30086211;24108313;26840047;27762734;23143598 False 3 100;0;0 1.2304 True ENSG00000147255 ENSG00000147255 HGNC:5948 IHH gene IHH Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Acrocapitofemoral dysplasia MIM#607778;Brachydactyly, type A1 MIM#112500 34530144;12632327;32311039;29155992 False 3 100;0;0 1.2304 True ENSG00000163501 ENSG00000163501 HGNC:5956 IKBKB gene IKBKB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Immunodeficiency 15A, MIM# 618204;Immunodeficiency 15B, MIM# 615592 24369075;25216719;30337470;10195897;32117824 False 3 100;0;0 1.2304 True ENSG00000104365 ENSG00000104365 HGNC:5960 IKBKG gene IKBKG Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Ectodermal dysplasia and immunodeficiency 1, MIM# 300291;Immunodeficiency 33 , MIM#300636;Incontinentia pigmenti, MIM# 308300;Autoinflammatory disease, systemic, X-linked, MIM# 301081 31874111;35289316 False 3 100;0;0 1.2304 True ENSG00000073009 ENSG00000269335 HGNC:5961 IKZF1 gene IKZF1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Immunodeficiency, common variable, 13 MIM# 616873;recurrent bacterial respiratory infections;Thrombocytopaenia;immunodeficiency;Hypogammaglobulinaemia;decrease B-cells;decrease B-cell differentiation;decrease memory B/T cells;Low Ig;pneumocystis early CID onset;Immune dysregulation 21548011;26981933;29889099;31057532;7923373;11805317;35333544 False 3 100;0;0 1.2304 True ENSG00000185811 ENSG00000185811 HGNC:13176 IKZF2 gene IKZF2 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Immunodeficiency, MONDO:0021094, IKZF2-related;Immune dysregulation;nonsyndromic genetic hearing loss MONDO:0019497, IKZF2-related 34920454;34826259;39406892 False 3 100;0;0 1.2304 True ENSG00000030419 ENSG00000030419 HGNC:13177 IKZF3 gene IKZF3 Expert Review;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Immunodeficiency 84, MIM# 619437 34155405 False 3 100;0;0 1.2304 True ENSG00000161405 ENSG00000161405 HGNC:13178 IKZF5 gene IKZF5 Expert Review;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Thrombocytopaenia 7, MIM#619130 31217188 False 3 100;0;0 1.2304 True ENSG00000095574 ENSG00000095574 HGNC:14283 IL10 gene IL10 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Diseases of Immune Dysregulation;Early-onset inflammatory bowel disease 22236434;20951137;19890111 False 3 100;0;0 1.2304 True ENSG00000136634 ENSG00000136634 HGNC:5962 IL10RA gene IL10RA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Inflammatory bowel disease 28, early onset, autosomal recessive, MIM# 613148 19890111;21519361;22476154 False 3 100;0;0 1.2304 True ENSG00000110324 ENSG00000110324 HGNC:5964 IL10RB gene IL10RB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Inflammatory bowel disease 25, early onset, autosomal recessive, MIM# 612567 19890111;21519361;35187668;31096038 False 3 100;0;0 1.2304 True ENSG00000243646 ENSG00000243646 HGNC:5965 IL11RA gene IL11RA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Craniosynostosis and dental anomalies, MIM# 614188 21741611;32277509;30811827;29926465;24498618 False 3 100;0;0 1.2304 True ENSG00000137070 ENSG00000137070 HGNC:5967 IL12B gene IL12B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 29, mycobacteriosis, MIM# 614890 9854038;11753820;34389021 False 3 100;0;0 1.2304 True ENSG00000113302 ENSG00000113302 HGNC:5970 IL12RB1 gene IL12RB1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 30, MIM# 614891 9603733;9603732;12591909;15736007;23864330 False 3 100;0;0 1.2304 True ENSG00000096996 ENSG00000096996 HGNC:5971 IL17RA gene IL17RA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 51, MIM# 613953;MONDO:0013500 21350122;27930337 False 3 100;0;0 1.2304 True ENSG00000177663 ENSG00000177663 HGNC:5985 IL17RC gene IL17RC Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Candidiasis, familial, 9, MIM# 616445;MONDO:0014642 25918342 False 3 100;0;0 1.2304 True ENSG00000163702 ENSG00000163702 HGNC:18358 IL1RAPL1 gene IL1RAPL1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Intellectual developmental disorder, X-linked 21 MIM#300143 34452636;27470653;21484992;18801879;18801879 False 3 100;0;0 1.2304 True ENSG00000169306 ENSG00000169306 HGNC:5996 IL1RN gene IL1RN Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Interleukin 1 receptor antagonist deficiency, MIM# 612852 19494218;32819369 False 3 100;0;0 1.2304 True ENSG00000136689 ENSG00000136689 HGNC:6000 IL21R gene IL21R Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 56, MIM# 615207 33929673 False 3 100;0;0 1.2304 True ENSG00000103522 ENSG00000103522 HGNC:6006 IL23R gene IL23R Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency disease, MONDO:0021094;Inherited susceptibility to mycobacterial disease, MONDO:0019146, IL23R-related 30578351;35829840;36763636 False 3 100;0;0 1.2304 True ENSG00000162594 ENSG00000162594 HGNC:19100 IL2RA gene IL2RA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 41 with lymphoproliferation and autoimmunity, MIM# 606367 9096364;17196245;23416241;24116927 False 3 100;0;0 1.2304 True ENSG00000134460 ENSG00000134460 HGNC:6008 IL2RB gene IL2RB Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 63 with lymphoproliferation and autoimmunity, MIM# 618495;Lymphoproliferation, lymphadenopathy, hepatosplenomegaly, autoimmune haemolytic anaemia, dermatitis, enteropathy, hypergammaglobulinaemia, recurrent viral (EBV, CMV) infections 31040184;31040185 False 3 100;0;0 1.2304 True ENSG00000100385 ENSG00000100385 HGNC:6009 IL2RG gene IL2RG Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Combined immunodeficiency, X-linked, moderate MIM# 312863;Severe combined immunodeficiency, X-linked MIM# 300400;recurrent viral/fungal/bacterial infections;Low T/NK cells;Low Ig levels;lymphocytopaenia;hypogammaglobulinaemia;failure to thrive;diarrhoea;Pneumonia;Thymic hypoplasia 20301584;8462096;8401490;7883965;9399950 False 3 100;0;0 1.2304 True ENSG00000147168 ENSG00000147168 HGNC:6010 IL36RN gene IL36RN Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Psoriasis 14, pustular, MIM# 614204;Autoinflammatory syndrome, MONDO:0019751, IL36RN-related 21848462;21839423;22903787;23648549 False 3 100;0;0 1.2304 True ENSG00000136695 ENSG00000136695 HGNC:15561 IL6ST gene IL6ST Expert list;Expert Review Green Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Hyper-IgE recurrent infection syndrome 4, autosomal recessive, MIM# 618523;Stuve-Wiedemann syndrome 2, MIM# 619751: skeletal dysplasia, neonatal lung dysfunction, thrombocytopenia, dermatitis, defective acute-phase response;Hyper-IgE recurrent infection syndrome 4A, autosomal dominant, MIM# 619752;Immunodeficiency 94 with autoinflammation and dysmorphic facies, MIM# 619750" 28747427;30309848;12370259;16041381;31914175;32207811;33517393 False 3 100;0;0 1.2304 True ENSG00000134352 ENSG00000134352 HGNC:6021 IL7 gene IL7 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined immunodeficiency, MONDO:0015131, IL7-related 39352394 False 3 100;0;0 1.2304 True ENSG00000104432 ENSG00000104432 HGNC:6023 IL7R gene IL7R Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal severe combined immunodeficiency 104 MIM#608971 9843216;19890784;26123418;11023514;7964471 False 3 100;0;0 1.2304 True ENSG00000168685 ENSG00000168685 HGNC:6024 ILDR1 gene ILDR1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 42, MIM# 609646 21255762;23226338;22903915;27344577;21255762;23239027;25822906;25819842;24990150 False 3 100;0;0 1.2304 True ENSG00000145103 ENSG00000145103 HGNC:28741 IMPAD1 gene IMPAD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Chondrodysplasia with joint dislocations, GPAPP type MIM#614078 22887726;21549340 False 3 100;0;0 1.2304 True ENSG00000104331 ENSG00000104331 HGNC:26019 IMPDH1 gene IMPDH1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Leber congenital amaurosis 11 (MIM# 613837);Retinitis pigmentosa 10 (MIM# 180105) 16384941 False 3 100;0;0 1.2304 True ENSG00000106348 ENSG00000106348 HGNC:6052 IMPDH2 gene IMPDH2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with dystonia PMID: 33098801 False 3 100;0;0 1.2304 True ENSG00000178035 ENSG00000178035 HGNC:6053 IMPG1 gene IMPG1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Macular dystrophy, vitelliform, 4, OMIM:616151;Retinitis pigmentosa, MONDO:0019200;Retinitis pigmentosa 91, MIM# 153870" 23993198;28644393;30589393;30688845;32817297 False 3 100;0;0 1.2304 True ENSG00000112706 ENSG00000112706 HGNC:6055 IMPG2 gene IMPG2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Retinitis pigmentosa 56, MIM#613581;Macular dystrophy, vitelliform, 5, MIM# 616152" 32242237 False 3 0;0;0 1.2304 True ENSG00000081148 ENSG00000081148 HGNC:18362 INF2 gene INF2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, dominant intermediate E, MIM# 614455;Glomerulosclerosis, focal segmental, 5, MIM# 613237 22187985;30680856;25943269;20023659 False 3 100;0;0 1.2304 True ENSG00000203485 ENSG00000203485 HGNC:23791 INPP4A gene INPP4A Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Intellectual disability 31978615;31938306;25338135;20011524 False 3 50;50;0 1.2304 True ENSG00000040933 ENSG00000040933 HGNC:6074 INPP5E gene INPP5E Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 1, MIM# 213300;MONDO:0008944;Mental retardation, truncal obesity, retinal dystrophy, and micropenis, MIM# 610156;MONDO:0012423 34211432;19668216;32139166;29230161;29052317;27998989;27401686;19668215 False 3 100;0;0 1.2304 True ENSG00000148384 ENSG00000148384 HGNC:21474 INPP5K gene INPP5K Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, congenital, with cataracts and intellectual disability MIM#617404 28190456;28190459;28940338;31630891;33193651;33792664 False 3 100;0;0 1.2304 True ENSG00000132376 ENSG00000132376 HGNC:33882 INPPL1 gene INPPL1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Opsismodysplasia MIM#258480 23273567;34529350;34094554 False 3 100;0;0 1.2304 True ENSG00000165458 ENSG00000165458 HGNC:6080 INS gene INS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Diabetes mellitus, insulin-dependent, 2, MIM# 125852;Diabetes mellitus, permanent neonatal 4, MIM# 618858;Maturity-onset diabetes of the young, type 10, MIM# 613370 18162506 False 3 100;0;0 1.2304 True ENSG00000254647 ENSG00000254647 HGNC:6081 INSR gene INSR Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hyperinsulinemic hypoglycemia, familial, 5, MIM# 609968;Leprechaunism, MIM# 246200;Rabson-Mendenhall syndrome, MIM# 262190 34965699 False 3 100;0;0 1.2304 True ENSG00000171105 ENSG00000171105 HGNC:6091 INTS1 gene INTS1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with cataracts, poor growth, and dysmorphic facies, MIM# 618571 28542170;30622326;31428919 False 3 100;0;0 1.2304 True ENSG00000164880 ENSG00000164880 HGNC:24555 INTS11 gene INTS11 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "Neurodevelopmental disorder with motor and language delay, ocular defects, and brain abnormalities, MIM# 620428" 37054711 False 3 100;0;0 1.2304 True ENSG00000127054 ENSG00000127054 HGNC:26052 INTS13 gene INTS13 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Oral-facial-digital syndrome, MONDO:0015375, INTS13-related PMID: 36229431 False 3 100;0;0 1.2304 True ENSG00000064102 ENSG00000064102 HGNC:20174 INTU gene INTU Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal ?Orofaciodigital syndrome XVII MIM#617926;?Short-rib thoracic dysplasia 20 with polydactyly 27158779;29451301;20067783 False 3 100;0;0 1.2304 True ENSG00000164066 ENSG00000164066 HGNC:29239 INVS gene INVS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Nephronophthisis 2, infantile, (MIM#602088) 12872123;19177160 False 3 100;0;0 1.2304 True ENSG00000119509 ENSG00000119509 HGNC:17870 IPO8 gene IPO8 Expert Review;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Vascular aneurysm, immune dysregulation, skeletal anomalies, and skin and joint laxity, MIM# 619472;Loeys-Dietz syndrome-like;cardiovascular, neurologic, skeletal and immunologic abnormalities 34010604 False 3 100;0;0 1.2304 True ENSG00000133704 ENSG00000133704 HGNC:9853 IQCB1 gene IQCB1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Senior-Loken syndrome 5, MIM# 609254;MONDO:0012225 15723066;21220633;20881296;21901789;33512896;33535056;29219953 False 3 100;0;0 1.2304 True ENSG00000173226 ENSG00000173226 HGNC:28949 IQCE gene IQCE Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Postaxial polydactyly 31549751;28488682 False 3 100;0;0 1.2304 True ENSG00000106012 ENSG00000106012 HGNC:29171 IQSEC1 gene IQSEC1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "Intellectual developmental disorder with short stature and behavioral abnormalities, MIM# 618687" 31607425 False 3 100;0;0 1.2304 True ENSG00000144711 ENSG00000144711 HGNC:29112 IQSEC2 gene IQSEC2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) "Intellectual developmental disorder, X-linked 1 MIM#309530, MONDO:0010656;Severe intellectual disability-progressive postnatal microcephaly- midline stereotypic hand movements syndrome MONDO:0018347" 31415821;20473311;30842726;33368194;23674175 False 3 100;0;0 1.2304 True Other ENSG00000124313 ENSG00000124313 HGNC:29059 IRAK4 gene IRAK4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 67, MIM# 607676 26825884;17878374;17544092;16950813 False 3 100;0;0 1.2304 True ENSG00000198001 ENSG00000198001 HGNC:17967 IREB2 gene IREB2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodegeneration, early-onset, with choreoathetoid movements and microcytic anemia, MIM#618451 30915432;31243445;11175792;35602653 False 3 100;0;0 1.2304 True ENSG00000136381 ENSG00000136381 HGNC:6115 IRF1 gene IRF1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 117, mycobacteriosis, autosomal recessive, MIM# 620668 36736301 False 3 100;0;0 1.2304 True ENSG00000125347 ENSG00000125347 HGNC:6116 IRF2BP2 gene IRF2BP2 Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Immunodeficiency, common variable, 14, MIM# 617765" 27016798;32048120;36193988;33864888 False 3 50;50;0 1.2304 True ENSG00000168264 ENSG00000168264 HGNC:21729 IRF2BPL gene IRF2BPL Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with regression, abnormal movements, loss of speech, and seizures, MIM#618088 30057031 False 3 100;0;0 1.2304 True ENSG00000119669 ENSG00000119669 HGNC:14282 IRF4 gene IRF4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Combined immunodeficiency, MONDO:0015131, IRF4-related 29537367;29408330;36662884 False 3 67;33;0 1.2304 True ENSG00000137265 ENSG00000137265 HGNC:6119 IRF6 gene IRF6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Popliteal pterygium syndrome 1MIM#119500;van der Woude syndrome MIM#119300 20301581 False 3 100;0;0 1.2304 True ENSG00000117595 ENSG00000117595 HGNC:6121 IRF7 gene IRF7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 39, MIM# 616345 25814066;15800576;35986347;35670811 False 3 100;0;0 1.2304 True ENSG00000185507 ENSG00000185507 HGNC:6122 IRF8 gene IRF8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Immunodeficiency 32A, mycobacteriosis, autosomal dominant, MIM# 614893;Immunodeficiency 32B, monocyte and dendritic cell deficiency, autosomal recessive, MIM# 226990 21524210;27893462;29128673;28162909;25122610 False 3 100;0;0 1.2304 True ENSG00000140968 ENSG00000140968 HGNC:5358 IRS4 gene IRS4 Expert Review;Expert Review Green Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Hypothyroidism, congenital, nongoitrous, 9, MIM# 301035 30061370 False 3 100;0;0 1.2304 True ENSG00000133124 ENSG00000133124 HGNC:6128 IRX5 gene IRX5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hamamy syndrome, MIM# 611174;cone dystrophy, MONDO:0000455 27453922;33891002;28041643;32045705;22581230;17230486;34899143 False 3 100;0;0 1.2304 True ENSG00000176842 ENSG00000176842 HGNC:14361 ISCA1 gene ISCA1 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Multiple mitochondrial dysfunctions syndrome 5, MIM# 617613" 28356563;32092383;31016283;30113620;30105122 False 3 100;0;0 1.2304 True ENSG00000135070 ENSG00000135070 HGNC:28660 ISCA2 gene ISCA2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Multiple mitochondrial dysfunctions syndrome 4, MIM# 616370 25539947;29297947;29122497;29359243 False 3 100;0;0 1.2304 True ENSG00000165898 ENSG00000165898 HGNC:19857 ISCU gene ISCU Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Myopathy with lactic acidosis, hereditary, MIM# 255125 29079705;18304497;18296749;19567699 False 3 100;0;0 1.2304 True ENSG00000136003 ENSG00000136003 HGNC:29882 ISG15 gene ISG15 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 38, MIM# 616126 25307056;22859821;35258551;32944031 False 3 100;0;0 1.2304 True ENSG00000187608 ENSG00000187608 HGNC:4053 ISPD gene ISPD Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643;Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052 22522421;23217329;23390185;30060766;28688748;26404900;30060766 False 3 100;0;0 1.2304 True ENSG00000214960 ENSG00000214960 HGNC:37276 ITCH gene ITCH Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Autoimmune disease, multisystem, with facial dysmorphism, MIM#613385 20170897;31091003;32356405 False 3 100;0;0 1.2304 True ENSG00000078747 ENSG00000078747 HGNC:13890 ITFG2 gene ITFG2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental abnormality;Intellectual disability;Developmental regression;Ataxia 28397838;33083013 False 3 50;50;0 1.2304 True ENSG00000111203 ENSG00000111203 HGNC:30879 ITGA2B gene ITGA2B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Bleeding disorder, platelet-type, 16, MIM# 187800;MONDO:000855;Glanzmann thrombasthaenia 1, MIM# 273800 1638023;21454453;8282784;16463284 False 3 100;0;0 1.2304 True ENSG00000005961 ENSG00000005961 HGNC:6138 ITGA3 gene ITGA3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Interstitial lung disease, nephrotic syndrome, and epidermolysis bullosa, congenital, MIM# 614748 22512483;25810266;27717396;32198874;26854491 False 3 100;0;0 1.2304 True ENSG00000005884 ENSG00000005884 HGNC:6139 ITGA6 gene ITGA6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Epidermolysis bullosa, junctional, with pyloric stenosis, MIM# 226730 31502654;27607025;9158140 False 3 100;0;0 1.2304 True ENSG00000091409 ENSG00000091409 HGNC:6142 ITGA7 gene ITGA7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, congenital, due to ITGA7 deficiency, MIM# 613204 34552617;9590299 False 3 100;0;0 1.2304 True ENSG00000135424 ENSG00000135424 HGNC:6143 ITGA8 gene ITGA8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Renal hypodysplasia/aplasia 1, MIM# 191830 24439109 False 3 100;0;0 1.2304 True ENSG00000077943 ENSG00000077943 HGNC:6144 ITGB2 gene ITGB2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Leukocyte adhesion deficiency, MIM# 116920 1968911;1694220;33957747;32279896;31374327 False 3 100;0;0 1.2304 True ENSG00000160255 ENSG00000160255 HGNC:6155 ITGB3 gene ITGB3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Bleeding disorder, platelet-type, 24, MIM#619271;MONDO:0008552 18065693;19336737;20081061;23253071 False 3 100;0;0 1.2304 True ENSG00000259207 ENSG00000259207 HGNC:6156 ITGB4 gene ITGB4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Epidermolysis bullosa of hands and feet, MIM# 131800;Epidermolysis bullosa, junctional, non-Herlitz type, MIM# 226650;Epidermolysis bullosa, junctional, with pyloric atresia, MIM# 226730 11328943;9670011;33225458;30079450;29380424;29198538;28557647 False 3 100;0;0 1.2304 True ENSG00000132470 ENSG00000132470 HGNC:6158 ITGB6 gene ITGB6 Expert Review;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Amelogenesis imperfecta, type IH, MIM# 616221 25431241;26695873;24305999;24319098 False 3 100;0;0 1.2304 True ENSG00000115221 ENSG00000115221 HGNC:6161 ITK gene ITK Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Lymphoproliferative syndrome 1 MIM# 613011;Lymphadenopathy;Recurrent infections;Hypogammaglobulinaemia;Evidence of EBV infection;EBV associated B cell Lymphoproliferation;High EBV viral load;Normal-low serum Ig;Depleted CD4+ T cells;Anaemia;Thrombocytopaenia;Hepatosplenomegaly 19425169;22289921;25061172;26056787;9311799;10213685 False 3 100;0;0 1.2304 True ENSG00000113263 ENSG00000113263 HGNC:6171 ITPA gene ITPA Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Inosine triphosphatase deficiency MIM#613850;Developmental and epileptic encephalopathy 35 MIM#616647 26224535;19498443;35234647;35098521;27604308;12384777 False 3 100;0;0 1.2304 True ENSG00000125877 ENSG00000125877 HGNC:6176 ITPR1 gene ITPR1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Gillespie syndrome, MIM# 206700;Spinocerebellar ataxia 15 MIM#606658;Spinocerebellar ataxia 29, congenital nonprogressive MIM#117360 27108797;31340402;30242502;29169895 False 3 100;0;0 1.2304 True ENSG00000150995 ENSG00000150995 HGNC:6180 ITPR3 gene ITPR3 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, demyelinating, type 1J, MIM# 620111;Combined immunodeficiency, MONDO:0015131, ITPR3-related 32949214;24627108;36302985 False 3 100;0;0 1.2304 True ENSG00000096433 ENSG00000096433 HGNC:6182 ITSN1 gene ITSN1 Expert list;Expert Review Green Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Nephrotic syndrome;Neurodevelopmental disorder MONDO:0700092, ITSN1-related 29773874 False 3 100;0;0 1.2304 True ENSG00000205726 ENSG00000205726 HGNC:6183 ITSN2 gene ITSN2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Nephrotic syndrome PMID: 29773874 False 3 100;0;0 1.2304 True ENSG00000198399 ENSG00000198399 HGNC:6184 IVD gene IVD Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Isovaleric acidaemia, MIM# 243500 15486829 False 3 100;0;0 1.2304 True ENSG00000128928 ENSG00000128928 HGNC:6186 IVNS1ABP gene IVNS1ABP Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Immunodeficiency 70, MIM#618969 32499645 False 3 100;0;0 1.2304 True ENSG00000116679 ENSG00000116679 HGNC:16951 IYD gene IYD Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Thyroid dyshormonogenesis 4, MIM# 274800 18434651;18434651 False 3 100;0;0 1.2304 True ENSG00000009765 ENSG00000009765 HGNC:21071 JAG1 gene JAG1 Expert Review Green;Literature;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alagille syndrome 1, MIM# 118450;Charcot-Marie-Tooth disease, axonal, type 2HH, MIM# 619574 32065591;25707699 False 3 50;50;0 1.2304 True ENSG00000101384 ENSG00000101384 HGNC:6188 JAG2 gene JAG2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 27, MIM# 619566;muscular dystrophy PMID: 33861953 False 3 100;0;0 1.2304 True ENSG00000184916 ENSG00000184916 HGNC:6189 JAGN1 gene JAGN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neutropaenia, severe congenital, 6, autosomal recessive, MIM# 616022 25129144 False 3 100;0;0 1.2304 True ENSG00000171135 ENSG00000171135 HGNC:26926 JAK1 gene JAK1 Expert list;Expert Review Green Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Autoinflammation, immunde dysregulation, and eosinophilia, MIM# 618999;Eosinophilia;Eosinophilic enteritis;Thyroid disease;Poor growth;Viral infections;Susceptibility to mycobacteria and viruses 28111307;28008925;30671064;38563820 False 3 100;0;0 1.2304 True ENSG00000162434 ENSG00000162434 HGNC:6190 JAK3 gene JAK3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal SCID, autosomal recessive, T-negative/B-positive type MIM# 600802 14615376;11668610 False 3 100;0;0 1.2304 True ENSG00000105639 ENSG00000105639 HGNC:6193 JAM2 gene JAM2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Primary brain calcification 31851307 False 3 100;0;0 1.2304 True ENSG00000154721 ENSG00000154721 HGNC:14686 JAM3 gene JAM3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hemorrhagic destruction of the brain, subependymal calcification, and cataracts, MIM# 613730 23255084;21109224 False 3 100;0;0 1.2304 True ENSG00000166086 ENSG00000166086 HGNC:15532 JARID2 gene JARID2 Expert Review;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental delay with variable intellectual disability and dysmorphic facies (DIDDF), MIM#620098 23294540;33077894 False 3 100;0;0 1.2304 True ENSG00000008083 ENSG00000008083 HGNC:6196 JMJD1C gene JMJD1C Expert Review;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability (MONDO#0001071), JMJD1C-related 26181491;32996679 False 3 100;0;0 1.2304 True ENSG00000171988 ENSG00000171988 HGNC:12313 JPH1 gene JPH1 Expert Review Green;Other Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital myopathy 25, MIM# 620964 39209426 False 3 100;0;0 1.2304 True ENSG00000104369 ENSG00000104369 HGNC:14201 JUP gene JUP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Arrhythmogenic right ventricular dysplasia 12, MIM# 611528;Naxos disease, MIM# 601214 2945574;21668431;2945574;9610536;18937352;10902626;15851108;27170944;11691526;16893920;29802319;31275992;25820315;25820315;25765472;25705887;25087486;21668431;20130592;17924338;20031617;10902626;20130592;21320868;32212272 False 3 100;0;0 1.2304 True ENSG00000173801 ENSG00000173801 HGNC:6207 KANK2 gene KANK2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Palmoplantar keratoderma and woolly hair (MIM#616099);Nephrotic syndrome, type 16, MIM#617783 25961457;24671081 False 3 100;0;0 1.2304 True ENSG00000197256 ENSG00000197256 HGNC:29300 KANSL1 gene KANSL1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Koolen-De Vries syndrome (MIM#610443) 22544363 False 3 100;0;0 1.2304 True ENSG00000120071 ENSG00000120071 HGNC:24565 KARS gene KARS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with or without deafness (LEPID), MIM#619147;Deafness, autosomal recessive 89, MIM# 613916;Congenital deafness and adult-onset progressive leukoencephalopathy (DEAPLE), MIM#619196 26741492;31618474;28887846;25330800;29615062;30252186;28496994;23768514;14975237 False 3 100;0;0 1.2304 True ENSG00000065427 ENSG00000065427 HGNC:6215 KAT5 gene KAT5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with dysmorphic facies, sleep disturbance, and brain abnormalities (NEDFASB), MIM#619103;Severe global developmental delay;Intellectual disability;Seizures;Microcephaly;Behavioral abnormality;Sleep disturbance;Morphological abnormality of the central nervous system;Short stature;Oral cleft;Abnormality of the face 32822602 False 3 100;0;0 1.2304 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000172977 ENSG00000172977 HGNC:5275 KAT6A gene KAT6A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Arboleda-Tham syndrome MIM#616268 30245513 False 3 100;0;0 1.2304 True ENSG00000083168 ENSG00000083168 HGNC:13013 KAT6B gene KAT6B Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted SBBYSS syndrome MIM#603736;Genitopatellar syndrome MIM#606170;KAT6B-related multiple congenital anomalies syndrome MONDO:0036042 22715153;32424177 False 3 100;0;0 1.2304 True Other ENSG00000156650 ENSG00000156650 HGNC:17582 KAT8 gene KAT8 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability;seizures;autism;dysmorphic features;Li-Ghorbani-Weisz syndrome, MIM#618974 31794431 False 3 100;0;0 1.2304 True ENSG00000103510 ENSG00000103510 HGNC:17933 KATNB1 gene KATNB1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal "Lissencephaly 6, with microcephaly, MIM# 616212" 25521378;25521379;26640080 False 3 100;0;0 1.2304 True ENSG00000140854 ENSG00000140854 HGNC:6217 KBTBD13 gene KBTBD13 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Nemaline myopathy 6, autosomal dominant, MIM# 609273;Hereditary motor neuropathy;late-onset limb girdle muscular dystrophy 28403181;31167812;31671076;30208948;11731279;21104864 False 3 67;33;0 1.2304 True ENSG00000234438 ENSG00000234438 HGNC:37227 KBTBD2 gene KBTBD2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal neurodevelopmental disorder MONDO:0700092, KBTBD2-related 39313616 False 3 100;0;0 1.2304 True ENSG00000170852 ENSG00000170852 HGNC:21751 KCNA1 gene KCNA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic ataxia/myokymia syndrome, MIM# 160120;Epilepsy, MONDO:0005027, KCNA1-related 11026449;32316562 False 3 100;0;0 1.2304 True ENSG00000111262 ENSG00000111262 HGNC:6218 KCNA2 gene KCNA2 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Early infantile encephalopathy 32, MIM#616366 29050392 False 3 100;0;0 1.2304 True ENSG00000177301 ENSG00000177301 HGNC:6220 KCNA3 gene KCNA3 Expert Review Green;Other Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, KCNA3-related 37964487 False 3 100;0;0 1.2304 True ENSG00000177272 ENSG00000177272 HGNC:6221 KCNB1 gene KCNB1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 26, MIM# 616056 31600826;31513310 False 3 100;0;0 1.2304 True ENSG00000158445 ENSG00000158445 HGNC:6231 KCNB2 gene KCNB2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted neurodevelopmental disorder MONDO:0700092, KCNB2-related 38503299 False 3 100;0;0 1.2304 True ENSG00000182674 ENSG00000182674 HGNC:6232 KCNC1 gene KCNC1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epilepsy, progressive myoclonic 7 (MIM#616187);Intellectual disability;Movement disorders 25401298;28145425;31353862 False 3 100;0;0 1.2304 True ENSG00000129159 ENSG00000129159 HGNC:6233 KCNC2 gene KCNC2 Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 103, MIM# 619913 32392612;31972370;35314505 False 3 50;50;0 1.2304 True ENSG00000166006 ENSG00000166006 HGNC:6234 KCNC3 gene KCNC3 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 13, MIM# 605259 16501573;25497598;25981959;25981959 False 3 100;0;0 1.2304 True ENSG00000131398 ENSG00000131398 HGNC:6235 KCND1 gene KCND1 Expert Review Green;Literature Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females neurodevelopmental disorder MONDO:0700092, KCND1-related 38772379 False 3 100;0;0 1.2304 True ENSG00000102057 ENSG00000102057 HGNC:6237 KCND2 gene KCND2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder MONDO:0700092;global developmental delay, HP:0001263;seizure, HP:0001250 24501278;16934482;29581270;34245260 False 3 100;0;0 1.2304 True Other ENSG00000184408 ENSG00000184408 HGNC:6238 KCND3 gene KCND3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 19, MIM# 607346 23280837;23280838;34361012;34067185;33575485;32823520 False 3 100;0;0 1.2304 True ENSG00000171385 ENSG00000171385 HGNC:6239 KCNH1 gene KCNH1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Temple-Baraitser syndrome, OMIM:611816;Zimmermann-Laband syndrome 1, OMIM:135500;Intellectual disability;Encephalopathy without features of TBS/ZLS 33811134 False 3 100;0;0 1.2304 True ENSG00000143473 ENSG00000143473 HGNC:6250 KCNH5 gene KCNH5 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Developmental and epileptic encephalopathy 112, MIM# 620537" https://www.medrxiv.org/content/10.1101/2022.04.26.22274147v1 False 3 100;0;0 1.2304 True Other ENSG00000140015 ENSG00000140015 HGNC:6254 KCNJ1 gene KCNJ1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bartter syndrome, type 2, 241200 28630040;8841184;19096086;7635463;12086641;9580661;12122007 False 3 100;0;0 1.2304 True ENSG00000151704 ENSG00000151704 HGNC:6255 KCNJ10 gene KCNJ10 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal SESAME syndrome, MIM# 612780;Paroxysmal dyskinesia, MONDO:0015427, KCNJ10-related 19289823;19420365;21849804;11466414;38979912 False 3 100;0;0 1.2304 True ENSG00000177807 ENSG00000177807 HGNC:6256 KCNJ11 gene KCNJ11 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal {Diabetes mellitus, type 2, susceptibility to} 125853;Diabetes mellitus, transient neonatal, 3 610582;Diabetes, permanent neonatal, with or without neurologic features 606176;Hyperinsulinemic hypoglycemia, familial, 2 601820;Maturity-onset diabetes of the young, type 13 616329 AD 18250167;11395395;23275527;23345197 False 3 100;0;0 1.2304 True Other ENSG00000187486 ENSG00000187486 HGNC:6257 KCNJ13 gene KCNJ13 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Leber congenital amaurosis 16 MIM#614186;Snowflake vitreoretinal degeneration, MIM# 193230 27203561;25475713;21763485;18179896;23255580;31647904 False 3 100;0;0 1.2304 True ENSG00000115474 ENSG00000115474 HGNC:6259 KCNJ16 gene KCNJ16 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Inherited renal tubular disease, MONDO:0015962, KCNJ16-related;Renal tubulopathy;deafness 33811157;33840812 False 3 100;0;0 1.2304 True ENSG00000153822 ENSG00000153822 HGNC:6262 KCNJ2 gene KCNJ2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Andersen syndrome MIM#170390;Atrial fibrillation, familial, 9 MIM#613980;Short QT syndrome 3 MIM#609622 24383070 False 3 100;0;0 1.2304 True ENSG00000123700 ENSG00000123700 HGNC:6263 KCNJ5 gene KCNJ5 Expert Review;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hyperaldosteronism, familial, type III, MIM# 613677 21311022;22203740;24420545;24574546 False 3 100;0;0 1.2304 True ENSG00000120457 ENSG00000120457 HGNC:6266 KCNJ6 gene KCNJ6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Keppen-Lubinsky syndrome, MIM# 614098;MONDO:0013572 25620207;29852244 False 3 100;0;0 1.2304 True ENSG00000157542 ENSG00000157542 HGNC:6267 KCNJ8 gene KCNJ8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cant Syndrome 29959160;24176758;24700710;32215968 False 3 50;0;50 1.2304 True Other ENSG00000121361 ENSG00000121361 HGNC:6269 KCNK18 gene KCNK18 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Migraine, with or without aura, susceptibility to, 13}, MIM# 613656 20871611;32394190;30573346;23904616;22355750 False 3 100;0;0 1.2304 True ENSG00000186795 ENSG00000186795 HGNC:19439 KCNK3 gene KCNK3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Pulmonary hypertension, primary, 4 MIM#615344;Neurodevelopmental disorder, MONDO:0700092, KCNK3-related 33057194 False 3 100;0;0 1.2304 True ENSG00000171303 ENSG00000171303 HGNC:6278 KCNK4 gene KCNK4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Facial dysmorphism, hypertrichosis, epilepsy, intellectual/developmental delay, and gingival overgrowth syndrome 618381 30290154 False 3 100;0;0 1.2304 True Other ENSG00000182450 ENSG00000182450 HGNC:6279 KCNK9 gene KCNK9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed) Birk-Barel syndrome, MIM# 612292;MONDO:0012856 28333430;27151206;24980697;18678320 False 3 100;0;0 1.2304 True ENSG00000169427 ENSG00000169427 HGNC:6283 KCNMA1 gene KCNMA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Paroxysmal nonkinesigenic dyskinesia, 3, with or without generalized epilepsy, MIM# 609446;Cerebellar atrophy, developmental delay, and seizures, MIM# 617643;Liang-Wang syndrome, MIM# 618729 15937479;26195193;27567911;29545233;31427379;31152168 False 3 100;0;0 1.2304 True ENSG00000156113 ENSG00000156113 HGNC:6284 KCNN2 gene KCNN2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder with or without variable movement or behavioural abnormalities, MIM#619725 33242881 False 3 100;0;0 1.2304 True ENSG00000080709 ENSG00000080709 HGNC:6291 KCNN3 gene KCNN3 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Zimmermann-Laband syndrome 3;MIM#618658 PMID: 31155282 False 3 100;0;0 1.2304 True ENSG00000143603 ENSG00000143603 HGNC:6292 KCNN4 gene KCNN4 Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Dehydrated hereditary stomatocytosis 2, MIM# 616689" 26148990;26198474;26178367;33519508;31091145;28619848 False 3 100;0;0 1.2304 True ENSG00000104783 ENSG00000104783 HGNC:6293 KCNQ2 gene KCNQ2 Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 7, 613720;Seizures, benign neonatal, 1, 121200;Myokymia, 121200 22169383;20962009;10575255;25959266;32917465;24318194 False 3 67;33;0 1.2304 True Other ENSG00000075043 ENSG00000075043 HGNC:6296 KCNQ3 gene KCNQ3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Seizures, benign neonatal, 2, MIM# 121201 33337327 False 3 100;0;0 1.2304 True ENSG00000184156 ENSG00000184156 HGNC:6297 KCNQ4 gene KCNQ4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Deafness, autosomal dominant 2A, MIM# 600101 10369879 False 3 100;0;0 1.2304 True ENSG00000117013 ENSG00000117013 HGNC:6298 KCNQ5 gene KCNQ5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 46, MIM# 617601 28669405;30359776 False 3 100;0;0 1.2304 True ENSG00000185760 ENSG00000185760 HGNC:6299 KCNT1 gene KCNT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epilepsy, nocturnal frontal lobe, 5, MIM# 615005;Epileptic encephalopathy, early infantile, 14, MIM# 614959 23086397;23086396;31872048;31532509 False 3 100;0;0 1.2304 True ENSG00000107147 ENSG00000107147 HGNC:18865 KCNT2 gene KCNT2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 57, MIM#617771;Developmental and epileptic encephalopathy;Epilepsy of infancy with migrating focal seizures (EIMFS) 29069600;29740868;32038177 False 3 100;0;0 1.2304 True ENSG00000162687 ENSG00000162687 HGNC:18866 KCNV2 gene KCNV2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Retinal cone dystrophy 3B, MIM# 610356 16909397;18235024;21882291 False 3 100;0;0 1.2304 True ENSG00000168263 ENSG00000168263 HGNC:19698 KCTD1 gene KCTD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Scalp-ear-nipple syndrome MIM#181270 23541344;31324836 False 3 100;0;0 1.2304 True ENSG00000134504 ENSG00000134504 HGNC:18249 KCTD17 gene KCTD17 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia 26, myoclonic MIM#616398 25983243;30642807;30579817 False 3 100;0;0 1.2304 True ENSG00000100379 ENSG00000100379 HGNC:25705 KCTD3 gene KCTD3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Epilepsy;Intellectual disability;Posterior fossa abnormalities 29406573 False 3 100;0;0 1.2304 True ENSG00000136636 ENSG00000136636 HGNC:21305 KCTD7 gene KCTD7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 3, with or without intracellular inclusions (MIM#611726) 22693283;22748208 False 3 100;0;0 1.2304 True ENSG00000243335 ENSG00000243335 HGNC:21957 KDELR2 gene KDELR2 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Osteogenesis imperfecta 21, MIM# 619131;Increased susceptibility to fractures;joint hypermobility;Scoliosis;Bowing of the legs;Bowing of the arms" 33053334 False 3 100;0;0 1.2304 True ENSG00000136240 ENSG00000136240 HGNC:6305 KDM1A gene KDM1A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cleft palate, psychomotor retardation, and distinctive facial features 616728;Multiple myeloma 29559475;27094131 False 3 100;0;0 1.2304 True ENSG00000004487 ENSG00000004487 HGNC:29079 KDM2A gene KDM2A Expert Review Green;Other Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, KDM2A-related False 3 100;0;0 1.2304 True ENSG00000173120 ENSG00000173120 HGNC:13606 KDM2B gene KDM2B Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted neurodevelopmental disorder MONDO#0700092, KDM2B-related 36322151 False 3 100;0;0 1.2304 True ENSG00000089094 ENSG00000089094 HGNC:13610 KDM3B gene KDM3B Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Diets-Jongmans syndrome, MIM# 618846;Intellectual disability;dysmorphic features;short stature 30929739 False 3 100;0;0 1.2304 True ENSG00000120733 ENSG00000120733 HGNC:1337 KDM4B gene KDM4B Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder, autosomal dominant 65, MIM# 619320;Global developmental delay, intellectual disability and neuroanatomical defects PMID: 33232677 False 3 100;0;0 1.2304 True ENSG00000127663 ENSG00000127663 HGNC:29136 KDM5A gene KDM5A Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal El Hayek-Chahrour neurodevelopmental syndrome, MIM# 620820;Neurodevelopmental disorder MONDO:0700092, KDM5A-related 21937992;33350388 False 3 100;0;0 1.2304 True ENSG00000073614 ENSG00000073614 HGNC:9886 KDM5B gene KDM5B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Mental retardation, autosomal recessive 65 MIM#618109;Neurodevelopmental disorder (MONDO#0700092), KDM5B-related, autosomal dominant 29276005;30217758;30409806 False 3 100;0;0 1.2304 True ENSG00000117139 ENSG00000117139 HGNC:18039 KDM5C gene KDM5C Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Intellectual developmental disorder, X-linked syndromic, Claes-Jensen type MIM# 300534;MONDO:0010355 15586325;32279304 False 3 100;0;0 1.2304 True ENSG00000126012 ENSG00000126012 HGNC:11114 KDM6A gene KDM6A Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Kabuki syndrome 2, 300867 27302555;24664873 False 3 100;0;0 1.2304 True ENSG00000147050 ENSG00000147050 HGNC:12637 KDM6B gene KDM6B Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with coarse facies and mild distal skeletal abnormalities, MIM#618505 31124279 False 3 100;0;0 1.2304 True ENSG00000132510 ENSG00000132510 HGNC:29012 KDR gene KDR Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Pulmonary hypertension;Haemangioma, capillary infantile, somatic 602089;Tetralogy of Fallot, MONDO:0008542 31980491;29650961;18931684 False 3 100;0;0 1.2304 True ENSG00000128052 ENSG00000128052 HGNC:6307 KDSR gene KDSR Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Erythrokeratodermia variabilis et progressiva 4, MIM# 617526;severe thrombocytopaenia 28774589;30467204;28575652 False 3 100;0;0 1.2304 True ENSG00000119537 ENSG00000119537 HGNC:4021 KERA gene KERA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cornea plana 2, autosomal recessive, MIM# 217300 23834557;11726611;10802664 False 3 100;0;0 1.2304 True ENSG00000139330 ENSG00000139330 HGNC:6309 KHDC3L gene KHDC3L Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hydatiform mold recurrent 2, MIM#614293 23232697;31847873;23125094;21885028 False 3 100;0;0 1.2304 True ENSG00000203908 ENSG00000203908 HGNC:33699 KHDRBS1 gene KHDRBS1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Premature ovarian failure 34794894;29808484;28938739;20881015 False 3 100;0;0 1.2304 True ENSG00000121774 ENSG00000121774 HGNC:18116 KIAA0391 gene KIAA0391 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "Combined oxidative phosphorylation deficiency 54, MIM# 619737" PMID: 34715011 False 3 100;0;0 1.2304 True ENSG00000100890 ENSG00000100890 HGNC:19958 KIAA0556 gene KIAA0556 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 26, MIM# 616784 26714646;27245168 False 3 100;0;0 1.2304 True ENSG00000047578 ENSG00000047578 HGNC:29068 KIAA0586 gene KIAA0586 Expert Review Green;Literature;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 23, MIM# 616490;Short-rib thoracic dysplasia 14 with polydactyly, MIM# 616546 26096313;26166481 False 3 100;0;0 1.2304 True ENSG00000100578 ENSG00000100578 HGNC:19960 KIAA0753 gene KIAA0753 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Orofaciodigital syndrome XV, MIM# 617127;Joubert syndrome 38, MIM# 619476;Short-rib thoracic dysplasia 21 without polydactyly, MIM# 619479 31816441;28220259;29138412;26643951;31816441;33875766;34016807 False 3 100;0;0 1.2304 True ENSG00000198920 ENSG00000198920 HGNC:29110 KIAA0825 gene KIAA0825 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "Polydactyly, postaxial, type A10, MIM# 618498" 32147526;30982135 False 3 100;0;0 1.2304 True ENSG00000185261 ENSG00000185261 HGNC:28532 KIAA1024L gene KIAA1024L Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 120, OMIM:620238 35727972 False 3 100;0;0 1.2304 True ENSG00000186367 ENSG00000186367 HGNC:33914 KIAA1109 gene KIAA1109 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Alkuraya-Kucinskas syndrome, MIM# 617822 29290337;30906834 False 3 100;0;0 1.2304 True ENSG00000138688 ENSG00000138688 HGNC:26953 KIAA1161 gene KIAA1161 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Basal ganglia calcification, idiopathic, 7, MIM #618317;primary familial brain calcifications (PFBC);ataxia;dysarthria;cerebellar atrophy;akinetic-hypertonic syndrome 30656188;30649222;30460687;29910000;31009047;31951047 False 3 100;0;0 1.2304 True ENSG00000164976 ENSG00000164976 HGNC:19918 KIDINS220 gene KIDINS220 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia, intellectual disability, nystagmus, and obesity, MIM# 617296;Ventriculomegaly and arthrogryposis, MIM# 619501 33205811;28934391;22048169;27005418;32909676 False 3 50;50;0 1.2304 True ENSG00000134313 ENSG00000134313 HGNC:29508 KIF11 gene KIF11 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Microcephaly with or without chorioretinopathy, lymphoedema, or mental retardation, MIM# 152950;MONDO:0007918 22284827;25115524;25124931;27212378;32730767;31993640;25996076 False 3 100;0;0 1.2304 True ENSG00000138160 ENSG00000138160 HGNC:6388 KIF12 gene KIF12 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Cholestasis, progressive familial intrahepatic, 8, MIM# 619662 30250217;30976738 False 3 50;50;0 1.2304 True ENSG00000136883 ENSG00000136883 HGNC:21495 KIF14 gene KIF14 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephaly 20, primary, autosomal recessive, MIM# 617914;Meckel syndrome 12, MIM# 616258 28892560;29343805;24128419 False 3 100;0;0 1.2304 True ENSG00000118193 ENSG00000118193 HGNC:19181 KIF1A gene KIF1A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neuropathy, hereditary sensory, type IIC, MIM# 614213;NESCAV syndrome, MIM# 614255;Spastic paraplegia 30, autosomal dominant MIM# 610357;Spastic paraplegia 30, autosomal recessive 620607 21820098;28708278 False 3 100;0;0 1.2304 True ENSG00000130294 ENSG00000130294 HGNC:888 KIF1BP gene KIF1BP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Goldberg-Shprintzen megacolon syndrome, MIM# 609460 23427148 False 3 100;0;0 1.2304 True ENSG00000198954 ENSG00000198954 HGNC:23419 KIF1C gene KIF1C Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 2, autosomal recessive, MIM# 611302 24482476;24319291;31413903;29544888 False 3 100;0;0 1.2304 True ENSG00000129250 ENSG00000129250 HGNC:6317 KIF21A gene KIF21A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Fibrosis of extraocular muscles, congenital, 1/3B, MIM# 135700 15621876;15223798;15621877;18332320;28930843;27513105;26190014;24656932 False 3 100;0;0 1.2304 True ENSG00000139116 ENSG00000139116 HGNC:19349 KIF21B gene KIF21B Expert Review;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Global developmental delay;Intellectual disability;Abnormality of brain morphology;Microcephaly 32415109 False 3 100;0;0 1.2304 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000116852 ENSG00000116852 HGNC:29442 KIF22 gene KIF22 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spondyloepimetaphyseal dysplasia with joint laxity, type 2 MIM#603546 22152677;22152678;25256152 False 3 100;0;0 1.2304 True ENSG00000079616 ENSG00000079616 HGNC:6391 KIF26A gene KIF26A Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Cortical dysplasia, complex, with other brain malformations 11, MIM# 620156 PMID: 36228617 False 3 100;0;0 1.2304 True ENSG00000066735 ENSG00000066735 HGNC:20226 KIF2A gene KIF2A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411 23603762;27896282;27747449;29077851;31919497 False 3 100;0;0 1.2304 True ENSG00000068796 ENSG00000068796 HGNC:6318 KIF4A gene KIF4A Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Intellectual developmental disorder, X-linked 100 MIM#300923;Taurodontism, microdontia, and dens invaginatus MIM#313490 24812067;34346154 False 3 50;50;0 1.2304 True ENSG00000090889 ENSG00000090889 HGNC:13339 KIF5A gene KIF5A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuropathy;Spastic paraplegia 10, autosomal dominant, MIM# 604187;Myoclonus, intractable, neonatal, MIM# 617235 30057544;29892902;28902413;26403765;25695920;25008398;27463701;27414745 False 3 100;0;0 1.2304 True ENSG00000155980 ENSG00000155980 HGNC:6323 KIF5B gene KIF5B Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted osteogenesis imperfecta, MONDO:0019019;Skeletal dysplasia, MONDO:0018230, KIF5B-related;Kyphomelic dysplasia PMID: 35342932;36018820;37934770 False 3 100;0;0 1.2304 True ENSG00000170759 ENSG00000170759 HGNC:6324 KIF5C gene KIF5C Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282 23603762;23033978;32562872 False 3 100;0;0 1.2304 True ENSG00000168280 ENSG00000168280 HGNC:6325 KIF7 gene KIF7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 12, MIM# 200990;Acrocallosal syndrome, MIM# 200990;MONDO:0008708;Hydrolethalus syndrome 2, MIM# 614120 21552264;21633164;19666503;30445565;26648833;26349186;26174511;25714560 False 3 100;0;0 1.2304 True ENSG00000166813 ENSG00000166813 HGNC:30497 KISS1R gene KISS1R Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypogonadotropic hypogonadism 8 with or without anosmia (MIM#614837) 17164310;31073722;14573733 False 3 100;0;0 1.2304 True ENSG00000116014 ENSG00000116014 HGNC:4510 KIT gene KIT Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Piebaldism, MIM# 172800;Gastrointestinal stromal tumor, familial, MIM# 606764;Mastocytosis, cutaneous, MIM# 154800 False 3 100;0;0 1.2304 True ENSG00000157404 ENSG00000157404 HGNC:6342 KITLG gene KITLG Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Deafness, autosomal dominant 69, unilateral or asymmetric, MIM# 616697;deafness;heterochromia iridis;hypopigmentation of the skin;hyperpigmentation of the skin;Waardenburg syndrome,MONDO:0018094, KITLG-related 26522471;35543077;28504826;19375057;21368769 False 3 50;50;0 1.2304 True ENSG00000049130 ENSG00000049130 HGNC:6343 KIZ gene KIZ Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Retinitis pigmentosa 69, MIM# 615780 24680887;31556760;29057815 False 3 100;0;0 1.2304 True ENSG00000088970 ENSG00000088970 HGNC:15865 KLB gene KLB Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypogonadotropic hypogonadism 28754744 False 3 100;0;0 1.2304 True ENSG00000134962 ENSG00000134962 HGNC:15527 KLC2 gene KLC2 Expert Review;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia, optic atrophy, and neuropathy MIM#609541 26385635 False 3 100;0;0 1.2304 True ENSG00000174996 ENSG00000174996 HGNC:20716 KLF1 gene KLF1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Dyserythropoietic anaemia, congenital, type IV, MIM# 613673;MONDO:0013355;Anaemia, congenital dyserythropoietic, type IVb, MIM#620969 21055716;33339573;32815883;32221653;32032242;31818881;24443441;25724378;28361594;34554218 False 3 100;0;0 1.2304 True ENSG00000105610 ENSG00000105610 HGNC:6345 KLF4 gene KLF4 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary palmoplantar keratoderma MONDO:0019272, KFL4-related PMID: 35168889;10431239 False 3 100;0;0 1.2304 True ENSG00000136826 ENSG00000136826 HGNC:6348 KLF7 gene KLF7 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability 29251763 False 3 100;0;0 1.2304 True ENSG00000118263 ENSG00000118263 HGNC:6350 KLHL20 gene KLHL20 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder (MONDO:0700092), KLHL20-related PMID: 36214804 False 3 100;0;0 1.2304 True ENSG00000076321 ENSG00000076321 HGNC:25056 KLHL24 gene KLHL24 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Epidermolysis bullosa simplex, generalized, with scarring and hair loss OMIM#617294;dilated cardiomyopathy;Cardiomyopathy, familial hypertrophic, 29, with polyglucosan bodies, MIM# 620236" 29779254;30120936;30715372 False 3 100;0;0 1.2304 True ENSG00000114796 ENSG00000114796 HGNC:25947 KLHL3 gene KLHL3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Pseudohypoaldosteronism, type IID, MIM# 614495 22266938;22406640;24821705;34022862;32462939 False 3 100;0;0 1.2304 True ENSG00000146021 ENSG00000146021 HGNC:6354 KLHL40 gene KLHL40 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Nemaline myopathy 8, autosomal recessive, MIM# 615348 23746549;24960163;32352246;31908664;27528495 False 3 100;0;0 1.2304 True ENSG00000157119 ENSG00000157119 HGNC:30372 KLHL41 gene KLHL41 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Nemaline myopathy 9, MIM# 615731 24268659;30986853;28939701;28826497 False 3 100;0;0 1.2304 True ENSG00000239474 ENSG00000239474 HGNC:16905 KLHL7 gene KLHL7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal PERCHING syndrome (MIM#617055);Retinitis pigmentosa 42 (MIM#612943) 31953236;30300710;31856884 False 3 100;0;0 1.2304 True ENSG00000122550 ENSG00000122550 HGNC:15646 KLK11 gene KLK11 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ichthyosis with erythrokeratoderma, MIM# 620507 36689511;37212630 False 3 100;0;0 1.2304 True ENSG00000167757 ENSG00000167757 HGNC:6359 KLK4 gene KLK4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Amelogenesis imperfecta, type IIA1, MIM# 204700 15235027;23355523;28611678;27066511 False 3 100;0;0 1.2304 True ENSG00000167749 ENSG00000167749 HGNC:6365 KMT2A gene KMT2A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Wiedemann-Steiner syndrome, MIM# 605130 AD 16990798 False 3 50;50;0 1.2304 True ENSG00000118058 ENSG00000118058 HGNC:7132 KMT2B gene KMT2B Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia 28, childhood-onset 617284;MONDO:0015004 27839873;27992417;33150406 False 3 100;0;0 1.2304 True ENSG00000272333 ENSG00000272333 HGNC:15840 KMT2C gene KMT2C Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Kleefstra syndrome 2, MIM#617768 False 3 100;0;0 1.2304 True ENSG00000055609 ENSG00000055609 HGNC:13726 KMT2D gene KMT2D Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Kabuki syndrome 1, MIM# 147920;Branchial arch abnormalities, choanal atresia, athelia, hearing loss, and hypothyroidism syndrome (BCAHH), MIM#620186 31949313;32083401 False 3 100;0;0 1.2304 True ENSG00000167548 ENSG00000167548 HGNC:7133 KMT2E gene KMT2E Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted O'Donnell-Luria-Rodan syndrome, MIM# 618512 31079897 False 3 100;0;0 1.2304 True ENSG00000005483 ENSG00000005483 HGNC:18541 KMT5B gene KMT5B Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 51 False 3 100;0;0 1.2304 True ENSG00000110066 ENSG00000110066 HGNC:24283 KNL1 gene KNL1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephaly 4, primary, autosomal recessive, MIM# 604321;MONDO:0011437 22983954;26626498;27149178;30304678;27784895 False 3 100;0;0 1.2304 True ENSG00000137812 ENSG00000137812 HGNC:24054 KPNA3 gene KPNA3 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia-88 (SPG88), MIM#620106 34564892 False 3 100;0;0 1.2304 True ENSG00000102753 ENSG00000102753 HGNC:6396 KPTN gene KPTN Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mental retardation, autosomal recessive 41 (MIM#615637) 24239382;32358097;32808430 False 3 100;0;0 1.2304 True ENSG00000118162 ENSG00000118162 HGNC:6404 KRAS gene KRAS Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cardiofaciocutaneous syndrome 2 615278;Noonan syndrome 3 609942;RAS-associated autoimmune leukoproliferative disorder 614470;Schimmelpenning-Feuerstein-Mims syndrome, somatic mosaic 163200 23059812;17056636 False 3 100;0;0 1.2304 True Other ENSG00000133703 ENSG00000133703 HGNC:6407 KRIT1 gene KRIT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cavernous malformations of CNS and retina, 116860;Cerebral cavernous malformations-1, 116860;Hyperkeratotic cutaneous capillary-venous malformations associated with cerebral capillary malformations, 116860 16571644;29593473 False 3 100;0;0 1.2304 True ENSG00000001631 ENSG00000001631 HGNC:1573 KRT1 gene KRT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epidermolytic hyperkeratosis, MIM#113800;Ichthyosis, cyclic, with epidermolytic hyperkeratosis, MIM# 607602;Ichthyosis histrix, Curth-Macklin type, MIM# 146590;Palmoplantar keratoderma, epidermolytic, MIM# 144200;Palmoplantar keratoderma, nonepidermolytic, MIM# 600962 7511022;21271994;11286630 False 3 100;0;0 1.2304 True ENSG00000167768 ENSG00000167768 HGNC:6412 KRT10 gene KRT10 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Epidermolytic hyperkeratosis, MIM#113800;Ichthyosis with confetti, MIM#609165;Ichthyosis, cyclic, with epidermolytic hyperkeratosis, MIM#607602 26176760;20798280;31638346;18219278;16505000 False 3 100;0;0 1.2304 True ENSG00000186395 ENSG00000186395 HGNC:6413 KRT12 gene KRT12 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Meesmann corneal dystrophy 1, MIM# 122100 9171831;22174841 False 3 100;0;0 1.2304 True ENSG00000187242 ENSG00000187242 HGNC:6414 KRT13 gene KRT13 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted White sponge nevus 2, MIM# 615785 7493031;14600690;32758484;29476668 False 3 100;0;0 1.2304 True ENSG00000171401 ENSG00000171401 HGNC:6415 KRT14 gene KRT14 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Epidermolysis bullosa simplex, recessive 1, 601001;Dermatopathia pigmentosa reticularis, 125595;Epidermolysis bullosa simplex, Dowling-Meara type, 131760;Epidermolysis bullosa simplex, Koebner type, 131900;Epidermolysis bullosa simplex, Weber-Cockayne type, 131800;Naegeli-Franceschetti-Jadassohn syndrome, 161000 16960809;18049449 False 3 100;0;0 1.2304 True Other ENSG00000186847 ENSG00000186847 HGNC:6416 KRT16 gene KRT16 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Palmoplantar keratoderma, nonepidermolytic, focal (MIM#613000);Pachyonychia congenita 1 (MIM#167200) 8595410;10839714 False 3 100;0;0 1.2304 True ENSG00000186832 ENSG00000186832 HGNC:6423 KRT17 gene KRT17 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Pachyonychia congenita 2, MIM#167210;Steatocystoma multiplex, MIM# 184500 31823354 False 3 100;0;0 1.2304 True ENSG00000128422 ENSG00000128422 HGNC:6427 KRT2 gene KRT2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Superficial epidermolytic ichthyosis (SEI) (MIM#146800) 26581228;22612346 False 3 100;0;0 1.2304 True ENSG00000172867 ENSG00000172867 HGNC:6439 KRT25 gene KRT25 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Woolly hair, autosomal recessive 3 MIM#616760 26160856;26902920;29686323;28899683 False 3 100;0;0 1.2304 True ENSG00000204897 ENSG00000204897 HGNC:30839 KRT3 gene KRT3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Meesmann corneal dystrophy 2, MIM# 618767 9171831;16227835;18806880;26788030 False 3 100;0;0 1.2304 True ENSG00000186442 ENSG00000186442 HGNC:6440 KRT4 gene KRT4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted White sponge naevus 1, MIM# 193900 7493030;10652003;12828738 False 3 100;0;0 1.2304 True ENSG00000170477 ENSG00000170477 HGNC:6441 KRT5 gene KRT5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Dowling-Degos disease 1, MIM# 179850;Epidermolysis bullosa simplex-MCR, MIM# 609352;Epidermolysis bullosa simplex-MP 131960;Epidermolysis bullosa simplex, Dowling-Meara type, MIM# 131760;Epidermolysis bullosa simplex, Koebner type, MIM# 131900;Epidermolysis bullosa simplex, recessive 1, MIM# 601001;Epidermolysis bullosa simplex, Weber-Cockayne type, MIM# 131800 False 3 100;0;0 1.2304 True ENSG00000186081 ENSG00000186081 HGNC:6442 KRT6A gene KRT6A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Pachyonychia congenita 3 (MIM#615726) 21326300 False 3 100;0;0 1.2304 True Other ENSG00000205420 ENSG00000205420 HGNC:6443 KRT6B gene KRT6B Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Pachyonychia congenita 4 (MIM#615728) 31823354 False 3 100;0;0 1.2304 True ENSG00000185479 ENSG00000185479 HGNC:6444 KRT6C gene KRT6C Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Palmoplantar keratoderma, nonepidermolytic, focal or diffuse (MIM#615735) 31823354 False 3 100;0;0 1.2304 True ENSG00000170465 ENSG00000170465 HGNC:20406 KRT81 gene KRT81 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Monilethrix, MIM# 158000 9402962;22628999 False 3 100;0;0 1.2304 True ENSG00000205426 ENSG00000205426 HGNC:6458 KRT85 gene KRT85 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ectodermal dysplasia 4, hair/nail type MIM#602032 16525032;19865094;31273852 False 3 100;0;0 1.2304 True ENSG00000135443 ENSG00000135443 HGNC:6462 KRT86 gene KRT86 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Monilethrix, MIM# 158000 9241275 False 3 100;0;0 1.2304 True ENSG00000170442 ENSG00000170442 HGNC:6463 KRT9 gene KRT9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Palmoplantar keratoderma, epidermolytic (MIM#144200) 31525823;29044727;7512862 False 3 100;0;0 1.2304 True ENSG00000171403 ENSG00000171403 HGNC:6447 KY gene KY Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Myopathy, myofibrillar, 7, MIM#617114 11136708;27485408;27484770;30591934 False 3 100;0;0 1.2304 True ENSG00000174611 ENSG00000174611 HGNC:26576 KYNU gene KYNU Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hydroxykynureninuria MIM#236800;Vertebral, cardiac, renal, and limb defects syndrome 2 MIM#617661;Disorders of histidine, tryptophan or lysine metabolism 17334708;28792876;31923704 False 3 100;0;0 1.2304 True ENSG00000115919 ENSG00000115919 HGNC:6469 L1CAM gene L1CAM Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Hydrocephalus due to aqueductal stenosis, MIM# 307000;MASA syndrome, MIM# 303350;L1 syndrome, MONDO:0017140;Corpus callosum, partial agenesis of, MIM# 304100 11438988;7920660;8401593;19565280 False 3 100;0;0 1.2304 True ENSG00000198910 ENSG00000198910 HGNC:6470 L2HGDH gene L2HGDH Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal L-2-hydroxyglutaric aciduria, MIM#236792 15385440;20052767 False 3 100;0;0 1.2304 True ENSG00000087299 ENSG00000087299 HGNC:20499 LACC1 gene LACC1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Juvenile arthritis MIM#618795 25220867;27881174;30872671;33718577 False 3 100;0;0 1.2304 True ENSG00000179630 ENSG00000179630 HGNC:26789 LAGE3 gene LAGE3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Galloway-Mowat syndrome 2, X-linked, MIM# 301006 28805828 False 3 100;0;0 1.2304 True ENSG00000196976 ENSG00000196976 HGNC:26058 LAMA1 gene LAMA1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, intellectual disability, oculomotor apraxia, cerebellar cysts;Poretti Boltshauser syndrome MIM#615960 25105227 False 3 100;0;0 1.2304 True ENSG00000101680 ENSG00000101680 HGNC:6481 LAMA2 gene LAMA2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855;Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138 30055037 False 3 100;0;0 1.2304 True ENSG00000196569 ENSG00000196569 HGNC:6482 LAMA3 gene LAMA3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal "Epidermolysis bullosa, junctional 2A, intermediate MIM#619783;Epidermolysis bullosa, junctional 2B, severe MIM#619784;Epidermolysis bullosa, junctional 2C, laryngoonychocutaneous MIM#245660" 7633458;8530087;11810295;10366601;37635785 False 3 50;50;0 1.2304 True ENSG00000053747 ENSG00000053747 HGNC:6483 LAMA5 gene LAMA5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Bent bone dysplasia syndrome 2, MIM# 620076;nephrotic syndrome;Presynaptic congenital myasthenic syndrome;multisystem syndrome;developmental delay 33242826;29534211;16790509;30589377;28735299;30631761 False 3 67;33;0 1.2304 True ENSG00000130702 ENSG00000130702 HGNC:6485 LAMB1 gene LAMB1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Lissencephaly 5, MIM# 615191;Cystic leukoencephalopathy;Adult-onset leukoencephalopathy 23472759;25925986;29888467;25925986;32548278;34606115 False 3 100;0;0 1.2304 True ENSG00000091136 ENSG00000091136 HGNC:6486 LAMB2 gene LAMB2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pierson syndrome, MIM# 609049;Nephrotic syndrome, type 5, with or without ocular abnormalities, MIM# 614199 14136829;15372515;17256789 False 3 100;0;0 1.2304 True ENSG00000172037 ENSG00000172037 HGNC:6487 LAMB3 gene LAMB3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Amelogenesis imperfecta, type IA, MIM# 104530;Epidermolysis bullosa, junctional, Herlitz type, MIM# 226700;Epidermolysis bullosa, junctional, non-Herlitz type, MIM# 226650 11023379;7706760;23958762;7706760;23632796;26502894;27220909;25769099;24494736 False 3 100;0;0 1.2304 True ENSG00000196878 ENSG00000196878 HGNC:6490 LAMC2 gene LAMC2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Epidermolysis bullosa, junctional, Herlitz type, MIM# 226700;Epidermolysis bullosa, junctional, non-Herlitz type, MIM# 226650 11810295;25888738;24533970 False 3 100;0;0 1.2304 True ENSG00000058085 ENSG00000058085 HGNC:6493 LAMC3 gene LAMC3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cortical malformations, occipital, MIM#614115 21572413;34354730 False 3 100;0;0 1.2304 True ENSG00000050555 ENSG00000050555 HGNC:6494 LAMP2 gene LAMP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Danon disease, MIM# 300257;MONDO:0010281 False 3 100;0;0 1.2304 True ENSG00000005893 ENSG00000005893 HGNC:6501 LARGE1 gene LARGE1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A6, MIM# 613154;Muscular dystrophy-dystroglycanopathy type B6, MIM# 608840 12966029;19067344;17436019;21248746 False 3 100;0;0 1.2304 True ENSG00000133424 ENSG00000133424 HGNC:6511 LARP1 gene LARP1 Expert Review Green;Other Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder;MONDO:0700092 39182167 False 3 100;0;0 1.2304 True ENSG00000155506 ENSG00000155506 HGNC:29531 LARP7 gene LARP7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Alazami syndrome, MIM# 615071;Microcephalic primordial dwarfism, Alazami type MONDO:0014031 22865833;21937992;30006060;33569879 False 3 100;0;0 1.2304 True ENSG00000174720 ENSG00000174720 HGNC:24912 LARS gene LARS Expert Review Green;NHS GMS Mendeliome BIALLELIC, autosomal or pseudoautosomal Infantile liver failure syndrome 1, MIM# 615438;Seizures;Intellectual disability;Encephalopathy 28774368;30349989;22607940;32699352 False 3 100;0;0 1.2304 True ENSG00000133706 ENSG00000133706 HGNC:6512 LARS2 gene LARS2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Perrault syndrome 4;Hydrops, lactic acidosis, and sideroblastic anemia, MIM# 617021;Leukodystrophy 29205794;32423379;30737337;26537577;23541342 False 3 100;0;0 1.2304 True ENSG00000011376 ENSG00000011376 HGNC:17095 LAS1L gene LAS1L Expert Review;Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Wilson-Turner syndrome, MIM# 309585 25644381;34653234;26358559;24647030 False 3 100;0;0 1.2304 True ENSG00000001497 ENSG00000001497 HGNC:25726 LAT gene LAT Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 52, MIM# 617514 27522155;27242165;10204488 False 3 100;0;0 1.2304 True ENSG00000213658 ENSG00000213658 HGNC:18874 LBR gene LBR Expert list;Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Greenberg skeletal dysplasia, MIM# 215140 12618959;27604308;29068549 False 3 100;0;0 1.2304 True ENSG00000143815 ENSG00000143815 HGNC:6518 LCA5 gene LCA5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Leber Congenital Amaurosis 5, MIM# 604537 17546029 False 3 100;0;0 1.2304 True ENSG00000135338 ENSG00000135338 HGNC:31923 LCAT gene LCAT Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Lecithin:Cholesterol Acyltransferase Deficiency, MIM# 245900;Fish-Eye disease, MIM# 136120 30720493;6624548 False 3 100;0;0 1.2304 True ENSG00000213398 ENSG00000213398 HGNC:6522 LCK gene LCK Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 22 MIM# 615758;Recurrent infections;Immune dysregulation;autoimmunity;Low CD4+;low CD8+;restricted T cell repertoire;poor TCR signaling;Normal IgG/IgA;high IgM;failure to thrive;diarrhoea;lymphopaenia;hypogammaglobulinaemia;anaemia;thrombocytopaenia;CD4+ T-cell lymphopaenia 22985903;1579166;11021796 False 3 100;0;0 1.2304 True ENSG00000182866 ENSG00000182866 HGNC:6524 LCP2 gene LCP2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 81, MIM# 619374;Severe combined immunodeficiency 33231617;36474126 False 3 100;0;0 1.2304 True ENSG00000043462 ENSG00000043462 HGNC:6529 LCT gene LCT Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Lactase deficiency, congenital, MIM# 223000 False 3 100;0;0 1.2304 True ENSG00000115850 ENSG00000115850 HGNC:6530 LDB1 gene LDB1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Congenital hydrocephalus MONDO:0016349 39680505 False 3 100;0;0 1.2304 True ENSG00000198728 ENSG00000198728 HGNC:6532 LDB3 gene LDB3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Cardiomyopathy, dilated, 1C, with or without LVNC MIM#601493;Cardiomyopathy, hypertrophic, 24 MIM#601493;Left ventricular noncompaction 3 MIM#601493;Myopathy, myofibrillar, 4 MIM#609452 26419279;16427346;14660611;14662268;27546599;25911362 False 3 100;0;0 1.2304 True ENSG00000122367 ENSG00000122367 HGNC:15710 LDHA gene LDHA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease XI, MIM# 612933 2334430;1959923;8327147 False 3 100;0;0 1.2304 True ENSG00000134333 ENSG00000134333 HGNC:6535 LDLRAP1 gene LDLRAP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypercholesterolemia, familial, 4, MIM# 603813 4351242 False 3 100;0;0 1.2304 True ENSG00000157978 ENSG00000157978 HGNC:18640 LEF1 gene LEF1 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Syndromic disease, MONDO:0002254, LEF1-related 32022899;35583550 False 3 100;0;0 1.2304 True ENSG00000138795 ENSG00000138795 HGNC:6551 LEMD3 gene LEMD3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Buschke-Ollendorff syndrome MIM#166700;Osteopoikilosis with or without melorheostosis MIM#166700 34098227;33598273;32519343;32151766;32151766 False 3 100;0;0 1.2304 True ENSG00000174106 ENSG00000174106 HGNC:28887 LEP gene LEP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Obesity, morbid, due to leptin deficiency (MIM#614962) 26567097 False 3 100;0;0 1.2304 True ENSG00000174697 ENSG00000174697 HGNC:6553 LEPR gene LEPR Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Obesity, morbid, due to leptin receptor deficiency (MIM#614963) 17229951;29545012 False 3 100;0;0 1.2304 True ENSG00000116678 ENSG00000116678 HGNC:6554 LETM1 gene LETM1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Childhood-onset neurodegeneration with multisystem involvement due to mitochondrial dysfunction (CONDMIM), MIM#620089 36055214 False 3 100;0;0 1.2304 True ENSG00000168924 ENSG00000168924 HGNC:6556 LFNG gene LFNG Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spondylocostal dysostosis 3, autosomal recessive, MIM# 609813 9690472;16385447;30531807;9690473 False 3 100;0;0 1.2304 True ENSG00000106003 ENSG00000106003 HGNC:6560 LGI1 gene LGI1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epilepsy, familial temporal lobe, 1, MIM# 6000512 18711109;12205652;15079010;22496201 False 3 100;0;0 1.2304 True ENSG00000108231 ENSG00000108231 HGNC:6572 LGI3 gene LGI3 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092, LGI3-related;Global developmental delay;Intellectual disability;Distal deformities;Diminished reflexes;Facial myokymia;Hyporeflexia/areflexi PMID: 35948005 False 3 100;0;0 1.2304 True ENSG00000168481 ENSG00000168481 HGNC:18711 LGI4 gene LGI4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Arthrogryposis multiplex congenita, neurogenic, with myelin defect, MIM#617468 28318499;34288120 False 3 100;0;0 1.2304 True ENSG00000153902 ENSG00000153902 HGNC:18712 LHB gene LHB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypogonadotropic hypogonadism 23 with or without anosmia, MIM# 228300 False 3 100;0;0 1.2304 True ENSG00000104826 ENSG00000104826 HGNC:6584 LHCGR gene LHCGR Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Luteinizing hormone resistance, female, (MIM#238320);Leydig cell hypoplasia with pseudohermaphroditism, (MIM#238320);Leydig cell hypoplasia with hypergonadotropic hypogonadism, (MIM#238320);Precocious puberty, male, (MIM#176410) 11041448 False 3 100;0;0 1.2304 True ENSG00000138039 ENSG00000138039 HGNC:6585 LHFPL5 gene LHFPL5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 67, MIM# 610265 16459341;16752389;21816241;19888295;26437881;26029705;15905332;19102128;25550511 False 3 100;0;0 1.2304 True ENSG00000197753 ENSG00000197753 HGNC:21253 LHX2 gene LHX2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder (MONDO: 0700092) PMID: 37057675 False 3 100;0;0 1.2304 True ENSG00000106689 ENSG00000106689 HGNC:6594 LHX3 gene LHX3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pituitary hormone deficiency, combined, 3, MIM# 221750 False 3 100;0;0 1.2304 True ENSG00000107187 ENSG00000107187 HGNC:6595 LHX4 gene LHX4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Pituitary hormone deficiency, combined, 4, MIM# 262700 False 3 100;0;0 1.2304 True ENSG00000121454 ENSG00000121454 HGNC:21734 LIAS gene LIAS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hyperglycinemia, lactic acidosis, and seizures, MIM# 614462 22152680;24334290;26108146 False 3 100;0;0 1.2304 True ENSG00000121897 ENSG00000121897 HGNC:16429 LIFR gene LIFR Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Stuve-Wiedemann syndrome/Schwartz-Jampel type 2 syndrome, MIM# 601559;CAKUT" 14740318;20447141;24988918;29620724;28334964 False 3 50;50;0 1.2304 True ENSG00000113594 ENSG00000113594 HGNC:6597 LIG1 gene LIG1 Expert list;Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 96, MIM# 619774;Lymphopaenia;Hypogammaglobulinaemia;Recurrent bacterial and viral infections;Growth retardation;Sun sensitivity, radiation sensitivity;Macrocytosis 30395541 False 3 100;0;0 1.2304 True ENSG00000105486 ENSG00000105486 HGNC:6598 LIG3 gene LIG3 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 20 (MNGIE type), MIM# 619780 33855352 False 3 100;0;0 1.2304 True ENSG00000005156 ENSG00000005156 HGNC:6600 LIG4 gene LIG4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal LIG4 syndrome, MIM# 606593;DNA ligase IV deficiency, MONDO:0011686 11779494;16088910;15333585;20133615 False 3 100;0;0 1.2304 True ENSG00000174405 ENSG00000174405 HGNC:6601 LIM2 gene LIM2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Cataract 19, multiple types, MIM# 615277 27814360;11917274;18596884;33708862;32202185;21617753 False 3 100;0;0 1.2304 True ENSG00000105370 ENSG00000105370 HGNC:6610 LINC01578 gene LINC01578 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with dysmorphic facies, absent speech and ambulation, and brain abnormalities, MIM# 621012 39442041 False 3 100;0;0 1.2304 True ENSG00000272888 ENSG00000272888 HGNC:48626 LINGO4 gene LINGO4 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Developmental Delay, Intellectual disability, speech disorder PMID: 33098801 False 3 100;0;0 1.2304 True ENSG00000213171 ENSG00000213171 HGNC:31814 LINS1 gene LINS1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Intellectual developmental disorder, autosomal recessive 27, MIM# 614340 32802957;34450347;32499722;31922598;28181389 False 3 100;0;0 1.2304 True ENSG00000140471 ENSG00000140471 HGNC:30922 LIPA gene LIPA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cholesteryl ester storage disease, MIM# 278000;Wolman disease, MIM# 278000;Lysosomal acid lipase deficiency, MONDO:0010204 11487567 False 3 100;0;0 1.2304 True ENSG00000107798 ENSG00000107798 HGNC:6617 LIPC gene LIPC Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hepatic lipase deficiency MIM#614025;Hyperlipidemia due to hepatic triglyceride lipase deficiency, MONDO:0013533 1671786;12777476;1883393;23219720;26423094;22464213;22798447 False 3 100;0;0 1.2304 True ENSG00000166035 ENSG00000166035 HGNC:6619 LIPE gene LIPE Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Lipodystrophy, familial partial, type 6, 615980 27862896;25475467;24848981 False 3 100;0;0 1.2304 True ENSG00000079435 ENSG00000079435 HGNC:6621 LIPH gene LIPH Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Woolly hair, autosomal recessive 2 with or without hypotrichosis, MIM# 604379;Hypotrichosis 7, MIM# 604379 False 3 100;0;0 1.2304 True ENSG00000163898 ENSG00000163898 HGNC:18483 LIPT1 gene LIPT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Lipoyltransferase 1 deficiency, MIM#616299;Leigh-like presentation False 3 100;0;0 1.2304 True ENSG00000144182 ENSG00000144182 HGNC:29569 LIPT2 gene LIPT2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Encephalopathy, neonatal severe, with lactic acidosis and brain abnormalities, MIM#617668 28757203 False 3 100;0;0 1.2304 True ENSG00000175536 ENSG00000175536 HGNC:37216 LITAF gene LITAF Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, type 1C, MIM# 601098;MONDO:0010995 12525712;19541485;23359569;32665875;28211240 False 3 100;0;0 1.2304 True ENSG00000189067 ENSG00000189067 HGNC:16841 LMAN1 gene LMAN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined factor V and VIII deficiency, MIM# 227300;MONDO:0009206 9546392;16304051 False 3 100;0;0 1.2304 True ENSG00000074695 ENSG00000074695 HGNC:6631 LMBR1 gene LMBR1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Laurin-Sandrow syndrome, MIM# 135750;Polydactyly, preaxial type II 174500;Triphalangeal thumb, type I, MIM# 174500;Syndactyly, type IV, MIM# 186200;Acheiropody, MIM# 200500;Triphalangeal thumb-polysyndactyly syndrome, MIM# 174500;Hypoplastic or aplastic tibia with polydactyly, MIM# 188740 False 3 100;0;0 1.2304 True ENSG00000105983 ENSG00000105983 HGNC:13243 LMBRD1 gene LMBRD1 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Methylmalonic aciduria and homocystinuria, cblF type MIM# 277380 19136951;27604308 False 3 100;0;0 1.2304 True ENSG00000168216 ENSG00000168216 HGNC:23038 LMBRD2 gene LMBRD2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental delay with variable neurologic and brain abnormalities, MIM# 619694;Global developmental delay;Intellectual disability;Microcephaly;Seizures;Abnormality of nervous system morphology;Abnormality of the eye 32820033;https://doi.org/10.1101/797787 False 3 100;0;0 1.2304 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000164187 ENSG00000164187 HGNC:25287 LMF1 gene LMF1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Lipase deficiency, combined, MIM# 246650 False 3 100;0;0 1.2304 True ENSG00000103227 ENSG00000103227 HGNC:14154 LMNB1 gene LMNB1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Microcephaly 26, primary, autosomal dominant, MIM# 619179;Global developmental delay, Intellectual disability, Microcephaly, Short stature, Seizures, Abnormality of the corpus callosum, Cortical gyral simplification, Feeding difficulties, Scoliosis;Leukodystrophy, adult-onset, autosomal dominant, MIM# 169500;Leukodystrophy, demyelinating, adult-onset, autosomal dominan, atypical, MIM#621061 32910914;16951681;19151023;33033404 False 3 100;0;0 1.2304 True Other ENSG00000113368 ENSG00000113368 HGNC:6637 LMNB2 gene LMNB2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Lipodystrophy, partial, acquired, susceptibility to} 608709;Microcephaly 27, primary, autosomal dominant, MIM# 619180;Congenital microcephaly, Intellectual disability 16826530;22768673;33033404 False 3 100;0;0 1.2304 True ENSG00000176619 ENSG00000176619 HGNC:6638 LMOD2 gene LMOD2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Dilated cardiomyopathy, MONDO:0005021 PMID: 31517052;PMID: 34888509;PMID: 35082396;PMID: 35188328;PMID: 26487682 False 3 100;0;0 1.2304 True ENSG00000170807 ENSG00000170807 HGNC:6648 LMOD3 gene LMOD3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Nemaline myopathy 10, MIM# 616165 29331079;25250574;30291184;28815944;30642739 False 3 100;0;0 1.2304 True ENSG00000163380 ENSG00000163380 HGNC:6649 LMX1A gene LMX1A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Deafness, autosomal dominant 7 MIM#601412;non-syndromic hearing loss 29754270;32840933;29971487 False 3 100;0;0 1.2304 True ENSG00000162761 ENSG00000162761 HGNC:6653 LMX1B gene LMX1B Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Nail-patella syndrome (MIM#161200), MONDO:0008061;LMX1B-related nephropathy;Focal segmental glomerulosclerosis-10 (FSGS10), MIM#256020 27450397;32457516 False 3 100;0;0 1.2304 True ENSG00000136944 ENSG00000136944 HGNC:6654 LNPK gene LNPK Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with epilepsy and hypoplasia of the corpus callosum, MIM# 618090 30032983 False 3 50;50;0 1.2304 True ENSG00000144320 ENSG00000144320 HGNC:21610 LONP1 gene LONP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal CODAS syndrome, MIM#600373;Mitochondrial cytopathy 31636596 False 3 100;0;0 1.2304 True ENSG00000196365 ENSG00000196365 HGNC:9479 LOR gene LOR Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Vohwinkel syndrome with ichthyosis, MIM# 604117 8673107;9326398;9326323;25234742;25142840 False 3 100;0;0 1.2304 True ENSG00000203782 ENSG00000203782 HGNC:6663 LOX gene LOX Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Aortic aneurysm, familial thoracic 10, MIM# 617168 30071989;26838787;30675029 False 3 100;0;0 1.2304 True ENSG00000113083 ENSG00000113083 HGNC:6664 LOXHD1 gene LOXHD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 77, MIM# 613079 21465660;19732867;25792669 False 3 100;0;0 1.2304 True ENSG00000167210 ENSG00000167210 HGNC:26521 LPAR6 gene LPAR6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Woolly hair, autosomal recessive 1, with or without hypotrichosis, MIM# 609239 False 3 100;0;0 1.2304 True ENSG00000139679 ENSG00000139679 HGNC:15520 LPIN1 gene LPIN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Myoglobinuria, acute recurrent, autosomal recessive, MIM# 268200 18817903;32549891;32522502;32410653 False 3 100;0;0 1.2304 True ENSG00000134324 ENSG00000134324 HGNC:13345 LPIN2 gene LPIN2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Majeed syndrome, MIM# 609628;Chronic recurrent multifocal osteomyelitis with congenital dyserythropoietic anaemia 15994876;33993107;33670882;33314777;31727123 False 3 100;0;0 1.2304 True ENSG00000101577 ENSG00000101577 HGNC:14450 LPL gene LPL Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Combined hyperlipidemia, familial, MIM# 144250;Lipoprotein lipase deficiency, MIM# 238600 False 3 100;0;0 1.2304 True ENSG00000175445 ENSG00000175445 HGNC:6677 LRAT gene LRAT Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Leber congenital amaurosis 14 MIM#613341;Retinal dystrophy, early-onset severe MIM#613341;Retinitis pigmentosa, juvenile MIM#613341 11381255;18055821;22570351;17011878;29973277;24625443;22559933;31448181 False 3 100;0;0 1.2304 True ENSG00000121207 ENSG00000121207 HGNC:6685 LRBA gene LRBA Expert Review Green;Literature;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency, common variable, 8, with autoimmunity MIM# 614700;Normal-decreased CD4 numbers;T cell dysregulation;Low-normal B cells;Reduced IgG and IgA;Recurrent infections;chronic diarrhoea;inflammatory bowel disease;hypogammaglobulinaemia;pneumonitis;autoimmune disorders;thrombocytopaenia 22721650;25468195;26206937;33155142;22608502;32506362 False 3 100;0;0 1.2304 True ENSG00000198589 ENSG00000198589 HGNC:1742 LRIG2 gene LRIG2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Urofacial syndrome 2, MIM# 615112 23313374;27855655;30885509 False 3 100;0;0 1.2304 True ENSG00000198799 ENSG00000198799 HGNC:20889 LRIT3 gene LRIT3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Night blindness, congenital stationary (complete), 1F, autosomal recessive, MIM# 615058 23246293;24598786;31578364;27428514 False 3 100;0;0 1.2304 True ENSG00000183423 ENSG00000183423 HGNC:24783 LRMDA gene LRMDA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Albinism, oculocutaneous, type VII, MIM# 615179;MONDO:0014070 23395477 False 3 100;0;0 1.2304 True ENSG00000148655 ENSG00000148655 HGNC:23405 LRP2 gene LRP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Donnai-Barrow syndrome, MIM# 222448 17632512 False 3 100;0;0 1.2304 True ENSG00000081479 ENSG00000081479 HGNC:6694 LRP4 gene LRP4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cenani-Lenz syndactyly syndrome (MIM#212780);Myasthenic syndrome, congenital, 17, MIM# 616304;Sclerosteosis 2, MIM# 614305;Syndactyly 23636941;23664847;30041615;20381006;24234652;26052878;24200689;21471202;32286743;28477420;26751728;29524275 False 3 100;0;0 1.2304 True ENSG00000134569 ENSG00000134569 HGNC:6696 LRP5 gene LRP5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Exudative vitreoretinopathy 4, MIM# 601813;Osteopetrosis, autosomal dominant 1, MIM# 607634;Osteoporosis-pseudoglioma syndrome, MIM# 259770;Osteosclerosis, MIM# 144750;Polycystic liver disease 4 with or without kidney cysts, MIM# 617875 False 3 100;0;0 1.2304 True ENSG00000162337 ENSG00000162337 HGNC:6697 LRP6 gene LRP6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Tooth agenesis, selective, 7, MIM# 616724 False 3 100;0;0 1.2304 True ENSG00000070018 ENSG00000070018 HGNC:6698 LRPPRC gene LRPPRC Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 5, (French-Canadian) MIM#220111 32972427;26510951;21266382 False 3 100;0;0 1.2304 True ENSG00000138095 ENSG00000138095 HGNC:15714 LRRC56 gene LRRC56 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Ciliary dyskinesia, primary, 39 618254" PMID: 30388400 False 3 100;0;0 1.2304 True ENSG00000161328 ENSG00000161328 HGNC:25430 LRRC6 gene LRRC6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 19, MIM# 614935 23122589;23891469;32622824;29511670 False 3 100;0;0 1.2304 True ENSG00000129295 ENSG00000129295 HGNC:16725 LRRC7 gene LRRC7 Expert Review Green;Literature;Other Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted neurodevelopmental disorder (MONDO:0700092), LRRC7-related 39256359 False 3 100;0;0 1.2304 True ENSG00000033122 ENSG00000033122 HGNC:18531 LRRK1 gene LRRK1 Expert Review;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Osteosclerotic metaphyseal dysplasia (OSMD) (OMIM: 615198) 27829680;27055475;31571209;32119750 False 3 100;0;0 1.2304 True ENSG00000154237 ENSG00000154237 HGNC:18608 LRSAM1 gene LRSAM1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, axonal, type 2P, MIM# 614436;MONDO:0013753 20865121;22012984;22781092;27686364;33568173;33414056;30996334 False 3 100;0;0 1.2304 True ENSG00000148356 ENSG00000148356 HGNC:25135 LRTOMT gene LRTOMT Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 63, MIM# 611451 18953341;18794526;21739586;18794526 False 3 100;0;0 1.2304 True ENSG00000184154 ENSG00000184154 HGNC:25033 LSS gene LSS Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Cataract 44, OMIM #616509;Hypotrichosis 14, OMIM #618275;Intellectual disability 30723320 False 3 100;0;0 1.2304 True ENSG00000160285 ENSG00000160285 HGNC:6708 LTBP1 gene LTBP1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Cutis laxa, autosomal recessive, type IIE MIM#619451 33991472 False 3 100;0;0 1.2304 True ENSG00000049323 ENSG00000049323 HGNC:6714 LTBP2 gene LTBP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Glaucoma 3, primary congenital, D 613086;Microspherophakia and/or megalocornea, with ectopia lentis and with or without secondary glaucoma, MIM# 251750 19656777;19361779;20617341;32165823;30380740;30565850 False 3 100;0;0 1.2304 True ENSG00000119681 ENSG00000119681 HGNC:6715 LTBP3 gene LTBP3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Dental anomalies and short stature, MIM# 601216;Geleophysic dysplasia 3, MIM# 617809;Thoracic aneurysm 19344874;25899461;25669657;29625025;27068007;34150014 False 3 100;0;0 1.2304 True ENSG00000168056 ENSG00000168056 HGNC:6716 LTBP4 gene LTBP4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cutis laxa, autosomal recessive, type IC, MIM# 613177 22829427;19836010;28684544 False 3 100;0;0 1.2304 True ENSG00000090006 ENSG00000090006 HGNC:6717 LYN gene LYN Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Autoinflammatory disease, systemic, with vasculitis, MIM# 620376 36932076;36122175 False 3 100;0;0 1.2304 True ENSG00000254087 ENSG00000254087 HGNC:6735 LYRM7 gene LYRM7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex III deficiency, nuclear type 8, MIM#615838 False 3 100;0;0 1.2304 True ENSG00000186687 ENSG00000186687 HGNC:28072 LYST gene LYST Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Chediak-Higashi syndrome, MIM# 214500 False 3 100;0;0 1.2304 True ENSG00000143669 ENSG00000143669 HGNC:1968 LYZ gene LYZ Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Amyloidosis, renal, MIM# 105200;Amyloidosis, hereditary systemic 5, MIM# 620658" 1808634;8464497;15745733, False 3 100;0;0 1.2304 True ENSG00000090382 ENSG00000090382 HGNC:6740 LZTFL1 gene LZTFL1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 17 (MIM#615994) 22510444;23692385;27312011;22072986 False 3 100;0;0 1.2304 True ENSG00000163818 ENSG00000163818 HGNC:6741 M1AP gene M1AP Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Spermatogenic failure 48, MIM# 619108;non-obstructive azoospermia (NOA);severe spermatogenic failure;male infertility PMID: 32673564 False 3 100;0;0 1.2304 True ENSG00000159374 ENSG00000159374 HGNC:25183 MAB21L1 gene MAB21L1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "Cerebellar, ocular, craniofacial, and genital syndrome #MIM 618479" 30487245 False 3 100;0;0 1.2304 True ENSG00000180660 ENSG00000180660 HGNC:6757 MAB21L2 gene MAB21L2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Microphthalmia/coloboma and skeletal dysplasia syndrome, MIM# 615877 24906020;25719200;31037784;30375740;30073347;26116559 False 3 100;0;0 1.2304 True ENSG00000181541 ENSG00000181541 HGNC:6758 MACF1 gene MACF1 Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Lissencephaly 9 with complex brainstem malformation, MIM# 618325" 30471716 False 3 100;0;0 1.2304 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000127603 ENSG00000127603 HGNC:13664 MADD gene MADD Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal DEEAH syndrome, MIM#619004 (Developmental Delay With Endocrine, Exocrine, Autonomic, and Hematologic Abnormalities);Neurodevelopmental disorder with dysmorphic facies, impaired speech and hypotonia (NEDDISH), MIM# 619005 28940097;29302074;32761064 False 3 100;0;0 1.2304 True ENSG00000110514 ENSG00000110514 HGNC:6766 MAF gene MAF Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ayme-Gripp syndrome (MIM#601088) 30160832;34643041 False 3 100;0;0 1.2304 True ENSG00000178573 ENSG00000178573 HGNC:6776 MAFB gene MAFB Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Multicentric carpotarsal osteolysis syndrome (MIM#166300);Duane retraction syndrome 3, MIM# 617041 23956186;30208859;27181683 False 3 100;0;0 1.2304 True ENSG00000204103 ENSG00000204103 HGNC:6408 MAG gene MAG Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 75, autosomal recessive, MIM# 616680;Cerebellar ataxia 24482476;26179919;31402626;32629324 False 3 100;0;0 1.2304 True ENSG00000105695 ENSG00000105695 HGNC:6783 MAGED2 gene MAGED2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Bartter syndrome, type 5, antenatal, transient, MIM# 300971 27120771 False 3 100;0;0 1.2304 True ENSG00000102316 ENSG00000102316 HGNC:16353 MAGEL2 gene MAGEL2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) Schaaf-Yang syndrome, MIM# 615547 33820833;24076603;31397880;29599419;30302899 False 3 100;0;0 1.2304 True ENSG00000254585 ENSG00000254585 HGNC:6814 MAGI2 gene MAGI2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Nephrotic syndrome, type 15, MIM# 617609 27932480;25108225;25271328;31171376;31010479 False 3 100;0;0 1.2304 True ENSG00000187391 ENSG00000187391 HGNC:18957 MAGT1 gene MAGT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Congenital disorder of glycosylation, type Icc (MIM# 301031);Immunodeficiency, X-linked, with magnesium defect, Epstein-Barr virus infection and neoplasia (MIM# 300853) 31036665;31714901 False 3 100;0;0 1.2304 True ENSG00000102158 ENSG00000102158 HGNC:28880 MAK gene MAK Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Retinitis pigmentosa 62, MIM# 614181 21825139;21835304 False 3 100;0;0 1.2304 True ENSG00000111837 ENSG00000111837 HGNC:6816 MALT1 gene MALT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 12 MIM# 615468;poor T-cell proliferation;normal T/B cell numbers;poor specific antibody response;recurrent bacterial/fungal/viral infections;bronchiectasis;failure to thrive 23727036;24332264;14576442;31037583 False 3 100;0;0 1.2304 True ENSG00000172175 ENSG00000172175 HGNC:6819 MAMLD1 gene MAMLD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Hypospadias 2 (MIM#300758) 26815876;31555317;32690052 False 3 100;0;0 1.2304 True ENSG00000013619 ENSG00000013619 HGNC:2568 MAN1B1 gene MAN1B1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mental retardation, autosomal recessive 15, MIM#614202 24348268 False 3 100;0;0 1.2304 True ENSG00000177239 ENSG00000177239 HGNC:6823 MAN2B1 gene MAN2B1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mannosidosis, alpha-, types I and II, MIM# 248500;MONDO:0009561 False 3 100;0;0 1.2304 True ENSG00000104774 ENSG00000104774 HGNC:6826 MAN2C1 gene MAN2C1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of deglycosylation 2, MIM# 619775 35045343 False 3 100;0;0 1.2304 True ENSG00000140400 ENSG00000140400 HGNC:6827 MANBA gene MANBA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mannosidosis, beta, MIM# 248510;MONDO:0009562;Nystagmus, autosomal dominant 30552791;25741867 False 3 100;0;0 1.2304 True ENSG00000109323 ENSG00000109323 HGNC:6831 MAOA gene MAOA Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Brunner syndrome, MIM# 300615 25807999;24169519 False 3 100;0;0 1.2304 True ENSG00000189221 ENSG00000189221 HGNC:6833 MAP1B gene MAP1B Australian Genomics Health Alliance Brain Malformations Flagship;Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability;seizures;PVNH;dysmorphic features;Periventricular nodular heterotopia 9, MIM# 618918;Deafness, autosomal dominant 83, MIM# 619808 31317654;30150678;30214071 False 3 100;0;0 1.2304 True ENSG00000131711 ENSG00000131711 HGNC:6836 MAP2K1 gene MAP2K1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cardiofaciocutaneous syndrome 3, MIM# 615279 16439621;17551924;18042262;20301365 False 3 100;0;0 1.2304 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000169032 ENSG00000169032 HGNC:6840 MAP2K2 gene MAP2K2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cardiofaciocutaneous syndrome 4, MIM# 615280 20358587;16439621;18042262 False 3 100;0;0 1.2304 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000126934 ENSG00000126934 HGNC:6842 MAP3K1 gene MAP3K1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted 46XY sex reversal 6 (MIM#613762) 21129722;32986312 False 3 100;0;0 1.2304 True ENSG00000095015 ENSG00000095015 HGNC:6848 MAP3K14 gene MAP3K14 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 112, MIM# 620449;NIK deficiency;Poor T cell proliferation to antigen;Low B-cell numbers;Low NK number and function;recurrent bacterial/viral/ cryptosporidium infections;hypogammaglobulinaemia;decreased immunoglobulin levels 29230214;11251123;25406581;10319865;11238593;12352969 False 3 100;0;0 1.2304 True ENSG00000006062 ENSG00000006062 HGNC:6853 MAP3K20 gene MAP3K20 Expert list;Expert Review Green Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Syndromic disease, MONDO:0002254, MAP3K20-related;Centronuclear myopathy 6 with fiber-type disproportion MIM#617760;Split-foot malformation with mesoaxial polydactyly MIM#616890 27816943;26755636;38451290 False 3 100;0;0 1.2304 True ENSG00000091436 ENSG00000091436 HGNC:17797 MAP3K3 gene MAP3K3 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cerebral cavernous malformations 5, MIM# 621032 33729480;35355835;33891857;36995941;10700190;25728774 False 3 100;0;0 1.2304 True Other ENSG00000198909 ENSG00000198909 HGNC:6855 MAP3K7 gene MAP3K7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cardiospondylocarpofacial syndrome 157800 AD;Frontometaphyseal dysplasia 2 617137 AD 27426734;27426733 False 3 100;0;0 1.2304 True Other ENSG00000135341 ENSG00000135341 HGNC:6859 MAP4K4 gene MAP4K4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted False 3 100;0;0 1.2304 True ENSG00000071054 ENSG00000071054 HGNC:6866 MAPK1 gene MAPK1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Noonan syndrome 13, MIM#619087;Global developmental delay;Intellectual disability;Behavioral abnormality;Growth delay;Abnormality of the face;Abnormality of the neck;Abnormality of the cardiovascular system;Abnormality of the skin 32721402 False 3 100;0;0 1.2304 True ENSG00000100030 ENSG00000100030 HGNC:6871 MAPK8IP3 gene MAPK8IP3 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with or without variable brain abnormalities OMIM# 605431 30612693 False 3 100;0;0 1.2304 True ENSG00000138834 ENSG00000138834 HGNC:6884 MAPKAPK5 gene MAPKAPK5 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurocardiofaciodigital syndrome, MIM# 619869 33442026 False 3 100;0;0 1.2304 True ENSG00000089022 ENSG00000089022 HGNC:6889 MAPKBP1 gene MAPKBP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Nephronophthisis 20, MIM# 617271;MONDO:0014997 28089251;33623699;32505465;32055034 False 3 100;0;0 1.2304 True ENSG00000137802 ENSG00000137802 HGNC:29536 MAPRE2 gene MAPRE2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Symmetric circumferential skin creases, congenital, 2, MIM# 616734 26637975 False 3 100;0;0 1.2304 True ENSG00000166974 ENSG00000166974 HGNC:6891 MARK2 gene MARK2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder MONDO:0700092 PMID: 39419027, 39436150 False 3 100;0;0 1.2304 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000072518 ENSG00000072518 HGNC:3332 MARS gene MARS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal "Interstitial lung and liver disease, MIM#615486;Charcot-Marie-Tooth disease, axonal, type 2U, MIM# 616280;Trichothiodystrophy 9, nonphotosensitive, MIM# 619692;Spastic paraplegia 70, autosomal recessive, MIM# 620323" 23729695;24354524;29655802;24103465;25913036;33909043;24482476;34585293 False 3 100;0;0 1.2304 True ENSG00000166986 ENSG00000166986 HGNC:6898 MARS2 gene MARS2 Australian Genomics Health Alliance Mitochondrial Flagship;Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 25, OMIM #616430;Spastic ataxia 3, autosomal recessive, OMIM #611390 25754315;16672289 False 3 100;0;0 1.2304 True ENSG00000247626 ENSG00000247626 HGNC:25133 MARVELD2 gene MARVELD2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 49, MIM# 610153 17186462;18084694;22903915;27344577;26677943;23979167 False 3 100;0;0 1.2304 True ENSG00000152939 ENSG00000152939 HGNC:26401 MASP1 gene MASP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal 3MC syndrome 1, MIM# 257920;MONDO:0009770 26789649;21258343;21035106 False 3 100;0;0 1.2304 True ENSG00000127241 ENSG00000127241 HGNC:6901 MAST1 gene MAST1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mega-corpus-callosum syndrome with cerebellar hypoplasia and cortical malformations;OMIM #618273 31721002;30449657 False 3 100;0;0 1.2304 True ENSG00000105613 ENSG00000105613 HGNC:19034 MAST3 gene MAST3 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 108, MIM#620115 34185323 False 3 100;0;0 1.2304 True ENSG00000099308 ENSG00000099308 HGNC:19036 MAST4 gene MAST4 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted neurodevelopmental disorder MONDO:0700092, MAST4-related 36910266;33057194 False 3 100;0;0 1.2304 True ENSG00000069020 ENSG00000069020 HGNC:19037 MAT1A gene MAT1A Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hypermethioninemia, persistent, autosomal dominant, due to methionine adenosyltransferase I/III deficiency MIM#250850;Methionine adenosyltransferase deficiency, autosomal recessive MIM#250850;Disorders of the metabolism of sulphur amino acids 27604308;7560086 False 3 100;0;0 1.2304 True ENSG00000151224 ENSG00000151224 HGNC:6903 MATN3 gene MATN3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Spondyloepimetaphyseal dysplasia, Borochowitz-Cormier-Daire type (MIM#608728);Epiphyseal dysplasia, multiple, 5 (MIM#607078) 31724101;32025536;11968079;14729835 False 3 100;0;0 1.2304 True ENSG00000132031 ENSG00000132031 HGNC:6909 MATR3 gene MATR3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 21, MIM# 606070;Distal myopathy 19344878;24686783;35205163;34659085;34173818;26493020 False 3 100;0;0 1.2304 True ENSG00000015479 ENSG00000015479 HGNC:6912 MAX gene MAX Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Pheochromocytoma, susceptibility to}, MIM# 171300;Polydactyly-macrocephaly syndrome, MIM# 620712 21685915;38141607 False 3 100;0;0 1.2304 True ENSG00000125952 ENSG00000125952 HGNC:6913 MB gene MB Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Myopathy, sarcoplasmic body MIM#620286 35527200;30918256 False 3 100;0;0 1.2304 True Other ENSG00000198125 ENSG00000198125 HGNC:6915 MBD5 gene MBD5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 1, MIM# 156200;MONDO:0007974 18812405;21981781;23708187;22726846;33912662 False 3 100;0;0 1.2304 True ENSG00000204406 ENSG00000204406 HGNC:20444 MBOAT7 gene MBOAT7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal intellectual disability MIM#617188 33335874;32645526;32744787;31852446;31282596;30701556 False 3 100;0;0 1.2304 True ENSG00000125505 ENSG00000125505 HGNC:15505 MBTPS1 gene MBTPS1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Skeletal dysplasia 32857899;32420688;30046013 False 3 100;0;0 1.2304 True ENSG00000140943 ENSG00000140943 HGNC:15456 MBTPS2 gene MBTPS2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Osteogenesis imperfecta, type XIX, (MIM301014);IFAP syndrome with or without BRESHECK syndrome (MIM#308205);Keratosis follicularis spinulosa decalvans, X-linked (MIM#308800);Olmsted syndrome, X-linked (MIM#300918) 27380894;19361614;21426410 False 3 100;0;0 1.2304 True ENSG00000012174 ENSG00000012174 HGNC:15455 MC2R gene MC2R Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Glucocorticoid deficiency, due to ACTH unresponsiveness, MIM# 202200 8094489;8227361 False 3 100;0;0 1.2304 True ENSG00000185231 ENSG00000185231 HGNC:6930 MC4R gene MC4R Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal {Obesity, resistence to (BMIQ20)} 618306;Obesity (BMIQ20) 618406 AD, AR 29970488 False 3 100;0;0 1.2304 True ENSG00000166603 ENSG00000166603 HGNC:6932 MCCC1 gene MCCC1 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal 3-Methylcrotonyl-CoA carboxylase 1 deficiency MIM#210200;Organic acidurias 27604308;11170888;31730530;36822454 False 3 100;0;0 1.2304 True ENSG00000078070 ENSG00000078070 HGNC:6936 MCCC2 gene MCCC2 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal 3-Methylcrotonyl-CoA carboxylase 2 deficiency MIM#210210;Organic acidurias 27604308;11181649;31730530 False 3 100;0;0 1.2304 True ENSG00000131844 ENSG00000131844 HGNC:6937 MCEE gene MCEE Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Methylmalonyl-CoA epimerase deficiency MIM#251120;Organic acidurias 27604308;16752391;32521958;31146325;32719376;30682498 False 3 100;0;0 1.2304 True ENSG00000124370 ENSG00000124370 HGNC:16732 MCFD2 gene MCFD2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Factor V and factor VIII, combined deficiency of, MIM# 613625;MONDO:0013331 12717434;16304051;18391077 False 3 100;0;0 1.2304 True ENSG00000180398 ENSG00000180398 HGNC:18451 MCIDAS gene MCIDAS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 42 (MIM#618695) 25048963 False 3 100;0;0 1.2304 True ENSG00000234602 ENSG00000234602 HGNC:40050 MCM3AP gene MCM3AP Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Peripheral neuropathy, autosomal recessive, with or without impaired intellectual development, MIM#618124 24123876;28633435;28969388;29982295;32202298 False 3 100;0;0 1.2304 True ENSG00000160294 ENSG00000160294 HGNC:6946 MCM6 gene MCM6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, MCM6-related;Lactase persistence/nonpersistence 223100 37198333 False 3 50;0;50 1.2304 True ENSG00000076003 ENSG00000076003 HGNC:6949 MCM8 gene MCM8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Premature ovarian failure 10, MIM# 612885 25437880;25873734 False 3 100;0;0 1.2304 True ENSG00000125885 ENSG00000125885 HGNC:16147 MCM9 gene MCM9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ovarian dysgenesis 4, MIM# 616185;Hereditary neoplastic syndrome MONDO:0015356 25480036;26771056;33538981;33095795;26806154;34556653;32841224;32613604;37378315 False 3 100;0;0 1.2304 True ENSG00000111877 ENSG00000111877 HGNC:21484 MCOLN1 gene MCOLN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mucolipidosis IV, MIM# 252650;MONDO:0009653;Lisch epithelial corneal dystrophy, OMIM# 620763 17239335;25156245;33965501;35205297;37972748 False 3 100;0;0 1.2304 True ENSG00000090674 ENSG00000090674 HGNC:13356 MCPH1 gene MCPH1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephaly 1, primary, autosomal recessive, MIM# 251200;MONDO:0009617 12046007;15199523;16311745;20978018;32294449;30351297;29026105 False 3 100;0;0 1.2304 True ENSG00000147316 ENSG00000147316 HGNC:6954 MCTS1 gene MCTS1 Expert Review Green;Literature Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females "Immunodeficiency 118, mycobacteriosis, MIM# 301115" 37875108 False 3 100;0;0 1.2304 True ENSG00000232119 ENSG00000232119 HGNC:23357 MDFIC gene MDFIC Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Lymphatic malformation 12, MIM# 620014 35235341 False 3 100;0;0 1.2304 True ENSG00000135272 ENSG00000135272 HGNC:28870 MDH2 gene MDH2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 51 MIM#617339 34766628;27989324 False 3 100;0;0 1.2304 True ENSG00000146701 ENSG00000146701 HGNC:6971 MECOM gene MECOM Expert Review;Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Radioulnar synostosis with amegakaryocytic thrombocytopenia 2, MIM#616738 26581901 False 3 100;0;0 1.2304 True ENSG00000085276 ENSG00000085276 HGNC:3498 MECP2 gene MECP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Rett syndrome, MIM# 312750;Intellectual developmental disorder, X-linked, syndromic 13, MIM# 300055;Encephalopathy, neonatal severe, MIM# 300673 32469049 False 3 100;0;0 1.2304 True ENSG00000169057 ENSG00000169057 HGNC:6990 MECR gene MECR Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Dystonia, childhood-onset, with optic atrophy and basal ganglia abnormalities, MIM# 617282;MONDO:0015003;Optic atrophy 16, MIM# 620629 27817865;33401012;31137067;31070877 False 3 100;0;0 1.2304 True ENSG00000116353 ENSG00000116353 HGNC:19691 MED11 gene MED11 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodegeneration with developmental delay, early respiratory failure, myoclonic seizures, and brain abnormalities, MIM# 620327 36001086 False 3 100;0;0 1.2304 True ENSG00000161920 ENSG00000161920 HGNC:32687 MED12 gene MED12 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Ohdo syndrome, X-linked MIM#300895;Lujan-Fryns syndrome MIM#309520;Opitz-Kaveggia syndrome MIM#305450;Hardikar syndrome, MIM# 301068 33244166;32174975;30006928;27312080;33244166 False 3 100;0;0 1.2304 True ENSG00000184634 ENSG00000184634 HGNC:11957 MED12L gene MED12L Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, MED12L-related;Intellectual disability;Seizures;Autism 31155615 False 3 100;0;0 1.2304 True ENSG00000144893 ENSG00000144893 HGNC:16050 MED13 gene MED13 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder, autosomal dominant 61, MIM# 618009 29740699 False 3 100;0;0 1.2304 True ENSG00000108510 ENSG00000108510 HGNC:22474 MED13L gene MED13L Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation and distinctive facial features with or without cardiac defects 616789;Transposition of the great arteries, dextro-looped 1 608808 29511999 False 3 100;0;0 1.2304 True ENSG00000123066 ENSG00000123066 HGNC:22962 MED16 gene MED16 Expert Review Green;Other Mendeliome BIALLELIC, autosomal or pseudoautosomal complex neurodevelopmental disorder MONDO:0100038 False 3 100;0;0 1.2304 True ENSG00000175221 ENSG00000175221 HGNC:17556 MED17 gene MED17 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephaly, postnatal progressive, with seizures and brain atrophy, MIM#613668 30345598 False 3 100;0;0 1.2304 True ENSG00000042429 ENSG00000042429 HGNC:2375 MED23 gene MED23 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Intellectual developmental disorder, autosomal recessive 18, with or without epilepsy, MIM# 614249 21868677;25845469;27311965;30847200;31164858 False 3 100;0;0 1.2304 True ENSG00000112282 ENSG00000112282 HGNC:2372 MED25 gene MED25 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Basel-Vanagait-Smirin-Yosef syndrome, MIM# 616449;Congenital cataract-microcephaly-naevus flammeus syndrome MONDO:0014643 25792360;32816121 False 3 50;0;50 1.2304 True ENSG00000104973 ENSG00000104973 HGNC:28845 MED27 gene MED27 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with spasticity, cataracts, and cerebellar hypoplasia, MIM# 619286 33443317 False 3 100;0;0 1.2304 True ENSG00000160563 ENSG00000160563 HGNC:2377 MEF2C gene MEF2C Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Chromosome 5q14.3 deletion syndrome, 613443;Mental retardation, stereotypic movements, epilepsy, and/or cerebral malformations, 613443;MONDO:0013266 19876902;19471318;19592390;19592390;20513142;34055696;34022131 False 3 100;0;0 1.2304 True ENSG00000081189 ENSG00000081189 HGNC:6996 MEFV gene MEFV Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Familial Mediterranean fever MIM# 249100 False 3 100;0;0 1.2304 True ENSG00000103313 ENSG00000103313 HGNC:6998 MEGF10 gene MEGF10 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Myopathy, areflexia, respiratory distress, and dysphagia, early-onset, MIM# 614399 22101682;22371254;30802937 False 3 100;0;0 1.2304 True ENSG00000145794 ENSG00000145794 HGNC:29634 MEGF8 gene MEGF8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Carpenter syndrome, MIM#614976 23063620 False 3 100;0;0 1.2304 True ENSG00000105429 ENSG00000105429 HGNC:3233 MEI4 gene MEI4 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Infertility disorder, MONDO:0005047, MEI4-related 38252283 False 3 100;0;0 1.2304 True ENSG00000269964 ENSG00000269964 HGNC:43638 MEIOB gene MEIOB Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Spermatogenic failure 22 MIM#617706;Premature ovarian failure 23, MIM# 620686 34794894;24068956;31000419;28206990;35991565;34392356;31000419 False 3 100;0;0 1.2304 True ENSG00000162039 ENSG00000162039 HGNC:28569 MEIS2 gene MEIS2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cleft palate, cardiac defects, and mental retardation (MIM#600987) 33427397;25712757 False 3 100;0;0 1.2304 True ENSG00000134138 ENSG00000134138 HGNC:7001 MEOX1 gene MEOX1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Klippel-Feil syndrome 2, OMIM:214300;Klippel-Feil syndrome 2, autosomal recessive, MONDO:0008958 24073994;23290072 False 3 100;0;0 1.2304 True ENSG00000005102 ENSG00000005102 HGNC:7013 MERTK gene MERTK Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Retinitis pigmentosa 38, MIM# 613862 11062461;17301963;20300561;22180149 False 3 100;0;0 1.2304 True ENSG00000153208 ENSG00000153208 HGNC:7027 MESD gene MESD Expert Review Green;Other Mendeliome BIALLELIC, autosomal or pseudoautosomal "Osteogenesis imperfecta, type XX, MIM# 618644" 31564437 False 3 100;0;0 1.2304 True ENSG00000117899 ENSG00000117899 HGNC:13520 MESP2 gene MESP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spondylocostal dysostosis 2, autosomal recessive (MIM#608681) 18485326 False 3 100;0;0 1.2304 True ENSG00000188095 ENSG00000188095 HGNC:29659 MET gene MET Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Arthrogryposis, distal, type 11 (MIM#620019), AD;Renal cell carcinoma, papillary, 1, familial and somatic, MIM# 605074;Papillary renal cell carcinoma MONDO:0017884 30777867 False 3 100;0;0 1.2304 True ENSG00000105976 ENSG00000105976 HGNC:7029 METTL23 gene METTL23 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Intellectual developmental disorder, autosomal recessive 44, MIM# 615942 24501276;24626631 False 3 50;50;0 1.2304 True ENSG00000181038 ENSG00000181038 HGNC:26988 METTL5 gene METTL5 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Intellectual developmental disorder, autosomal recessive 72, MIM# 618665" 29302074;31564433 False 3 100;0;0 1.2304 True ENSG00000138382 ENSG00000138382 HGNC:25006 MFF gene MFF Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Encephalopathy due to defective mitochondrial and peroxisomal fission 2, MIM# 617086 22499341;26783368;32181496 False 3 100;0;0 1.2304 True ENSG00000168958 ENSG00000168958 HGNC:24858 MFN2 gene MFN2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, axonal, type 2A2A 609260;Charcot-Marie-Tooth disease, axonal, type 2A2B, MIM# 617087;Hereditary motor and sensory neuropathy VIA, MIM# 601152;Lipomatosis, multiple symmetric, with or without peripheral neuropathy, MIM# 151800 15064763;15549395;16437557;20008656 False 3 100;0;0 1.2304 True ENSG00000116688 ENSG00000116688 HGNC:16877 MFRP gene MFRP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microphthalmia, isolated 5, MIM# 611040 17167404;18554571;20361016 False 3 100;0;0 1.2304 True ENSG00000235718 ENSG00000235718 HGNC:18121 MFSD2A gene MFSD2A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephaly 15, primary, autosomal recessive, MIM# 616486 26005865;26005868;24828044 False 3 100;0;0 1.2304 True ENSG00000168389 ENSG00000168389 HGNC:25897 MFSD8 gene MFSD8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 7, MIM# 610951;MONDO:0012588;Macular dystrophy with central cone involvement, MIM# 616170;MONDO:0014515 31006324;17564970;19201763;25227500 False 3 100;0;0 1.2304 True ENSG00000164073 ENSG00000164073 HGNC:28486 MGAT2 gene MGAT2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IIa, MIM# 212066;MGAT2-CDG, MONDO:0008908 8808595;11228641;22105986;33044030;31420886 False 3 100;0;0 1.2304 True ENSG00000168282 ENSG00000168282 HGNC:7045 MGME1 gene MGME1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 11, MIM# 615084 23313956;29572490;28711739 False 3 100;0;0 1.2304 True ENSG00000125871 ENSG00000125871 HGNC:16205 MGP gene MGP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Keutel syndrome, MIM #245150;Skeletal dysplasia MONDO:0018230, MGP-related 9916809;15810001;33996798;37675773 False 3 100;0;0 1.2304 True ENSG00000111341 ENSG00000111341 HGNC:7060 MICU1 gene MICU1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Myopathy with extrapyramidal signs, MIM# 615673 24336167;29721912;32395406 False 3 100;0;0 1.2304 True ENSG00000107745 ENSG00000107745 HGNC:1530 MID1 gene MID1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Opitz GBBB syndrome, type I (MIM#300000) 1103076;9354791 False 3 100;0;0 1.2304 True ENSG00000101871 ENSG00000101871 HGNC:7095 MINPP1 gene MINPP1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 16, MIM# 619527 33257696 False 3 100;0;0 1.2304 True ENSG00000107789 ENSG00000107789 HGNC:7102 MIP gene MIP Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cataract 15, multiple types, MIM# 615274 10802646;16564824;33530927;30214549 False 3 100;0;0 1.2304 True ENSG00000135517 ENSG00000135517 HGNC:7103 MIPEP gene MIPEP Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Combined oxidative phosphorylation deficiency 31, MIM# 617228" 27799064 False 3 100;0;0 1.2304 True ENSG00000027001 ENSG00000027001 HGNC:7104 MIR140 gene MIR140 Expert Review;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spondyloepiphyseal dysplasia, Nishimura type, MIM# 618618" 30804514;31633310 False 3 100;0;0 1.2304 True ENSG00000208017 ENSG00000208017 HGNC:31527 MIR17HG gene MIR17HG Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Feingold syndrome 2;OMIM #614326 25391829;21892160 False 3 100;0;0 1.2304 True ENSG00000215417 ENSG00000215417 HGNC:23564 MIR184 gene MIR184 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted EDICT syndrome, MIM# 614303 21996275;22131394;25373792;24138095 False 3 100;0;0 1.2304 True ENSG00000207695 ENSG00000207695 HGNC:31555 MITF gene MITF Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal COMMAD syndrome, MIM# 617306;Tietz albinism-deafness syndrome, MIM# 103500;Waardenburg syndrome, type 2A, MIM# 193510 27889061;32541011 False 3 100;0;0 1.2304 True ENSG00000187098 ENSG00000187098 HGNC:7105 MKKS gene MKKS Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 6 (MIM#605231);McKusick-Kaufman syndrome, MIM# 236700;Retinitis pigmentosa 10802661;26900326;10973251;15637713 False 3 67;33;0 1.2304 True ENSG00000125863 ENSG00000125863 HGNC:7108 MKRN3 gene MKRN3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Precocious puberty, central, 2, MIM# 615346 31687022;31041429;31636607;32480405 False 3 100;0;0 1.2304 True ENSG00000179455 ENSG00000179455 HGNC:7114 MKS1 gene MKS1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 28, MIM# 617121;MONDO:0014928;Meckel syndrome 1, MIM# 249000;MONDO:0009571;Bardet-Biedl syndrome 13, MIM# 615990;MONDO:0014441 17377820;24886560;19776033;33193692;27570071;27377014;18327255;24608809 False 3 100;0;0 1.2304 True ENSG00000011143 ENSG00000011143 HGNC:7121 MLC1 gene MLC1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Megalencephalic leukoencephalopathy with subcortical cysts (MIM#604004) 11254442;18757878;16652334 False 3 100;0;0 1.2304 True ENSG00000100427 ENSG00000100427 HGNC:17082 MLIP gene MLIP Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Myopathy with myalgia, increased serum creatine kinase, and with or without episodic rhabdomyolysis, MIM# 620138 34581780 False 3 100;0;0 1.2304 True ENSG00000146147 ENSG00000146147 HGNC:21355 MLPH gene MLPH Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Griscelli syndrome, type 3, MIM# 609227 12897212;32864751;31721180 False 3 100;0;0 1.2304 True ENSG00000115648 ENSG00000115648 HGNC:29643 MLYCD gene MLYCD Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Malonyl-CoA decarboxylase deficiency, MIM# 248360 12955715 False 3 100;0;0 1.2304 True ENSG00000103150 ENSG00000103150 HGNC:7150 MMAA gene MMAA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Methylmalonic aciduria, vitamin B12-responsive, cblA type, MIM# 251100 False 3 100;0;0 1.2304 True ENSG00000151611 ENSG00000151611 HGNC:18871 MMAB gene MMAB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Methylmalonic aciduria, vitamin B12-responsive, cblB type, MIM# 251110 False 3 100;0;0 1.2304 True ENSG00000139428 ENSG00000139428 HGNC:19331 MMACHC gene MMACHC Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Methylmalonic aciduria and homocystinuria, cblC type MIM#277400;Disorders of cobalamin absorption, transport and metabolism 27604308;16311595 False 3 100;0;0 1.2304 True ENSG00000132763 ENSG00000132763 HGNC:24525 MMADHC gene MMADHC Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Homocystinuria, cblD type, variant 1 MIM#277410;Methylmalonic aciduria and homocystinuria, cblD type MIM#277410;Methylmalonic aciduria, cblD type, variant 2 MIM#277410;Disorders of cobalamin absorption, transport and metabolism 27604308;18385497 False 3 100;0;0 1.2304 True ENSG00000168288 ENSG00000168288 HGNC:25221 MME gene MME Expert Review Green;GeneReviews;Royal Melbourne Hospital;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Charcot-Marie-Tooth disease, axonal, type 2T, MIM# 617017;MONDO:0014866;Spinocerebellar ataxia 43 MIM#617018 26991897;27588448;33144514;31429185;27583304 False 3 50;0;50 1.2304 True ENSG00000196549 ENSG00000196549 HGNC:7154 MMP13 gene MMP13 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Metaphyseal anadysplasia 1 (MIM#602111);Metaphyseal dysplasia, Spahr type (MIM#250400);?Spondyloepimetaphyseal dysplasia, Missouri type (MIM#602111) 19615667;24781753;24648384 False 3 100;0;0 1.2304 True Other ENSG00000137745 ENSG00000137745 HGNC:7159 MMP2 gene MMP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Multicentric osteolysis, nodulosis, and arthropathy, MIM# 259600 11431697;15691365;17059372;17400654 False 3 100;0;0 1.2304 True ENSG00000087245 ENSG00000087245 HGNC:7166 MMP20 gene MMP20 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Amelogenesis imperfecta, type IIA2 MIM#612529 15744043;33600052 False 3 100;0;0 1.2304 True ENSG00000137674 ENSG00000137674 HGNC:7167 MMP21 gene MMP21 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Heterotaxy, visceral, 7, autosomal,MIM# 616749 26429889;26437028;26437029 False 3 100;0;0 1.2304 True ENSG00000154485 ENSG00000154485 HGNC:14357 MMP9 gene MMP9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Metaphyseal anadysplasia 2, MIM# 613073 19615667;28342220;34407464 False 3 100;0;0 1.2304 True ENSG00000100985 ENSG00000100985 HGNC:7176 MN1 gene MN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted CEBALID syndrome, MIM#618774;Intellectual disability;dysmophic features;rhombencephalosynapsis 31834374;31839203 False 3 100;0;0 1.2304 True Other ENSG00000169184 ENSG00000169184 HGNC:7180 MNS1 gene MNS1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Heterotaxy;male infertility;Heterotaxy, visceral, 9, autosomal, with male infertility, MIM# 618948 31534215;30148830 False 3 100;0;0 1.2304 True ENSG00000138587 ENSG00000138587 HGNC:29636 MNX1 gene MNX1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Currarino syndrome, MIM# 176450;Permanent neonatal diabetes mellitus, MONDO:0100164, MNX1-related 32571425;33836786;11528505 False 3 100;0;0 1.2304 True ENSG00000130675 ENSG00000130675 HGNC:4979 MOCOS gene MOCOS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Xanthinuria type II, MIM#603592 11302742;17368066;14624414;25967871;34356852;32073534;30758870;27919260 False 3 100;0;0 1.2304 True ENSG00000075643 ENSG00000075643 HGNC:18234 MOCS1 gene MOCS1 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Molybdenum cofactor deficiency A, MIM# 252150 21031595;9921896;12754701;27604308;9731530 False 3 100;0;0 1.2304 True ENSG00000124615 ENSG00000124615 HGNC:7190 MOCS2 gene MOCS2 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Molybdenum cofactor deficiency B MIM#252160;Disorders of molybdenum cofactor metabolism 27604308;10053004 False 3 100;0;0 1.2304 True ENSG00000164172 ENSG00000164172 HGNC:7193 MOGS gene MOGS Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IIb 606056 31925597;30587846;33058492 False 3 100;0;0 1.2304 True ENSG00000115275 ENSG00000115275 HGNC:24862 MORC2 gene MORC2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Charcot-Marie-Tooth disease, axonal, type 2Z, MIM# 616688;Developmental delay, impaired growth, dysmorphic facies, and axonal neuropathy, MIM# 619090" 32693025;26497905;26659848 False 3 50;0;50 1.2304 True ENSG00000133422 ENSG00000133422 HGNC:23573 MOS gene MOS Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Infertility disorder, MONDO:0005047, MOS-related;Early embryonic arrest and fragmentation PMID: 34779126;PMID: 34997960;PMID: 36403623;PMID: 35670744 False 3 100;0;0 1.2304 True ENSG00000172680 ENSG00000172680 HGNC:7199 MPC1 gene MPC1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial pyruvate carrier deficiency, MIM# 614741 22628558;34873722 False 3 100;0;0 1.2304 True ENSG00000060762 ENSG00000060762 HGNC:21606 MPDU1 gene MPDU1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type If, MIM# 609180;MPDU1-CDG, MONDO:0012211 11733564;11733556;31741824;29721919 False 3 100;0;0 1.2304 True ENSG00000129255 ENSG00000129255 HGNC:7207 MPDZ gene MPDZ Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hydrocephalus, congenital, 2, with or without brain or eye anomalies, MIM# 615219 28556411;23240096;30518636;29499638 False 3 50;50;0 1.2304 True ENSG00000107186 ENSG00000107186 HGNC:7208 MPEG1 gene MPEG1 Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Immunodeficiency 77, MIM# 619223" 33224153;33692780;28422754 False 3 100;0;0 1.2304 True ENSG00000197629 ENSG00000197629 HGNC:29619 MPI gene MPI Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Ib, MIM# 602579;MPI-CDG MONDO:0011257 12414827;9585601;10980531;33098580;33204592;32905087;32266963;30242110 False 3 100;0;0 1.2304 True ENSG00000178802 ENSG00000178802 HGNC:7216 MPIG6B gene MPIG6B Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Thrombocytopenia, anemia, and myelofibrosis, MIM# 617441" 31276734;29898956;27743390 False 3 100;0;0 1.2304 True ENSG00000204420 ENSG00000204420 HGNC:13937 MPL gene MPL Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Myelofibrosis with myeloid metaplasia, somatic, MIM#254450;Thrombocythemia 2, MIM#601977, AD, SMu;Thrombocytopenia, congenital amegakaryocytic, MIM#604498, AR 28955303;26423830 False 3 100;0;0 1.2304 True ENSG00000117400 ENSG00000117400 HGNC:7217 MPLKIP gene MPLKIP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Trichothiodystrophy 4, nonphotosensitive, MIM# 234050;MONDO:0021013 15645389;16977596 False 3 100;0;0 1.2304 True ENSG00000168303 ENSG00000168303 HGNC:16002 MPP5 gene MPP5 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Global developmental delay;Intellectual disability;Delayed speech and language development;Developmental regression;Behavioral abnormality 33073849 False 3 100;0;0 1.2304 True ENSG00000072415 ENSG00000072415 HGNC:18669 MPV17 gene MPV17 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, axonal, type 2EE, MIM# 618400 22508010;26437932;30298599 False 3 100;0;0 1.2304 True ENSG00000115204 ENSG00000115204 HGNC:7224 MPZ gene MPZ Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot Marie Tooth disease, dominant intermediate D, 60779;Neuropathy, congenital hypomyelinating, 605253;Charcot Marie Tooth disease, type 2J, 607736;Dejerine Sottas disease, 145900;Charcot Marie Tooth disease, type 1B, 118200;Charcot Marie Tooth disease, type 2I, 607677;HMSN 19293842 False 3 100;0;0 1.2304 True ENSG00000158887 ENSG00000158887 HGNC:7225 MPZL2 gene MPZL2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 111, MIM#618145 29982980;29961571 False 3 100;0;0 1.2304 True ENSG00000149573 ENSG00000149573 HGNC:3496 MRAP gene MRAP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Glucocorticoid deficiency 2, MIM# 607398 15654338 False 3 100;0;0 1.2304 True ENSG00000170262 ENSG00000170262 HGNC:1304 MRAS gene MRAS Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Noonan syndrome 11, MIM#618499 28289718;31173466;31108500;31173466 False 3 100;0;0 1.2304 True ENSG00000158186 ENSG00000158186 HGNC:7227 MRE11 gene MRE11 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ataxia-telangiectasia-like disorder 1, MIM# 604391;MONDO:0024557 10612394;11371508;15269180;22863007;24332946;21227757 False 3 100;0;0 1.2304 True ENSG00000020922 ENSG00000020922 HGNC:7230 MRM2 gene MRM2 Expert Review Green;NHS GMS Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 17, MIM# 618567 28973171 False 3 100;0;0 1.2304 True ENSG00000122687 ENSG00000122687 HGNC:16352 MRPL3 gene MRPL3 Australian Genomics Health Alliance Mitochondrial Flagship;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 9;OMIM #614582 27815843;21786366 False 3 100;0;0 1.2304 True ENSG00000114686 ENSG00000114686 HGNC:10379 MRPL39 gene MRPL39 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency-59 (COXPD59), MIM#620646 PMID: 37133451 False 3 100;0;0 1.2304 True ENSG00000154719 ENSG00000154719 HGNC:14027 MRPL44 gene MRPL44 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 16, MIM# 615395 23315540;25797485 False 3 100;0;0 1.2304 True ENSG00000135900 ENSG00000135900 HGNC:16650 MRPL49 gene MRPL49 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial disease, MONDO:0044970, MRPL49-related 39417135 False 3 100;0;0 1.2304 True ENSG00000149792 ENSG00000149792 HGNC:1176 MRPS2 gene MRPS2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 36, MIM# 617950 29576219;34991560 False 3 100;0;0 1.2304 True ENSG00000122140 ENSG00000122140 HGNC:14495 MRPS22 gene MRPS22 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 5 MIM#611719;Ovarian dysgenesis 7 MIM#618117 29566152 False 3 100;0;0 1.2304 True ENSG00000175110 ENSG00000175110 HGNC:14508 MRPS23 gene MRPS23 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hepatic disease;Combined respiratory chain complex deficiencies;Hepatic disease;Combined respiratory chain complex deficiencies;Cardiomyopathy;Tubulopathy;Lactic acidosis;Structural brain abnormalities;Combined oxidative phosphorylation deficiency 45, MIM#618951 26741492;17873122;25663021;28752220 False 3 100;0;0 1.2304 True ENSG00000181610 ENSG00000181610 HGNC:14509 MRPS34 gene MRPS34 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 32, 61766 28777931 False 3 100;0;0 1.2304 True ENSG00000074071 ENSG00000074071 HGNC:16618 MSH3 gene MSH3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Familial adenomatous polyposis 4 , MIM#617100 27476653;10706084;34843512 False 3 100;0;0 1.2304 True ENSG00000113318 ENSG00000113318 HGNC:7326 MSH4 gene MSH4 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Primary ovarian insufficiency;azoospermia 34794894;10809667;12478991;28541421;32741963;33437391;34755185;33448284 False 3 100;0;0 1.2304 True ENSG00000057468 ENSG00000057468 HGNC:7327 MSH5 gene MSH5 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Spermatogenic failure 74, MIM# 619937;Premature ovarian failure 13, MIM#617442 28175301;9916805;24970489 False 3 100;0;0 1.2304 True ENSG00000204410 ENSG00000204410 HGNC:7328 MSL2 gene MSL2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Karayol-Borroto-Haghshenas neurodevelopmental syndrome, MIM# 620985 31332282;33057194;38815585;38702431 False 3 67;33;0 1.2304 True ENSG00000174579 ENSG00000174579 HGNC:25544 MSL3 gene MSL3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Basilicata-Akhtar syndrome, OMIM # 301032 33173220 False 3 100;0;0 1.2304 True ENSG00000005302 ENSG00000005302 HGNC:7370 MSMO1 gene MSMO1 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephaly, congenital cataract, and psoriasiform dermatitis, MIM# 616834;MONDO:0014793;Disorders of the metabolism of sterols 27604308;21285510;24144731;33161406;28673550;33161406 False 3 100;0;0 1.2304 True ENSG00000052802 ENSG00000052802 HGNC:10545 MSN gene MSN Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Immunodeficiency 50, MIM# 300988 27405666 False 3 100;0;0 1.2304 True ENSG00000147065 ENSG00000147065 HGNC:7373 MSRB3 gene MSRB3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 74, MIM# 613718 19650862;24191262;21185009 False 3 100;0;0 1.2304 True ENSG00000174099 ENSG00000174099 HGNC:27375 MSTO1 gene MSTO1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Myopathy, mitochondrial, and ataxia, OMIM:617675;Mitochondrial myopathy-cerebellar ataxia-pigmentary retinopathy syndrome, MONDO:0044714 28554942;28544275;31604776;31463572;31130378;30684668;29339779 False 3 100;0;0 1.2304 True ENSG00000125459 ENSG00000125459 HGNC:29678 MSX1 gene MSX1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Witkop syndrome (Ectodermal Dysplasia) (MIM: 189500),Cleft Lip+/- Cleft Palate (Rofacial Cleft- MIM :608874), Oligodontia 33419968;33708320;32192766 False 3 100;0;0 1.2304 True ENSG00000163132 ENSG00000163132 HGNC:7391 MSX2 gene MSX2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Craniosynostosis 2 (MIM#604757);Parietal foramina 1 (MIM#168500);Parietal foramina with cleidocranial dysplasia (MIM#168550) 23949913;27884935;23918290;2359311;22948472;19533795;10742103;14571277 False 3 100;0;0 1.2304 True ENSG00000120149 ENSG00000120149 HGNC:7392 MTCL1 gene MTCL1 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal slowly progressive cerebellar ataxia;mild intellectual disability;seizures;episodic pain;spinocerebellar ataxia 30548255;28283581 False 3 100;0;0 1.2304 True ENSG00000168502 ENSG00000168502 HGNC:29121 MTFMT gene MTFMT Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 15, MIM# 614947;Mitochondrial complex I deficiency, nuclear type 27, MIM# 618248 21907147;23499752;24461907;22499348 False 3 100;0;0 1.2304 True ENSG00000103707 ENSG00000103707 HGNC:29666 MTHFD1 gene MTHFD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined immunodeficiency and megaloblastic anemia with or without hyperhomocysteinaemia MIM # 617780 32414565;19033438 False 3 100;0;0 1.2304 True ENSG00000100714 ENSG00000100714 HGNC:7432 MTHFR gene MTHFR Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Homocystinuria due to MTHFR deficiency MIM#236250;Disorders of folate metabolism and transport 27604308;7920641 False 3 100;0;0 1.2304 True ENSG00000177000 ENSG00000177000 HGNC:7436 MTHFS gene MTHFS Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly, epilepsy, and hypomyelination, 618367 30031689;31844630;22303332 False 3 100;0;0 1.2304 True ENSG00000136371 ENSG00000136371 HGNC:7437 MTM1 gene MTM1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Myopathy, centronuclear, X-linked, MIM# 310400 10790201 False 3 100;0;0 1.2304 True ENSG00000171100 ENSG00000171100 HGNC:7448 MTMR2 gene MTMR2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, type 4B1, 601382;MONDO:0011066 10802647;16249189;33653949;32586600;32488727;31680794 False 3 100;0;0 1.2304 True ENSG00000087053 ENSG00000087053 HGNC:7450 MTO1 gene MTO1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 10, OMIM #614702 26061759;29331171;23929671 False 3 100;0;0 1.2304 True ENSG00000135297 ENSG00000135297 HGNC:19261 MTOR gene MTOR Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Smith-Kingsmore syndrome, MIM# 616638;Focal cortical dysplasia, type II, somatic, MIM# 607341;Overgrowth syndrome and/or cerebral malformations due to abnormalities in MTOR pathway genes, MONDO:0100283 28892148;25878179;26018084 False 3 100;0;0 1.2304 True Other ENSG00000198793 ENSG00000198793 HGNC:3942 MTPAP gene MTPAP Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 4, autosomal recessive 613672;Lethal encephalopathy 20970105;25008111;26319014;31779033 False 3 50;50;0 1.2304 True ENSG00000107951 ENSG00000107951 HGNC:25532 MTR gene MTR Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940 8968736;8968737;9683607;12068375;8968735;27604308 False 3 100;0;0 1.2304 True ENSG00000116984 ENSG00000116984 HGNC:7468 MTRR gene MTRR Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Homocystinuria-megaloblastic anaemia, cbl E type, MIM# 236270 12555939;15714522 False 3 100;0;0 1.2304 True ENSG00000124275 ENSG00000124275 HGNC:7473 MTSS1L gene MTSS1L Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Intellectual developmental disorder with ocular anomalies and distinctive facial features MIM#620086" PMID: 36067766 False 3 100;0;0 1.2304 True ENSG00000132613 ENSG00000132613 HGNC:25094 MTTP gene MTTP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Abetalipoproteinaemia, MIM# 200100 17275380;34078172;34052173;33258201 False 3 100;0;0 1.2304 True ENSG00000138823 ENSG00000138823 HGNC:7467 MTX2 gene MTX2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Mandibuloacral dysplasia progeroid syndrome, MIM# 619127;Mandibuloacral dysplasia;lipodystrophy;arterial calcification 32917887 False 3 100;0;0 1.2304 True ENSG00000128654 ENSG00000128654 HGNC:7506 MUC1 gene MUC1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Medullary cystic kidney disease 1 (MIM#174000) 29186029;29156055;29520014 False 3 50;0;50 1.2304 True ENSG00000185499 ENSG00000185499 HGNC:7508 MUSK gene MUSK Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Fetal akinesia deformation sequence 1, MIM# 208150;MONDO:0100101;Myasthenic syndrome, congenital, 9, associated with acetylcholine receptor deficiency, MIM# 616325;MONDO:0014587 25537362;25612909;8653786;31750350;15496425;19949040;20371544;32253145 False 3 100;0;0 1.2304 True ENSG00000030304 ENSG00000030304 HGNC:7525 MUT gene MUT Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Methylmalonic aciduria, mut(0) type, MIM# 251000 1977311;11528502;12948746 False 3 100;0;0 1.2304 True ENSG00000146085 ENSG00000146085 HGNC:7526 MVD gene MVD Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Porokeratosis 7, multiple types, MIM# 614714;Nonsyndromic genetic hearing loss MONDO:0019497, MVD-related, AR 30942823;33491095;34135477 False 3 50;0;50 1.2304 True ENSG00000167508 ENSG00000167508 HGNC:7529 MVK gene MVK Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mevalonic aciduria MIM# 610377 12563048;10401001;28095071 False 3 100;0;0 1.2304 True ENSG00000110921 ENSG00000110921 HGNC:7530 MYBBP1A gene MYBBP1A Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Hydrops fetalis, MONDO:0015193, MYBBP1A-related 39191491;28425981 False 3 100;0;0 1.2304 True ENSG00000132382 ENSG00000132382 HGNC:7546 MYBPC1 gene MYBPC1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Arthrogryposis, distal, type 1B 614335;Lethal congenital contracture syndrome 4, MIM# 614915;Myopathy, congenital, with tremor MIM#618524 20045868;22610851;23873045;26661508;31264822;31025394 False 3 100;0;0 1.2304 True ENSG00000196091 ENSG00000196091 HGNC:7549 MYCBP2 gene MYCBP2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, MYCBP2-related;corpus callosum abnormalities PMID: 36200388 False 3 100;0;0 1.2304 True ENSG00000005810 ENSG00000005810 HGNC:23386 MYCN gene MYCN Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder (MONDO:0700092), MYCN-related;Feingold syndrome 1 MIM#164280 21224895;8470948;30573562;37710961 False 3 75;0;25 1.2304 True ENSG00000134323 ENSG00000134323 HGNC:7559 MYD88 gene MYD88 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 68, MIM# 612260 18669862;20538326;31301515 False 3 100;0;0 1.2304 True ENSG00000172936 ENSG00000172936 HGNC:7562 MYF5 gene MYF5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ophthalmoplegia, external, with rib and vertebral anomalies, OMIM 61855 29887215;15386014;1423602;9268580;8918877 False 3 100;0;0 1.2304 True ENSG00000111049 ENSG00000111049 HGNC:7565 MYH10 gene MYH10 Expert list;Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted AD complex neurodevelopmental disorder with or without congenital anomalies (MONDO:0100465) 24825879;24901346;25356899;22495309;25003005 False 3 100;0;0 1.2304 True ENSG00000133026 ENSG00000133026 HGNC:7568 MYH14 gene MYH14 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Deafness, autosomal dominant 4A, MIM# 600652;Peripheral neuropathy, myopathy, hoarseness, and hearing loss 614369 15015131;25719458;31045651;28221712;34681017;21480433;31653586;31631044;31231018 False 3 100;0;0 1.2304 True ENSG00000105357 ENSG00000105357 HGNC:23212 MYH2 gene MYH2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Proximal myopathy and ophthalmoplegia, MIM# 605637 20418530;15548556;24193343;11114175;23489661;32578970;29934118;28729039;27490141;27177998 False 3 100;0;0 1.2304 True ENSG00000125414 ENSG00000125414 HGNC:7572 MYH3 gene MYH3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Arthrogryposis, distal, type 2A (Freeman-Sheldon) 193700;Arthrogryposis, distal, type 2B3 (Sheldon-Hall) 618436;Contractures, pterygia, and spondylocarpostarsal fusion syndrome 1A 178110;Contractures, pterygia, and spondylocarpotarsal fusion syndrome 1B 618469 25957469;26544689;21531865;18695058 False 3 100;0;0 1.2304 True ENSG00000109063 ENSG00000109063 HGNC:7573 MYH6 gene MYH6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Atrial septal defect 3 MIM#614089;Congenital heart disease;Cardiomyopathy, dilated, 1EE MIM#613252;Cardiomyopathy, hypertrophic, 14 MIM#613251;{Sick sinus syndrome 3} MIM#614090 32656206;31638415;29969989;29536580;29332214;30681346 False 3 100;0;0 1.2304 True ENSG00000197616 ENSG00000197616 HGNC:7576 MYH8 gene MYH8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Trismus-pseudocamptodactyly syndrome MIM# 158300;Carney complex variant MIM# 608837 28377322;18049072;17041932 False 3 50;0;50 1.2304 True ENSG00000133020 ENSG00000133020 HGNC:7578 MYH9 gene MYH9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Deafness, autosomal dominant 17, MIM# 603622;Macrothrombocytopenia and granulocyte inclusions with or without nephritis or sensorineural hearing loss, MIM# 155100;MYH9-related disorders 9390828;24890873;17146397;25505834;16630581;16162639;23976996;21908426 False 3 100;0;0 1.2304 True ENSG00000100345 ENSG00000100345 HGNC:7579 MYL9 gene MYL9 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Megacystis-microcolon-intestinal hypoperistalsis syndrome, MIM#619365 29453416;33031641;32621347;33264186 False 3 50;50;0 1.2304 True ENSG00000101335 ENSG00000101335 HGNC:15754 MYMK gene MYMK Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Carey-Fineman-Ziter syndrome;OMIM #254940 28681861 False 3 100;0;0 1.2304 True ENSG00000187616 ENSG00000187616 HGNC:33778 MYMX gene MYMX Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Carey-Fineman-Ziter syndrome MONDO:0009700 35642635 False 3 50;50;0 1.2304 True ENSG00000262179 ENSG00000262179 HGNC:52391 MYO15A gene MYO15A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 3, MIM# 600316;autosomal recessive nonsyndromic deafness 3 MONDO:0010860 27375115;26226137;23208854;19309289;9603735;10915760;33078831 False 3 100;0;0 1.2304 True ENSG00000091536 ENSG00000091536 HGNC:7594 MYO18B gene MYO18B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Klippel-Feil syndrome 4, autosomal recessive, with myopathy and facial dysmorphism, MIM# 616549 25748484;27858739;32637634;32184166;27879346 False 3 100;0;0 1.2304 True ENSG00000133454 ENSG00000133454 HGNC:18150 MYO1E gene MYO1E Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Glomerulosclerosis, focal segmental, 6, MIM# 614131 21756023;31520189;25739341;23977349 False 3 100;0;0 1.2304 True ENSG00000157483 ENSG00000157483 HGNC:7599 MYO3A gene MYO3A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Deafness, autosomal recessive 30, MIM# 607101;Deafness, autosomal dominant 90, MIM# 620722 21165622;26754646;23990876;33078831;26841241;29880844 False 3 100;0;0 1.2304 True ENSG00000095777 ENSG00000095777 HGNC:7601 MYO5A gene MYO5A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Griscelli syndrome, type 1 MIM#214450 32275080;22711375;25283056 False 3 100;0;0 1.2304 True ENSG00000197535 ENSG00000197535 HGNC:7602 MYO5B gene MYO5B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microvillus inclusion disease, MIM# 251850;Cholestasis 30564347;29266534;28027573;27532546 False 3 100;0;0 1.2304 True ENSG00000167306 ENSG00000167306 HGNC:7603 MYO6 gene MYO6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Deafness, autosomal dominant 22, MIM# 606346;Deafness, autosomal recessive 37, MIM# 607821 24105371;11468689;25999546;25227905;18348273;27171474 False 3 100;0;0 1.2304 True ENSG00000196586 ENSG00000196586 HGNC:7605 MYO7A gene MYO7A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Deafness, autosomal dominant 11, MIM# 601317;Deafness, autosomal recessive 2, 600060;Usher syndrome, type 1B, MIM# 276900 9354784;15300860;15121790;15221449;16449806;21150918;23451214;23383098;28802369;29400105;23559863;18181211;25211151 False 3 100;0;0 1.2304 True ENSG00000137474 ENSG00000137474 HGNC:7606 MYOC gene MYOC Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Glaucoma 1A, primary open angle, MIM# 137750 9005853;9535666;15108121 False 3 100;0;0 1.2304 True ENSG00000034971 ENSG00000034971 HGNC:7610 MYOCD gene MYOCD Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Megabladder, congenital, MIM# 618719 31513549;35005812 False 3 100;0;0 1.2304 True ENSG00000141052 ENSG00000141052 HGNC:16067 MYOD1 gene MYOD1 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Myopathy, congenital, with diaphragmatic defects, respiratory insufficiency, and dysmorphic facies, MIM# 618975" 26733463;30403323;31260566 False 3 100;0;0 1.2304 True ENSG00000129152 ENSG00000129152 HGNC:7611 MYOT gene MYOT Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myopathy, myofibrillar, 3, MIM# 609200;Myopathy, spheroid body, MIM# 182920 10958653;15111675;16380616;33250842;32509353;29924655 False 3 100;0;0 1.2304 True ENSG00000120729 ENSG00000120729 HGNC:12399 MYPN gene MYPN Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Nemaline myopathy 11, autosomal recessive MIM#617336 AR;cardiomyopathy MIM#615248 AD False 3 100;0;0 1.2304 True ENSG00000138347 ENSG00000138347 HGNC:23246 MYRF gene MYRF Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Nanophthalmos and high hyperopia;Cardiac-urogenital syndrome, MIM# 618280;Encephalitis/encephalopathy, mild, with reversible myelin vacuolization, MIM# 618113 31048900;31172260;31266062;31700225;29446546;29446546;30532227;31069960;29265453 False 3 100;0;0 1.2304 True ENSG00000124920 ENSG00000124920 HGNC:1181 MYSM1 gene MYSM1 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Bone marrow failure syndrome 4, MIM#618116 4288411;28115216;26220525;32640305 False 3 100;0;0 1.2304 True ENSG00000162601 ENSG00000162601 HGNC:29401 MYT1 gene MYT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Craniofacial microsomia;OAV spectrum 28612832;32871052;27358179;33710394 False 3 100;0;0 1.2304 True ENSG00000196132 ENSG00000196132 HGNC:7622 MYT1L gene MYT1L Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 39, MIM# 616521 28859103;32065501 False 3 100;0;0 1.2304 True ENSG00000186487 ENSG00000186487 HGNC:7623 MYZAP gene MYZAP Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Cardiomyopathy, dilated, 2K, MIM# 620894 34899865;35840178;38436102;20093627 False 3 100;0;0 1.2304 True ENSG00000263155 ENSG00000263155 HGNC:43444 NAA10 gene NAA10 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) "Microphthalmia, syndromic 1, MIM# 309800;Ogden syndrome MIM#300855" 30842225;34075687;21700266 False 3 100;0;0 1.2304 True ENSG00000102030 ENSG00000102030 HGNC:18704 NAA15 gene NAA15 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder, autosomal dominant 50, with behavioral abnormalities - MIM#617787 33103328;29656860;31127942;28191889;33557580;28990276 False 3 100;0;0 1.2304 True ENSG00000164134 ENSG00000164134 HGNC:30782 NAA20 gene NAA20 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Intellectual developmental disorder, autosomal recessive 73, MIM# 619717 34230638 False 3 100;0;0 1.2304 True ENSG00000173418 ENSG00000173418 HGNC:15908 NAA60 gene NAA60 Expert Review Green;Other Mendeliome BIALLELIC, autosomal or pseudoautosomal Basal ganglia calcification, idiopathic, 9, autosomal recessive, MIM# 620786 False 3 100;0;0 1.2304 True ENSG00000122390 ENSG00000122390 HGNC:25875 NACC1 gene NACC1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with epilepsy, cataracts, feeding difficulties, and delayed brain myelination - MIM#617393 28132692 False 3 100;0;0 1.2304 True ENSG00000160877 ENSG00000160877 HGNC:20967 NADK2 gene NADK2 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "2,4-dienoyl-CoA reductase deficiency, MIM# 616034" 24847004;29388319;27940755 False 3 100;0;0 1.2304 True ENSG00000152620 ENSG00000152620 HGNC:26404 NADSYN1 gene NADSYN1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Vertebral, cardiac, renal, and limb defects syndrome 3, MONDO:0030077;Vertebral, cardiac, renal, and limb defects syndrome 3, OMIM:618845 31883644 False 3 100;0;0 1.2304 True ENSG00000172890 ENSG00000172890 HGNC:29832 NAE1 gene NAE1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with dysmorphic facies and ischiopubic hypoplasia, MIM# 620210 36608681 False 3 100;0;0 1.2304 True ENSG00000159593 ENSG00000159593 HGNC:621 NAF1 gene NAF1 Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Pulmonary fibrosis and/or bone marrow failure syndrome, telomere-related, 7, MIM# 620365 27510903 False 3 100;0;0 1.2304 True ENSG00000145414 ENSG00000145414 HGNC:25126 NAGA gene NAGA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Kanzaki disease, MIM# 609242;Schindler disease, type I and type II 609241;alpha-N-acetylgalactosaminidase deficiency MONDO:0017779 1313741;31468281;15619430;8782044 False 3 100;0;0 1.2304 True ENSG00000198951 ENSG00000198951 HGNC:7631 NAGLU gene NAGLU Expert Review Amber;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mucopolysaccharidosis type IIIB (Sanfilippo B), MIM# 252920;MONDO:0009656;Charcot-Marie-Tooth disease, axonal, type 2V MIM#616491;MONDO:0014665 25818867;8650226 False 3 50;50;0 1.2304 True ENSG00000108784 ENSG00000108784 HGNC:7632 NAGS gene NAGS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal N-acetylglutamate synthase deficiency - MIM#237310 12594532;17421020;12459178;12754705;9877039 False 3 100;0;0 1.2304 True ENSG00000161653 ENSG00000161653 HGNC:17996 NALCN gene NALCN Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Congenital contractures of the limbs and face, hypotonia, and developmental delay - MIM#616266;Hypotonia, infantile, with psychomotor retardation and characteristic facies 1 - MIM#615419 25683120;23749988;24075186;30167850 False 3 100;0;0 1.2304 True ENSG00000102452 ENSG00000102452 HGNC:19082 NANS gene NANS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spondyloepimetaphyseal dysplasia, Camera-Genevieve type - MIM#610442 8152878;15726110;8723082;27213289;7551156 False 3 100;0;0 1.2304 True ENSG00000095380 ENSG00000095380 HGNC:19237 NAPB gene NAPB Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 107 MIM#620033 26235277;28097321;33189936 False 3 100;0;0 1.2304 True ENSG00000125814 ENSG00000125814 HGNC:15751 NARS gene NARS Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly, impaired language, and gait abnormalities (NEDMILG), MIM#619091;Neurodevelopmental disorder with microcephaly, impaired language, epilepsy, and gait abnormalities (NEDMILEG), MIM#619092;Abnormal muscle tone;Microcephaly;Global developmental delay;Intellectual disability;Seizures;Ataxia;Abnormality of the face;Demyelinating peripheral neuropathy 32738225 False 3 100;0;0 1.2304 True ENSG00000134440 ENSG00000134440 HGNC:7643 NARS2 gene NARS2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 24 - MIM#616239;Deafness, autosomal recessive 94 - MIM#618434 25385316;25807530;30327238;28077841 False 3 100;0;0 1.2304 True ENSG00000137513 ENSG00000137513 HGNC:26274 NAV3 gene NAV3 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092, NAV3-related 39708122;38977784 False 3 100;0;0 1.2304 True ENSG00000067798 ENSG00000067798 HGNC:15998 NAXD gene NAXD Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Encephalopathy, progressive, early-onset, with brain edema and/or leukoencephalopathy, 2 MIM#618321 30576410;31755961;32462209 False 3 100;0;0 1.2304 True ENSG00000213995 ENSG00000213995 HGNC:25576 NAXE gene NAXE Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Encephalopathy, progressive, early-onset, with brain oedema and/or leukoencephalopathy, MIM# 617186 27122014;27616477;31758406 False 3 100;0;0 1.2304 True ENSG00000163382 ENSG00000163382 HGNC:18453 NBAS gene NBAS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Short stature, optic nerve atrophy, and Pelger-Huet anomaly, MIM# 614800;Infantile liver failure syndrome 2, MIM# 616483;Haemophagocytic lymphohistiocytosis (HLH), MONDO:0015541 31761904;35902954 False 3 100;0;0 1.2304 True ENSG00000151779 ENSG00000151779 HGNC:15625 NBEA gene NBEA Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with or without early-onset generalized epilepsy, MIM# 619157;Intellectual disability;Seizures 30269351;28554332;12746398;12826745;11450821;3377648;23277425;22109531;23153818 False 3 100;0;0 1.2304 True ENSG00000172915 ENSG00000172915 HGNC:7648 NBEAL2 gene NBEAL2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Gray platelet syndrome, MIM# 139090 21765412;21765411;21765413 False 3 100;0;0 1.2304 True ENSG00000160796 ENSG00000160796 HGNC:31928 NBN gene NBN Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Nijmegen breakage syndrome, MIM# 251260;MONDO:0009623 33488600;33082212 False 3 100;0;0 1.2304 True ENSG00000104320 ENSG00000104320 HGNC:7652 NCAPD2 gene NCAPD2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephaly 21, primary, autosomal recessive;OMIM #617983 31056748;27737959;28097321 False 3 100;0;0 1.2304 True ENSG00000010292 ENSG00000010292 HGNC:24305 NCDN gene NCDN Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodevelopmental disorder with infantile epileptic spasms (NEDIES), MIM#619373 33711248 False 3 100;0;0 1.2304 True ENSG00000020129 ENSG00000020129 HGNC:17597 NCF1 gene NCF1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Chronic granulomatous disease 1, autosomal recessive, MIM# 233700 2011585;11133775;10706888;16972229;16972229 False 3 100;0;0 1.2304 True ENSG00000158517 ENSG00000158517 HGNC:7660 NCF2 gene NCF2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Chronic granulomatous disease 2, autosomal recessive, MIM# 233710 7795241;10498624 False 3 100;0;0 1.2304 True ENSG00000116701 ENSG00000116701 HGNC:7661 NCF4 gene NCF4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Granulomatous disease, chronic, autosomal recessive, cytochrome b-positive, type III MIM#613960 19692703;16880254;29969437 False 3 100;0;0 1.2304 True ENSG00000100365 ENSG00000100365 HGNC:7662 NCKAP1 gene NCKAP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder (MONDO#0700092) , NCKAP1-related 33157009 False 3 100;0;0 1.2304 True ENSG00000061676 ENSG00000061676 HGNC:7666 NCKAP1L gene NCKAP1L Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency;Immune dysregulation;Immunodeficiency 72 with autoinflammation, MIM# 618982 32647003 False 3 100;0;0 1.2304 True ENSG00000123338 ENSG00000123338 HGNC:4862 NCSTN gene NCSTN Expert Review Green;Victorian Clinical Genetics Services Mendeliome Unknown False 3 100;0;0 1.2304 True ENSG00000162736 ENSG00000162736 HGNC:17091 NDC1 gene NDC1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal triple-A syndrome MONDO:0009279 39003500;19782045 False 3 100;0;0 1.2304 True ENSG00000058804 ENSG00000058804 HGNC:25525 NDE1 gene NDE1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microhydranencephaly 605013;Lissencephaly 4 (with microcephaly) 614019 30637988 False 3 100;0;0 1.2304 True ENSG00000072864 ENSG00000072864 HGNC:17619 NDP gene NDP Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Exudative vitreoretinopathy 2, X-linked, MIM 305390;Norrie disease, MIM 310600 23444378;8268931;17325173;27217716;29181528;31827910 False 3 100;0;0 1.2304 True ENSG00000124479 ENSG00000124479 HGNC:7678 NDRG1 gene NDRG1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Charcot Marie Tooth disease, type 4D, 601455;MONDO:0011085;Auditory neuropathy 10831399;24136616;33334662;29724652;29174527;28776325 False 3 100;0;0 1.2304 True ENSG00000104419 ENSG00000104419 HGNC:7679 NDST1 gene NDST1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mental retardation, autosomal recessive 46 - MIM#616116 25125150;21937992;32878022;28211985 False 3 100;0;0 1.2304 True ENSG00000070614 ENSG00000070614 HGNC:7680 NDUFA1 gene NDUFA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Mitochondrial complex I deficiency, nuclear type 12 MIM#301020 29506883;19185523;17262856;21596602 False 3 100;0;0 1.2304 True ENSG00000125356 ENSG00000125356 HGNC:7683 NDUFA10 gene NDUFA10 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 22 - MIM#618243 21150889;26741492;28247337 False 3 100;0;0 1.2304 True ENSG00000130414 ENSG00000130414 HGNC:7684 NDUFA12 gene NDUFA12 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 23 618244 21617257;33715266 False 3 50;0;50 1.2304 True ENSG00000184752 ENSG00000184752 HGNC:23987 NDUFA13 gene NDUFA13 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 28, MIM# 618249 25901006;32722639 False 3 50;50;0 1.2304 True ENSG00000186010 ENSG00000186010 HGNC:17194 NDUFA2 gene NDUFA2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 13 - MIM#618235 28857146;32154054;18513682 False 3 100;0;0 1.2304 True ENSG00000131495 ENSG00000131495 HGNC:7685 NDUFA4 gene NDUFA4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 21, MIM#619065;Leigh syndrome;Complex IV deficiency 30361421;28988874;23746447 False 3 100;0;0 1.2304 True ENSG00000189043 ENSG00000189043 HGNC:7687 NDUFA6 gene NDUFA6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 33, MIM# 618253 30245030 False 3 100;0;0 1.2304 True ENSG00000184983 ENSG00000184983 HGNC:7690 NDUFA9 gene NDUFA9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 26 - MIM#618247 26425749;28671271;22114105 False 3 100;0;0 1.2304 True ENSG00000139180 ENSG00000139180 HGNC:7693 NDUFAF1 gene NDUFAF1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 11 - MIM#618234 17557076;21931170;16218961;24963768;34975718 False 3 100;0;0 1.2304 True ENSG00000137806 ENSG00000137806 HGNC:18828 NDUFAF2 gene NDUFAF2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 10 - MIM#618233 33528536;34364746;16200211;19384974;20571988 False 3 100;0;0 1.2304 True ENSG00000164182 ENSG00000164182 HGNC:28086 NDUFAF3 gene NDUFAF3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 18 - MIM#618240 27986404;29344937;19463981 False 3 100;0;0 1.2304 True ENSG00000178057 ENSG00000178057 HGNC:29918 NDUFAF4 gene NDUFAF4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 15 - MIM#618237 32949790;28853723;18179882 False 3 100;0;0 1.2304 True ENSG00000123545 ENSG00000123545 HGNC:21034 NDUFAF5 gene NDUFAF5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 3 MIM#618224 34797029 False 3 100;0;0 1.2304 True ENSG00000101247 ENSG00000101247 HGNC:15899 NDUFAF6 gene NDUFAF6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 17 (MIM#618239) 30642748 False 3 100;0;0 1.2304 True ENSG00000156170 ENSG00000156170 HGNC:28625 NDUFAF8 gene NDUFAF8 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Leigh syndrome 31866046 False 3 100;0;0 1.2304 True ENSG00000224877 ENSG00000224877 HGNC:33551 NDUFB10 gene NDUFB10 Expert Review Green;NHS GMS Mendeliome BIALLELIC, autosomal or pseudoautosomal fatal infantile lactic acidosis;cardiomyopathy;Mitochondrial complex I deficiency nuclear type 35 (MC1DN35), MIM#619003 28040730;32025618;33169436 False 3 100;0;0 1.2304 True ENSG00000140990 ENSG00000140990 HGNC:7696 NDUFB11 gene NDUFB11 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Linear skin defects with multiple congenital anomalies 3, XLD (MIM#300952);MONDO:0010494;Mitochondrial complex I deficiency, nuclear type 30, XLR (MIM#301021);MONDO:0026721;X-linked sideroblastic anaemia 28050600;27488349;30423443;27488349;27488349 False 3 100;0;0 1.2304 True ENSG00000147123 ENSG00000147123 HGNC:20372 NDUFB3 gene NDUFB3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 25, MIM# 618246;MONDO:0032629 22499348;27091925 False 3 100;0;0 1.2304 True ENSG00000119013 ENSG00000119013 HGNC:7698 NDUFB8 gene NDUFB8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 32 - MIM#618252 29429571 False 3 100;0;0 1.2304 True ENSG00000166136 ENSG00000166136 HGNC:7703 NDUFS1 gene NDUFS1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 5 - MIM#618226 33751534;24952175;20382551;21203893;20797884;15824269;25615419;11349233;22399432 False 3 100;0;0 1.2304 True ENSG00000023228 ENSG00000023228 HGNC:7707 NDUFS2 gene NDUFS2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 6 - MIM#618228 28031252;31411514;22036843;20819849;11220739;23266820;31411514 False 3 100;0;0 1.2304 True ENSG00000158864 ENSG00000158864 HGNC:7708 NDUFS3 gene NDUFS3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 8 - MIM#618230 22499348;30140060;14729820;33097395 False 3 100;0;0 1.2304 True ENSG00000213619 ENSG00000213619 HGNC:7710 NDUFS4 gene NDUFS4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 1 - MIM#252010 11181577;11165261;16478720;10944442;24295889;22326555;27079373;15975579;19364667;27671926;33093004;29264396;34484776 False 3 100;0;0 1.2304 True ENSG00000164258 ENSG00000164258 HGNC:7711 NDUFS6 gene NDUFS6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 9 - MIM#618232 15372108;19259137;30948790 False 3 100;0;0 1.2304 True ENSG00000145494 ENSG00000145494 HGNC:7713 NDUFS7 gene NDUFS7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 3 MIM#618224 17604671;17275378;10360771 False 3 100;0;0 1.2304 True ENSG00000115286 ENSG00000115286 HGNC:7714 NDUFS8 gene NDUFS8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 2 MIM#618222 23430795;9837812;15159508;22499348;20818383;20819849 False 3 100;0;0 1.2304 True ENSG00000110717 ENSG00000110717 HGNC:7715 NDUFV1 gene NDUFV1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 4 MIM#618225 34807224 False 3 100;0;0 1.2304 True ENSG00000167792 ENSG00000167792 HGNC:7716 NDUFV2 gene NDUFV2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 7 - MIM#618229 33811136;34405929;12754703;26008862;30770271;19167255 False 3 100;0;0 1.2304 True ENSG00000178127 ENSG00000178127 HGNC:7717 NEB gene NEB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Nemaline myopathy 2, autosomal recessive 256030;MONDO:0009725;Arthrogryposis multiplex congenita 6, MIM# 619334 25205138;10051637;22367672;26578207;33376055 False 3 67;33;0 1.2304 True ENSG00000183091 ENSG00000183091 HGNC:7720 NECTIN1 gene NECTIN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cleft lip/palate-ectodermal dysplasia syndrome MIM#225060;Zlotogora-Ogur syndrome 25913853;10932188 False 3 100;0;0 1.2304 True ENSG00000110400 ENSG00000110400 HGNC:9706 NECTIN4 gene NECTIN4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ectodermal dysplasia-syndactyly syndrome 1 (MIM#613573) 24577405;20691405;25529316 False 3 100;0;0 1.2304 True ENSG00000143217 ENSG00000143217 HGNC:19688 NEDD4L gene NEDD4L Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Periventricular nodular heterotopia 7, MIM# 617201 34087865;27694961;32117442 False 3 100;0;0 1.2304 True ENSG00000049759 ENSG00000049759 HGNC:7728 NEFH gene NEFH Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, axonal, type 2CC, MIM#616924 30992180;27040688;28709447 False 3 100;0;0 1.2304 True Other ENSG00000100285 ENSG00000100285 HGNC:7737 NEFL gene NEFL Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, dominant intermediate G, MIM# 617882;Charcot-Marie-Tooth disease, type 1F, MIM# 607734;Charcot-Marie-Tooth disease, type 2E 607684 10841809;12393795;14733962;24887401;25877835;20039262;12566280;29191368;28902413 False 3 100;0;0 1.2304 True ENSG00000104725 ENSG00000277586 HGNC:7739 NEK1 gene NEK1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Short-rib thoracic dysplasia 6 with or without polydactyly, MIM# 263520;Orofaciodigital syndrome II , MIM# 252100;Amyotrophic lateral sclerosis, susceptibility to, 24, MIM# 617892 21211617;22499340;25492405;28123176;33445179;27530628 False 3 100;0;0 1.2304 True ENSG00000137601 ENSG00000137601 HGNC:7744 NEK10 gene NEK10 Expert Review Green;NHS GMS Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 44, MIM# 618781 31959991 False 3 100;0;0 1.2304 True ENSG00000163491 ENSG00000163491 HGNC:18592 NEK8 gene NEK8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Renal-hepatic-pancreatic dysplasia 2, MIM# 615415;MONDO:0014174;Polycystic kidney disease 8, MIM# 620903 33131162;23418306;26862157;26697755;26967905;23274954;31633649 False 3 100;0;0 1.2304 True ENSG00000160602 ENSG00000160602 HGNC:13387 NEMF gene NEMF Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Intellectual developmental disorder with speech delay and axonal peripheral neuropathy, MIM# 619099;Intellectual disability;neuropathy" 32934225 False 3 100;0;0 1.2304 True ENSG00000165525 ENSG00000165525 HGNC:10663 NEPRO gene NEPRO Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Anauxetic dysplasia 3, MIM618853 26633546;29620724;31250547;37294112 False 3 50;50;0 1.2304 True ENSG00000163608 ENSG00000163608 HGNC:24496 NEU1 gene NEU1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Sialidosis, type I and type II, MIM# 256550;MONDO:0009738 8985184;9054950;11063730 False 3 100;0;0 1.2304 True ENSG00000204386 ENSG00000204386 HGNC:7758 NEUROD1 gene NEUROD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Maturity-onset diabetes of the young 6, MIM#606394;Retinitis pigmentosa, retinopathy, permanent neonatal diabetes 25477324;25684977;22784109;29521454 False 3 100;0;0 1.2304 True ENSG00000162992 ENSG00000162992 HGNC:7762 NEUROD2 gene NEUROD2 Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Epileptic encephalopathy, early infantile, 72, MIM# 618374;Intellectual disability" 33438828;30323019 False 3 100;0;0 1.2304 True ENSG00000171532 ENSG00000171532 HGNC:7763 NEUROG1 gene NEUROG1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Cranial dysinnervation disorder, congenital, with absent corneal reflex and developmental delay, OMIM:620469 23419067;26077850;33439489;36647078 False 3 100;0;0 1.2304 True ENSG00000181965 ENSG00000181965 HGNC:7764 NEUROG3 gene NEUROG3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Diarrhoea 4, malabsorptive, congenital, MIM# 610370 16855267;32574610;28724572;21490072 False 3 100;0;0 1.2304 True ENSG00000122859 ENSG00000122859 HGNC:13806 NEXMIF gene NEXMIF Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Mental retardation, X-linked 98 300912 27358180 False 3 100;0;0 1.2304 True ENSG00000050030 ENSG00000050030 HGNC:29433 NEXN gene NEXN Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Lethal fetal cardiomyopathy;Hydrops fetalis;Cardiomyopathy, dilated 1CC - MIM#613122 33947203;33949776;35166435;32058062 False 3 100;0;0 1.2304 True ENSG00000162614 ENSG00000162614 HGNC:29557 NF1 gene NF1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Leukemia, juvenile myelomonocytic 607785;Neurofibromatosis, familial spinal 162210;Neurofibromatosis, type 1 162200;Neurofibromatosis-Noonan syndrome 601321;Watson syndrome 193520 False 3 100;0;0 1.2304 True ENSG00000196712 ENSG00000196712 HGNC:7765 NFASC gene NFASC Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with central and peripheral motor dysfunction;OMIM #618356 31501903;28940097;30124836;30850329;31608123 False 3 100;0;0 1.2304 True ENSG00000163531 ENSG00000163531 HGNC:29866 NFE2L2 gene NFE2L2 Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Immunodeficiency, developmental delay, and hypohomocysteinemia, MIM# 617744;Recurrent respiratory and skin infection;Growth retardation;Developmental delay, borderline ID;White matter cerebral lesions" 29018201 False 3 100;0;0 1.2304 True ENSG00000116044 ENSG00000116044 HGNC:7782 NFIA gene NFIA Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Brain malformations with or without urinary tract defects - MIM#613735 35018717;33973697;32926563 False 3 100;0;0 1.2304 True ENSG00000162599 ENSG00000162599 HGNC:7784 NFIB gene NFIB Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Macrocephaly, acquired, with impaired intellectual development, MIM#618286 30388402 False 3 100;0;0 1.2304 True ENSG00000147862 ENSG00000147862 HGNC:7785 NFIX gene NFIX Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Sotos syndrome 2 (MIM#614753);Marshall-Smith syndrome, MIM# 602535 33034087;29897170;30548146;25118028 False 3 100;0;0 1.2304 True ENSG00000008441 ENSG00000008441 HGNC:7788 NFKB1 gene NFKB1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Immunodeficiency, common variable, 12 MIM# 616576;Normal-low IgG, IgA, IgM;low-normal B cells;low switched memory B cells;hypogammaglobulinaemia;recurrent respiratory and gastrointestinal infections;Chronic obstructive pulmonary disease COPD;EBV proliferation;autoimmunity;alopecia 26279205;32278790;27022143;7834752 False 3 100;0;0 1.2304 True ENSG00000109320 ENSG00000109320 HGNC:7794 NFKB2 gene NFKB2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Immunodeficiency, common variable, 10 MIM# 615577;Low serum IgG, IgA, IgM;low B cell numbers;low switched memory B cells;Recurrent sinopulmonary infections, Alopecia;endocrinopathies;ACTH deficiency 24140114;24888602;25524009;31417880 False 3 100;0;0 1.2304 True ENSG00000077150 ENSG00000077150 HGNC:7795 NFKBIA gene NFKBIA Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ectodermal dysplasia and immunodeficiency 2 MIM# 612132;Ectodermal dysplasia;TCR/ BCR activation impaired;low memory and isotype switched B cells;decreased IgG and IgA;elevated IgM;poor specific antibody responses;diarrhoea;agammaglobulinaemia;ectodermal dysplasia;recurrent respiratory and gastrointestinal infections;colitis;variable defects of skin, hair and teeth False 3 100;0;0 1.2304 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000100906 ENSG00000100906 HGNC:7797 NFS1 gene NFS1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 52, MIM#619386;Complex II/III deficiency;multisystem organ failure 24498631;33457206 False 3 100;0;0 1.2304 True ENSG00000244005 ENSG00000244005 HGNC:15910 NFU1 gene NFU1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Multiple mitochondrial dysfunctions syndrome 1, MIM# 605711;Spastic paraplegia 93, autosomal recessive, MIM# 620938 21944046;22077971;32747156;29441221 False 3 100;0;0 1.2304 True ENSG00000169599 ENSG00000169599 HGNC:16287 NGF gene NGF Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neuropathy, hereditary sensory and autonomic, type V, MIM# 608654;MONDO:0012092 14976160;20978020;33884296;32693191;31685654;30296891 False 3 100;0;0 1.2304 True ENSG00000134259 ENSG00000134259 HGNC:7808 NGLY1 gene NGLY1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of deglycosylation, MIM# 615273 24651605;27388694;32259258 False 3 100;0;0 1.2304 True ENSG00000151092 ENSG00000151092 HGNC:17646 NHEJ1 gene NHEJ1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Severe combined immunodeficiency with microcephaly, growth retardation, and sensitivity to ionizing radiation, MIM# 611291;Cernunnos-XLF deficiency MONDO:0012650;Microphthalmia/coloboma, MIM# 13 620968 37580330;30898087;30666249;28741180;25288157;24511403;21721379;21535335 False 3 100;0;0 1.2304 True ENSG00000187736 ENSG00000187736 HGNC:25737 NHLRC1 gene NHLRC1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 2B (Lafora) 254780 21505799;12958597 False 3 100;0;0 1.2304 True ENSG00000187566 ENSG00000187566 HGNC:21576 NHLRC2 gene NHLRC2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Fibrosis, neurodegeneration, and cerebral angiomatosis (FINCA) syndrome MIM#618278 29423877;32435055 False 3 100;0;0 1.2304 True ENSG00000196865 ENSG00000196865 HGNC:24731 NHP2 gene NHP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Dyskeratosis congenita, autosomal recessive 2, MIM# 613987 18523010;31985013 False 3 100;0;0 1.2304 True ENSG00000145912 ENSG00000145912 HGNC:14377 NHS gene NHS Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Nance-Horan syndrome - MIM#302350;Cataract 40, X-linked - MIM#302200 31755796;25266737 False 3 100;0;0 1.2304 True ENSG00000188158 ENSG00000188158 HGNC:7820 NID1 gene NID1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dandy-Walker malformation and occipital cephalocele;Hydrocephalus with or without seizures 23674478;25558065;12480912;30773799 False 3 100;0;0 1.2304 True ENSG00000116962 ENSG00000116962 HGNC:7821 NIPA1 gene NIPA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 6, autosomal dominant, MIM# 600363;MONDO:0010878 14508710;15711826;32500351;25133278 False 3 100;0;0 1.2304 True ENSG00000170113 ENSG00000170113 HGNC:17043 NIPAL4 gene NIPAL4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ichthyosis, congenital, autosomal recessive 6 - MIM#612281 30578701 False 3 100;0;0 1.2304 True ENSG00000172548 ENSG00000172548 HGNC:28018 NIPBL gene NIPBL Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cornelia de Lange syndrome 1, MIM#122470 False 3 100;0;0 1.2304 True ENSG00000164190 ENSG00000164190 HGNC:28862 NIT1 gene NIT1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Cerebrovascular disorder, NIT1-related (MONDO:0011057) 38430071 False 3 100;0;0 1.2304 True ENSG00000158793 ENSG00000158793 HGNC:7828 NKAP gene NKAP Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability 26358559;26350204;31587868 False 3 100;0;0 1.2304 True ENSG00000101882 ENSG00000101882 HGNC:29873 NKX2-1 gene NKX2-1 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Choreoathetosis, hypothyroidism, and neonatal respiratory distress MIM#610978;Chorea, hereditary benign MIM#118700 10931427;27066577;26839702;26103969 False 3 100;0;0 1.2304 True ENSG00000136352 ENSG00000136352 HGNC:11825 NKX2-2 gene NKX2-2 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Syndromic neonatal diabetes, with severe developmental delay, hypotonia, cortical blindness, hearing impairment 24411943;9584121 False 3 100;0;0 1.2304 True ENSG00000125820 ENSG00000125820 HGNC:7835 NKX2-5 gene NKX2-5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Atrial septal defect 7, with or without AV conduction defects, MIM# 108900;Ventricular septal defect 3 (MIM#614432);Tetralogy of Fallot (MIM#187500)" 30354339;28690296;25503402;27855642;25742962;26805889 False 3 100;0;0 1.2304 True ENSG00000183072 ENSG00000183072 HGNC:2488 NKX2-6 gene NKX2-6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Conotruncal heart malformations - MIM#217095;Persistent truncus arteriosus - MIM#217095 24421281;15649947;32198970;25380965;25319568 False 3 100;0;0 1.2304 True ENSG00000180053 ENSG00000180053 HGNC:32940 NKX3-2 gene NKX3-2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spondylo-megaepiphyseal-metaphyseal dysplasia - MIM#613330 20004766;29704686 False 3 100;0;0 1.2304 True ENSG00000109705 ENSG00000109705 HGNC:951 NKX6-2 gene NKX6-2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 8, autosomal recessive, with hypomyelinating leukodystrophy, MIM# 617560;MONDO:0033043 28575651;15601927;32246862;32004679 False 3 100;0;0 1.2304 True ENSG00000148826 ENSG00000148826 HGNC:19321 NLGN3 gene NLGN3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females X-linked complex neurodevelopmental disorder MONDO:0100148;{Asperger syndrome susceptibility, X-linked 1} - MIM#300494;{Autism susceptibility, X-linked 1} - MIM#300425 28584888;12669065;25167861 False 3 0;0;0 1.2304 True ENSG00000196338 ENSG00000196338 HGNC:14289 NLGN4X gene NLGN4X Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Mental retardation, X-linked, MIM# 300495 12669065;18231125;10071191;29428674;26350204;14963808;16648374 False 3 33;33;33 1.2304 True ENSG00000146938 ENSG00000146938 HGNC:14287 NLRC4 gene NLRC4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Familial cold autoinflammatory syndrome 4 - MIM#616115;Autoinflammation with infantile enterocolitis - MIM#616050 25217959;25385754;25217960 False 3 100;0;0 1.2304 True ENSG00000091106 ENSG00000091106 HGNC:16412 NLRP1 gene NLRP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Autoinflammation with arthritis and dyskeratosis, MIM# 617388;Palmoplantar carcinoma, multiple self-healing, MIM# 615225;Recurrent respiratory papillomatosis 27965258;31484767;27662089 False 3 100;0;0 1.2304 True ENSG00000091592 ENSG00000091592 HGNC:14374 NLRP12 gene NLRP12 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Familial cold autoinflammatory syndrome 2 - MIM#611762 18230725;21360512;24064030;27633793;38343435 False 3 100;0;0 1.2304 True ENSG00000142405 ENSG00000142405 HGNC:22938 NLRP2 gene NLRP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal female infertility;early embryonic arrest 30877238;19300480;29574422;33090377 False 3 100;0;0 1.2304 True ENSG00000022556 ENSG00000022556 HGNC:22948 NLRP3 gene NLRP3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Familial cold inflammatory syndrome 1, MIM#120100;Muckle-Wells syndrome, MIM#191900;CINCA syndrome, MIM#607115;Deafness, autosomal dominant 34, with or without inflammation, MIM#617772;Keratoendothelitis fugax hereditaria, MIM#148200 25038238 False 3 100;0;0 1.2304 True Other ENSG00000162711 ENSG00000162711 HGNC:16400 NLRP5 gene NLRP5 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Early embryonic arrest;Multi locus imprinting disturbance in offspring 32232222962;31829238;30877238;26323243;34440388 False 3 100;0;0 1.2304 True ENSG00000171487 ENSG00000171487 HGNC:21269 NLRP7 gene NLRP7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hydatidiform mole, recurrent, 1 - MIM#231090 23201303;23125094;25097207;26606510;19650864;23880596;22770628;26544189;28428943;21623199;21439709;33583041;32055942;19246479;19066229;34189227 False 3 100;0;0 1.2304 True ENSG00000167634 ENSG00000167634 HGNC:22947 NMNAT1 gene NMNAT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spondyloepiphyseal dysplasia, sensorineural hearing loss, intellectual disability, and Leber congenital amaurosis (SHILCA), MIM#619260;Leber congenital amaurosis 9, MIM# 608553 32533184;33668384;22842230;22842229 False 3 100;0;0 1.2304 True ENSG00000173614 ENSG00000173614 HGNC:17877 NNT gene NNT Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Glucocorticoid deficiency 4, with or without mineralocorticoid deficiency - MIM#614736 22634753;23474776;25879317;26070314;27129361 False 3 100;0;0 1.2304 True ENSG00000112992 ENSG00000112992 HGNC:7863 NOBOX gene NOBOX Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Premature ovarian failure 5,MIM#611548 27836978;21837770;25514101;17701902;27798098;29067606 False 3 100;0;0 1.2304 True ENSG00000106410 ENSG00000106410 HGNC:22448 NOD2 gene NOD2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Blau syndrome, MIM# 186580 15459013 False 3 100;0;0 1.2304 True ENSG00000167207 ENSG00000167207 HGNC:5331 NOG gene NOG Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Brachydactyly, type B2 - MIM#611377;Multiple synostoses syndrome 1 (MIM#186500);Stapes ankylosis with broad thumbs and toes (MIM#184460);Symphalangism, proximal, 1A (MIM#185800);Tarsal-carpal coalition syndrome (MIM#186570) 11846737;18440889;12089654;10080184;15066478;22088931;17381491 False 3 100;0;0 1.2304 True ENSG00000183691 ENSG00000183691 HGNC:7866 NONO gene NONO Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Intellectual developmental disorder, X-linked syndromic 34 - MIM#300967 26571461;27329731;27550220 False 3 100;0;0 1.2304 True ENSG00000147140 ENSG00000147140 HGNC:7871 NOS1AP gene NOS1AP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Nephrotic syndrome, type 22, MIM# 619155 False 3 50;0;50 1.2304 True ENSG00000198929 ENSG00000198929 HGNC:16859 NOTCH1 gene NOTCH1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Adams-Oliver syndrome 5 (MIM#616028);Genetic cerebral small vessel disease (MONDO:0018787), NOTCH1-related 25963545;25132448;35947102 False 3 100;0;0 1.2304 True Other ENSG00000148400 ENSG00000148400 HGNC:7881 NOTCH2 gene NOTCH2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alagille syndrome 2 (MIM#610205);Hajdu-Cheney syndrome (MIM#102500) 16773578;21378985;21378989 False 3 50;50;0 1.2304 True ENSG00000134250 ENSG00000134250 HGNC:7882 NOVA2 gene NOVA2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with or without autistic features and/or structural brain abnormalities, MIM# 618859 32197073 False 3 100;0;0 1.2304 True Other ENSG00000104967 ENSG00000104967 HGNC:7887 NPHP1 gene NPHP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 4, MIM# 609583;Nephronophthisis 1, juvenile, MIM# 256100;Senior-Loken syndrome-1, MIM# 266900 15138899;32139166;28347285;8852662;9856524 False 3 100;0;0 1.2304 True ENSG00000144061 ENSG00000144061 HGNC:7905 NPHP3 gene NPHP3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Meckel syndrome 7, MIM# 267010;Nephronophthisis 3, MIM# 604387;Renal-hepatic-pancreatic dysplasia 1, MIM# 208540 False 3 50;0;50 1.2304 True ENSG00000113971 ENSG00000113971 HGNC:7907 NPHP4 gene NPHP4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Nephronophthisis 4, MIM# 606966;Senior-Loken syndrome 4, MIM# 606996 12244321;12205563;34013113 False 3 100;0;0 1.2304 True ENSG00000131697 ENSG00000131697 HGNC:19104 NPHS1 gene NPHS1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Nephrotic syndrome, type 1, MIM# 256300 False 3 100;0;0 1.2304 True ENSG00000161270 ENSG00000161270 HGNC:7908 NPHS2 gene NPHS2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Nephrotic syndrome, type 2 (MIM#600995), AR 32467597;30260545;24509478 False 3 100;0;0 1.2304 True ENSG00000116218 ENSG00000116218 HGNC:13394 NPM1 gene NPM1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown radial ray defects;short stature;nail dsytrophy;bone marrow failure 31570891 False 3 100;0;0 1.2304 True ENSG00000181163 ENSG00000181163 HGNC:7910 NPNT gene NPNT Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Renal agenesis, MONDO:0018470, NPNT-related 35246978;34049960;17537792 False 3 100;0;0 1.2304 True ENSG00000168743 ENSG00000168743 HGNC:27405 NPR1 gene NPR1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Genetic hypertension MONDO:0015512 PMID: 37080586 False 3 100;0;0 1.2304 True ENSG00000169418 ENSG00000169418 HGNC:7943 NPR2 gene NPR2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Acromesomelic dysplasia, Maroteaux type MIM# 602875;Epiphyseal chondrodysplasia, Miura type, MIM# 615923;Short stature with nonspecific skeletal abnormalities, MIM# 616255 31555216;16384845;15146390;22870295;24057292;24259409;16384845;24471569 False 3 100;0;0 1.2304 True ENSG00000159899 ENSG00000159899 HGNC:7944 NPR3 gene NPR3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Boudin-Mortier syndrome, MIM#619543;Tall stature, skeletal abnormalities, aortic dilatation 30032985 False 3 100;0;0 1.2304 True ENSG00000113389 ENSG00000113389 HGNC:7945 NPRL2 gene NPRL2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Epilepsy, familial focal, with variable foci 2, MIM# 617116;focal seizures;frontal lobe epilepsy;nocturnal frontal lobe epilepsy;temporal lobe epilepsy;focal cortical dysplasia" 26505888;27173016;28199897;31594065 False 3 100;0;0 1.2304 True ENSG00000114388 ENSG00000114388 HGNC:24969 NPRL3 gene NPRL3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epilepsy, familial focal, with variable foci 3- MIM#617118 27173016;26285051;33461085 False 3 100;0;0 1.2304 True ENSG00000103148 ENSG00000103148 HGNC:14124 NPTX1 gene NPTX1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted cerebellar ataxia MONDO#0000437, NPTX1-related 34788392;35288776;35285082;35560436 False 3 100;0;0 1.2304 True ENSG00000171246 ENSG00000171246 HGNC:7952 NR0B1 gene NR0B1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females "Adrenal hypoplasia, congenital (MIM# 300200);46XY sex reversal 2, dosage-sensitive, MIM# 300018" 19508677;26030781 False 3 100;0;0 1.2304 True ENSG00000169297 ENSG00000169297 HGNC:7960 NR1H4 gene NR1H4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cholestasis, progressive familial intrahepatic, 5, MIM# 617049 26888176;32443034 False 3 100;0;0 1.2304 True ENSG00000012504 ENSG00000012504 HGNC:7967 NR2E3 gene NR2E3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Retinitis pigmentosa 37 - MIM#611131;Enhanced S-cone syndrome - MIM#268100;Goldmann-Favre syndrome - MONDO#0100289;retinal dystrophy 20301590;30324420;19718767;33138239 False 3 100;0;0 1.2304 True ENSG00000031544 ENSG00000278570 HGNC:7974 NR2F1 gene NR2F1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Bosch-Boonstra-Schaaf optic atrophy syndrome, MIM# 615722 32275123 False 3 100;0;0 1.2304 True ENSG00000175745 ENSG00000175745 HGNC:7975 NR2F2 gene NR2F2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Krithika Murali (Victorian Clinical Genetics Services) 46,XX sex reversal 5 - MIM#618901;Congenital heart defects, multiple types, 4 - MIM#615779 Current 46,XX sex reversal 5 - MIM#618901;Congenital heart defects, multiple types, 4 - MIM#615779 Edit;46,XX sex reversal 5 - MIM#618901;Congenital heart defects, multiple types, 4 - MIM#615779" 37500725;24702954;29478779;31687637;27363585;29222010;29663647 False 3 100;0;0 1.2304 True ENSG00000185551 ENSG00000185551 HGNC:7976 NR3C1 gene NR3C1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Glucocorticoid resistance, OMIM # 615962 12754700;1704018;8445027;31995340;30158362 False 3 100;0;0 1.2304 True ENSG00000113580 ENSG00000113580 HGNC:7978 NR3C2 gene NR3C2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Pseudohypoaldosteronism type I, autosomal dominant, MIM# 177735;MONDO:0008329 9662404;11134129;11344206;12788847;16972228 False 3 100;0;0 1.2304 True ENSG00000151623 ENSG00000151623 HGNC:7979 NR4A2 gene NR4A2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder with language impairment and early-onset DOPA-responsive dystonia-parkinsonism, MIM# 619911 31428396;30504930;29770430;12756136;9092472 False 3 100;0;0 1.2304 True ENSG00000153234 ENSG00000153234 HGNC:7981 NR5A1 gene NR5A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Adrenocortical insufficiency, (MIM#612964);46, XX sex reversal 4, (MIM# 617480);Premature ovarian failure 7, (MIM#612964);Spermatogenic failure 8, (MIM#613957);46XY sex reversal 3, (MIM#612965) 31513305 False 3 100;0;0 1.2304 True ENSG00000136931 ENSG00000136931 HGNC:7983 NR6A1 gene NR6A1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Craniofacial microsomia MONDO:0015397 39606382 False 3 100;0;0 1.2304 True ENSG00000148200 ENSG00000148200 HGNC:7985 NRAP gene NRAP Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Dilated cardiomyopathy 33534821;30384889;28611399;32870709 False 3 100;0;0 1.2304 True ENSG00000197893 ENSG00000197893 HGNC:7988 NRAS gene NRAS Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Noonan syndrome 6, MIM# 613224 19966803;26467218;28594414 False 3 100;0;0 1.2304 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000213281 ENSG00000213281 HGNC:7989 NRCAM gene NRCAM Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with neuromuscular and skeletal abnormalities, MIM# 619833 PMID: 35108495 False 3 100;0;0 1.2304 True ENSG00000091129 ENSG00000091129 HGNC:7994 NRL gene NRL Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Retinitis pigmentosa 27 - MIM#613750;Retinal degeneration, autosomal recessive, clumped pigment type 15591106;29385733;21981118;10192380;9344665 False 3 100;0;0 1.2304 True ENSG00000129535 ENSG00000129535 HGNC:8002 NRROS gene NRROS Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal neurodegeneration;intracranial calcification;epilepsy 32100099;32197075 False 3 100;0;0 1.2304 True ENSG00000174004 ENSG00000174004 HGNC:24613 NRXN1 gene NRXN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pitt-Hopkins-like syndrome 2 - MIM#614325 25486015;19896112;21964664;30873608;35101781;22337556;22670139 False 3 100;0;0 1.2304 True ENSG00000179915 ENSG00000179915 HGNC:8008 NSD1 gene NSD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Sotos syndrome 1 (MIM#117550), AD 16010675;15942875 False 3 100;0;0 1.2304 True ENSG00000165671 ENSG00000165671 HGNC:14234 NSD2 gene NSD2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Rauch-Steindl syndrome, MIM# 619695;Microcephaly;intellectual disability;Neurodevelopmental disorder, NSD2-associated, GoF, MONDO:0700092 30345613;31171569;36189577 False 3 100;0;0 1.2304 True ENSG00000109685 ENSG00000109685 HGNC:12766 NSDHL gene NSDHL Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) CHILD syndrome (MMIM#308050) 15689440 False 3 100;0;0 1.2304 True ENSG00000147383 ENSG00000147383 HGNC:13398 NSRP1 gene NSRP1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Epilepsy;Cerebral palsy;microcephaly;Intellectual disability 34385670 False 3 100;0;0 1.2304 True ENSG00000126653 ENSG00000126653 HGNC:25305 NSUN2 gene NSUN2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mental retardation, autosomal recessive 5 - MIM#611091 22541559;22541562;21063731;22577224;35126837 False 3 100;0;0 1.2304 True ENSG00000037474 ENSG00000037474 HGNC:25994 NSUN6 gene NSUN6 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Intellectual developmental disorder, autosomal recessive 82, MIM# 620779 37226891 False 3 67;33;0 1.2304 True ENSG00000241058 ENSG00000241058 HGNC:23529 NT5C2 gene NT5C2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 45, autosomal recessive, MIM# 613162;MONDO:0013165 24482476;32153630;29123918;28884889;28327087 False 3 100;0;0 1.2304 True ENSG00000076685 ENSG00000076685 HGNC:8022 NT5C3A gene NT5C3A Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Anaemia, haemolytic, due to UMPH1 deficiency, MIM# 266120 11369620;12714505;30951028;25153905 False 3 100;0;0 1.2304 True ENSG00000122643 ENSG00000122643 HGNC:17820 NT5E gene NT5E Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Calcification of joints and arteries, MIM# 211800 21288095 False 3 100;0;0 1.2304 True ENSG00000135318 ENSG00000135318 HGNC:8021 NTN1 gene NTN1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mirror movements 4 MIM#618264 25763452;28945198;33472083 False 3 100;0;0 1.2304 True ENSG00000065320 ENSG00000065320 HGNC:8029 NTNG2 gene NTNG2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal "Intellectual disability;autism;dysmorphic features;Neurodevelopmental disorder with behavioral abnormalities, absent speech, and hypotonia, MIM# 618718" 31668703 False 3 100;0;0 1.2304 True ENSG00000196358 ENSG00000196358 HGNC:14288 NTRK1 gene NTRK1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Insensitivity to pain, congenital, with anhidrosis - MIM#256800 10233776;19250380;10861667;10982191;20301726;20089052 False 3 100;0;0 1.2304 True ENSG00000198400 ENSG00000198400 HGNC:8031 NTRK2 gene NTRK2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 58, MIM# 617830;Obesity, hyperphagia, and developmental delay, MIM# 613886 29100083;15494731;27884935;29100083 False 3 100;0;0 1.2304 True ENSG00000148053 ENSG00000148053 HGNC:8032 NUBPL gene NUBPL Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 21 - MIM#618242 20818383;32518176;23553477;31917109;32518176;31787496;30897263;22826544 False 3 100;0;0 1.2304 True ENSG00000151413 ENSG00000151413 HGNC:20278 NUDCD3 gene NUDCD3 Expert list;Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal severe combined immunodeficiency MONDO:0015974 38787962 False 3 100;0;0 1.2304 True ENSG00000015676 ENSG00000015676 HGNC:22208 NUDT2 gene NUDT2 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular hypotonia;Global developmental delay;Intellectual disability;Polyneuropathy 27431290;30059600;33058507 False 3 100;0;0 1.2304 True ENSG00000164978 ENSG00000164978 HGNC:8049 NUP107 gene NUP107 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Galloway-Mowat syndrome 7, MIM# 618348 28280135;28117080;30179222;25558065 False 3 100;0;0 1.2304 True ENSG00000111581 ENSG00000111581 HGNC:29914 NUP133 gene NUP133 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Nephrotic syndrome, type 18, MIM#618177 30179222 False 3 100;0;0 1.2304 True ENSG00000069248 ENSG00000069248 HGNC:18016 NUP160 gene NUP160 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Nephrotic syndrome, type 19, MIM#618178 30910934;30179222;33456446;38224683 False 3 50;0;50 1.2304 True ENSG00000030066 ENSG00000030066 HGNC:18017 NUP188 gene NUP188 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Sandestig-Stefanova syndrome, 618804;microcephaly;ID;cataract;structural brain abnormalities;hypoventilation 32021605;28726809;32275884 False 3 100;0;0 1.2304 True ENSG00000095319 ENSG00000095319 HGNC:17859 NUP214 gene NUP214 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Encephalopathy, acute, infection-induced, susceptibility to, 9, MIM# 618426;epileptic encephalopathy;developmental regression;microcephaly 31178128 False 3 100;0;0 1.2304 True ENSG00000126883 ENSG00000126883 HGNC:8064 NUP85 gene NUP85 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Nephrotic syndrome, type 17, MIM#618176 30179222 False 3 100;0;0 1.2304 True ENSG00000125450 ENSG00000125450 HGNC:8734 NUP88 gene NUP88 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Fetal akinesia deformation sequence 4, MIM# 618393 30543681 False 3 100;0;0 1.2304 True ENSG00000108559 ENSG00000108559 HGNC:8067 NUP93 gene NUP93 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Nephrotic syndrome, type 12 - MIM#616892 26878725;26878725;33578576;30741391 False 3 100;0;0 1.2304 True ENSG00000102900 ENSG00000102900 HGNC:28958 NUS1 gene NUS1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Congenital disorder of glycosylation, type 1aa 617082;Mental retardation, autosomal dominant 55, with seizures 617831 31656175;29100083;32485575;25066056 False 3 100;0;0 1.2304 True ENSG00000153989 ENSG00000153989 HGNC:21042 NXN gene NXN Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Robinow syndrome, autosomal recessive 2 618529 29276006 False 3 100;0;0 1.2304 True ENSG00000167693 ENSG00000167693 HGNC:18008 NYX gene NYX Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Night blindness, congenital stationary (complete), 1A, X-linked MIM#310500 11062471;11062472;16670814;23714322;34064005;34165036 False 3 100;0;0 1.2304 True ENSG00000188937 ENSG00000188937 HGNC:8082 OAS1 gene OAS1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Immunodeficiency 100 with pulmonary alveolar proteinosis and hypogammaglobulinaemia, MIM#618042 34145065;29455859 False 3 50;0;50 1.2304 True Other ENSG00000089127 ENSG00000089127 HGNC:8086 OAS2 gene OAS2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Multisystem inflammatory syndrome, MONDO:0035375, OAS2-related 36538032 False 3 100;0;0 1.2304 True ENSG00000111335 ENSG00000111335 HGNC:8087 OAT gene OAT Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Gyrate atrophy of choroid and retina with or without ornithinemia - MIM#258870 1618792;2220818;3339136;3417397;2916581;1737786;33463379 False 3 100;0;0 1.2304 True ENSG00000065154 ENSG00000065154 HGNC:8091 OBSCN gene OBSCN Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Rhabdomyolysis MONDO:0005290, OBSCN-related 30681346;26573135;17716621;25173926;28630914;33438037;34957489 False 3 33;0;67 1.2304 True ENSG00000154358 ENSG00000154358 HGNC:15719 OBSL1 gene OBSL1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal 3-M syndrome 2, MIM #612921 21737058;19481195;23018678;19877176 False 3 100;0;0 1.2304 True ENSG00000124006 ENSG00000124006 HGNC:29092 OCA2 gene OCA2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Albinism, brown oculocutaneous 203200;Albinism, oculocutaneous, type II 203200;autosomal dominant Albinism, oculocutaneous 32741191;24518832;20301410 False 3 100;0;0 1.2304 True ENSG00000104044 ENSG00000104044 HGNC:8101 OCLN gene OCLN Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pseudo-TORCH syndrome 1, MIM#251290 20727516;32240828;29192239;28386946 False 3 100;0;0 1.2304 True ENSG00000197822 ENSG00000197822 HGNC:8104 OCRL gene OCRL Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Dent disease 2, MIM# 300555;Lowe syndrome , MIM#309000 15627218;9199559;33517444 False 3 100;0;0 1.2304 True ENSG00000122126 ENSG00000122126 HGNC:8108 ODC1 gene ODC1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with alopecia and brain imaging abnormalities (NEDABIA), MIM#619075 30475435;30239107 False 3 100;0;0 1.2304 True Other ENSG00000115758 ENSG00000115758 HGNC:8109 OFD1 gene OFD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome Other Joubert syndrome 10, 300804;Simpson-Golabi-Behmel syndrome, type 2, 300209;Orofaciodigital syndrome I, 311200;Retinitis pigmentosa 23, 300424 31373179;23033313;16783569 False 3 100;0;0 1.2304 True ENSG00000046651 ENSG00000046651 HGNC:2567 OGDH gene OGDH Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Oxoglutarate dehydrogenase deficiency, MIM# 203740;Developmental delay;ataxia;seizure;raised lactate 32383294;36520152 False 3 50;50;0 1.2304 True ENSG00000105953 ENSG00000105953 HGNC:8124 OGDHL gene OGDHL Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Yoon-Bellen neurodevelopmental syndrome, MIM# 619701;Neurodevelopmental disorder featuring epilepsy, hearing loss, visual impairment, and ataxia PMID: 34800363 False 3 100;0;0 1.2304 True ENSG00000197444 ENSG00000197444 HGNC:25590 OGT gene OGT Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Mental retardation, X-linked 106, MIM# 300997 28302723;28584052;31296563;31627256;29769320;29606577 False 3 100;0;0 1.2304 True ENSG00000147162 ENSG00000147162 HGNC:8127 ONECUT1 gene ONECUT1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neonatal diabetes mellitus MONDO:0016391 37639628;34663987;10825208 False 3 100;0;0 1.2304 True ENSG00000169856 ENSG00000169856 HGNC:8138 OPA1 gene OPA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 14 (encephalocardiomyopathic type)MIM# 616896;Behr syndrome MIM#210000, AR;Optic atrophy 1, MIM#165500;Optic atrophy plus syndrome, MIM# 125250 False 3 100;0;0 1.2304 True ENSG00000198836 ENSG00000198836 HGNC:8140 OPA3 gene OPA3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal 3-methylglutaconic aciduria, type III (MGA3) (MIM#258501), AR;Optic atrophy 3 with cataract (MIM#165300), AD 25159689;31119193;31928268 False 3 100;0;0 1.2304 True Other ENSG00000125741 ENSG00000125741 HGNC:8142 OPHN1 gene OPHN1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance, MIM#300486 20528889;9582072;12807966;16221952 False 3 100;0;0 1.2304 True ENSG00000079482 ENSG00000079482 HGNC:8148 OPN1SW gene OPN1SW Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Colourblindness, tritan - MIM#190900 1531728;2937147;22065927;32400513;31944634 False 3 100;0;0 1.2304 True ENSG00000128617 ENSG00000128617 HGNC:1012 ORAI1 gene ORAI1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Immunodeficiency 9, MIM# 612782;Myopathy, tubular aggregate, 2, MIM# 615883" 31448844 False 3 100;0;0 1.2304 True Other ENSG00000182500 ENSG00000276045 HGNC:25896 ORC1 gene ORC1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Meier-Gorlin syndrome 1, MIM# 224690;MONDO:0009143 21358633;21358632;21358631;23023959 False 3 100;0;0 1.2304 True ENSG00000085840 ENSG00000085840 HGNC:8487 ORC4 gene ORC4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Meier-Gorlin syndrome 2, MIM# 613800 21358632;21358631;23023959;22333897 False 3 100;0;0 1.2304 True ENSG00000115947 ENSG00000115947 HGNC:8490 ORC6 gene ORC6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Meier-Gorlin syndrome 3, MIM# 613803 21358632;22333897;25691413;26139588 False 3 100;0;0 1.2304 True ENSG00000091651 ENSG00000091651 HGNC:17151 OSBPL2 gene OSBPL2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Deafness, autosomal dominant 67 - MIM#616340 25077649;25759012;31451425;30894143 False 3 100;0;0 1.2304 True ENSG00000130703 ENSG00000130703 HGNC:15761 OSGEP gene OSGEP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Galloway-Mowat syndrome 3, MIM# 617729 28805828;28272532 False 3 100;0;0 1.2304 True ENSG00000092094 ENSG00000092094 HGNC:18028 OSMR gene OSMR Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyloidosis, primary localized cutaneous, 1 - MIM#105250 19375894;19528426;25054142;20507362;19690585 False 3 100;0;0 1.2304 True ENSG00000145623 ENSG00000145623 HGNC:8507 OSTM1 gene OSTM1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Osteopetrosis, autosomal recessive 5 (MIM#259720) 12627228;15108279;16813530;23772242;32048120 False 3 100;0;0 1.2304 True ENSG00000081087 ENSG00000081087 HGNC:21652 OTC gene OTC Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Ornithine transcarbamylase deficiency - MIM#311250 False 3 100;0;0 1.2304 True ENSG00000036473 ENSG00000036473 HGNC:8512 OTOA gene OTOA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 22, MIM# 607039 11972037;19888295;23173898;16460646;26029705;26969326;23129639 False 3 100;0;0 1.2304 True ENSG00000155719 ENSG00000155719 HGNC:16378 OTOF gene OTOF Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Auditory neuropathy, autosomal recessive, 1 (MIM # 601071);Deafness, autosomal recessive 9 (MIM # 601071) 16371502;22906306 False 3 100;0;0 1.2304 True ENSG00000115155 ENSG00000115155 HGNC:8515 OTOG gene OTOG Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 18B - MIM#614945 29800624;23122587 False 3 100;0;0 1.2304 True ENSG00000188162 ENSG00000188162 HGNC:8516 OTOGL gene OTOGL Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 84B, MIM# 614944 23122586;23850727;25829320; 25719458;28426234 False 3 100;0;0 1.2304 True ENSG00000165899 ENSG00000165899 HGNC:26901 OTUD5 gene OTUD5 Expert Review Green;Literature Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Multiple congenital anomalies-neurodevelopmental syndrome, X-linked, MIM# 301056 33131077;33523931 False 3 100;0;0 1.2304 True ENSG00000068308 ENSG00000068308 HGNC:25402 OTUD6B gene OTUD6B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Intellectual developmental disorder with dysmorphic facies, seizures, and distal limb anomalies, OMIM #617452 28343629;32924626;31147255 False 3 100;0;0 1.2304 True ENSG00000155100 ENSG00000155100 HGNC:24281 OTULIN gene OTULIN Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Autoinflammation, panniculitis, and dermatosis syndrome, autosomal dominant, MIM# 621030;Autoinflammation, panniculitis, and dermatosis syndrome, autosomal recessive, MIM# 617099;Immunodeficiency 107, susceptibility to invasive staphylococcus aureus infection, MIM# 619986 27523608;27559085;35587511;38630025;38652464;38129331 False 3 100;0;0 1.2304 True ENSG00000154124 ENSG00000154124 HGNC:25118 OTX2 gene OTX2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Microphthalmia, syndromic 5, MIM# 610125;Pituitary hormone deficiency, combined, 6, MIM# 613986;Retinal dystrophy, early-onset, with or without pituitary dysfunction, MIM# 610125 False 3 100;0;0 1.2304 True ENSG00000165588 ENSG00000165588 HGNC:8522 OVOL2 gene OVOL2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Corneal dystrophy, posterior polymorphous, 1, MIM# 122000 26749309 False 3 100;0;0 1.2304 True ENSG00000125850 ENSG00000125850 HGNC:15804 OXCT1 gene OXCT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Succinyl CoA:3-oxoacid CoA transferase deficiency MIM#245050 25778941;10964512;8751852;23420214 False 3 100;0;0 1.2304 True ENSG00000083720 ENSG00000083720 HGNC:8527 OXR1 gene OXR1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Intellectual disability;seizures;cerebellar atrophy 31785787 False 3 50;50;0 1.2304 True ENSG00000164830 ENSG00000164830 HGNC:15822 P2RX2 gene P2RX2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Deafness, autosomal dominant 41, MIM# 608224 23345450;24211385;33791800 False 3 100;0;0 1.2304 True ENSG00000187848 ENSG00000187848 HGNC:15459 P2RY12 gene P2RY12 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Bleeding disorder, platelet-type, 8, MIM# 609821;MONDO:0012354 11196645;12578987;29117459;19237732 False 3 100;0;0 1.2304 True ENSG00000169313 ENSG00000169313 HGNC:18124 P3H1 gene P3H1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal "Osteogenesis imperfecta, type VIII, MIM# 610915" 17277775;19088120;27864101;33737016 False 3 100;0;0 1.2304 True ENSG00000117385 ENSG00000117385 HGNC:19316 P3H2 gene P3H2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Myopia, high, with cataract and vitreoretinal degeneration - MIM#614292 21885030;24172257;25469533;35499085 False 3 100;0;0 1.2304 True ENSG00000090530 ENSG00000090530 HGNC:19317 P4HB gene P4HB Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cole-Carpenter syndrome 1, MIM#112240 30063094;29263160;25683117;29384951 False 3 100;0;0 1.2304 True ENSG00000185624 ENSG00000185624 HGNC:8548 P4HTM gene P4HTM Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypotonia, hypoventilation, impaired intellectual development, dysautonomia, epilepsy, and eye abnormalities;OMIM #618493 25078763;30940925 False 3 100;0;0 1.2304 True ENSG00000178467 ENSG00000178467 HGNC:28858 PABPC1 gene PABPC1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder, PABPC1-related (MONDO#0700092) PMID: 35511136 False 3 100;0;0 1.2304 True ENSG00000070756 ENSG00000070756 HGNC:8554 PABPN1 gene PABPN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Oculopharyngeal muscular dystrophy - MIM#164300 19080757;33805441 False 3 100;0;0 1.2304 True ENSG00000100836 ENSG00000100836 HGNC:8565 PACS1 gene PACS1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Schuurs-Hoeijmakers syndrome (MIM# 615009) 26842493;23159249 False 3 100;0;0 1.2304 True ENSG00000175115 ENSG00000175115 HGNC:30032 PACS2 gene PACS2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 66 - MIM#618067 29656858;34894068;34859793 False 3 100;0;0 1.2304 True ENSG00000179364 ENSG00000179364 HGNC:23794 PADI3 gene PADI3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Uncombable hair syndrome - MIM#191480 27866708;22381266;30763140 False 3 100;0;0 1.2304 True ENSG00000142619 ENSG00000142619 HGNC:18337 PADI6 gene PADI6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Pre-implantation embryonic lethality 2 MIM#617234;Multi locus imprinting disturbance in offspring;Recurrent hydatiform mole 29693651;33583041;329228291;33221824;27545678 False 3 100;0;0 1.2304 True ENSG00000256049 ENSG00000276747 HGNC:20449 PAFAH1B1 gene PAFAH1B1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Lissencephaly 1, MIM# 607432;Subcortical laminar heterotopia, MIM# 607432;MONDO:0011830 11754098;18285425 False 3 100;0;0 1.2304 True ENSG00000007168 ENSG00000007168 HGNC:8574 PAH gene PAH Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Phenylketonuria MIM#261600;Disorders of phenylalanine or tyrosine metabolism 27604308;3008810 False 3 100;0;0 1.2304 True ENSG00000171759 ENSG00000171759 HGNC:8582 PAK1 gene PAK1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder with macrocephaly, seizures, and speech delay;OMIM #618158 31504246;30290153 False 3 100;0;0 1.2304 True ENSG00000149269 ENSG00000149269 HGNC:8590 PAK2 gene PAK2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Knobloch 2 syndrome, MIM#618458 38894571;38712026;33693784 False 3 50;0;50 1.2304 True ENSG00000180370 ENSG00000180370 HGNC:8591 PAK3 gene PAK3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Mental retardation, X-linked 30/47, MIM# 300558;Intellectual disability 9731525;10946356;12884430;17853471;18523455;32050918;32005903;31943058;31843706;31678216 False 3 100;0;0 1.2304 True ENSG00000077264 ENSG00000077264 HGNC:8592 PAM16 gene PAM16 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spondylometaphyseal dysplasia, Megarbane-Dagher-Melike type, OMIM # 613320 24786642;27354339 False 3 100;0;0 1.2304 True ENSG00000217930 ENSG00000217930 HGNC:29679 PAN2 gene PAN2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Syndromic disease MONDO:0002254, PAN2-related PMID:35304602;29620724 False 3 100;0;0 1.2304 True ENSG00000135473 ENSG00000135473 HGNC:20074 PANX1 gene PANX1 Expert list;Expert Review Green Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Oocyte maturation defect 7, MIM# 618550 30918116;32838805;33495594 False 3 50;50;0 1.2304 True Other ENSG00000110218 ENSG00000110218 HGNC:8599 PAPPA2 gene PAPPA2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Short stature, Dauber-Argente type, MIM#619489 26902202;34272725;32739295 False 3 100;0;0 1.2304 True ENSG00000116183 ENSG00000116183 HGNC:14615 PAPSS2 gene PAPSS2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Brachyolmia 4 with mild epiphyseal and metaphyseal changes MIM#612847 22791835;25594860;31461705;23633440;9771708;19474428 False 3 100;0;0 1.2304 True ENSG00000198682 ENSG00000198682 HGNC:8604 PARN gene PARN Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Dyskeratosis congenita, autosomal recessive 6, MIM# 616353;Pulmonary fibrosis and/or bone marrow failure, telomere-related, 4, MIM# 616371 25893599;26342108;25848748 False 3 100;0;0 1.2304 True ENSG00000140694 ENSG00000140694 HGNC:8609 PARP6 gene PARP6 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability;Epilepsy;Microcephaly 34067418 False 3 100;0;0 1.2304 True ENSG00000137817 ENSG00000137817 HGNC:26921 PARS2 gene PARS2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Epileptic encephalopathy, early infantile, 75, MIM# 618437 29410512;28077841;25629079;29915213 False 3 100;0;0 1.2304 True ENSG00000162396 ENSG00000162396 HGNC:30563 PATL2 gene PATL2 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Oocyte maturation defect 4, MIM# 617743 28965844;28965849;32048119;30765866 False 3 100;0;0 1.2304 True ENSG00000229474 ENSG00000229474 HGNC:33630 PAX1 gene PAX1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Otofaciocervical syndrome 2, MIM#615560;Syndromic SCID 29681087;28657137;23851939;32111619 False 3 100;0;0 1.2304 True ENSG00000125813 ENSG00000125813 HGNC:8615 PAX2 gene PAX2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Papillorenal syndrome, MIM# 120330;Renal coloboma syndrome, MONDO:0007352;Glomerulosclerosis, focal segmental, 7 - MIM#616002 21654726;24676634;31060108;32203253 False 3 100;0;0 1.2304 True ENSG00000075891 ENSG00000075891 HGNC:8616 PAX3 gene PAX3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Craniofacial-deafness-hand syndrome (MIM#122880), AD 2;Waardenburg syndrome, type 1 (MIM#193500), AD;Waardenburg syndrome, type 3 (MIM#148820), AD, AR 20301703;30854529 False 3 100;0;0 1.2304 True ENSG00000135903 ENSG00000135903 HGNC:8617 PAX5 gene PAX5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodevelopmental disorder MONDO:0700092, PAX5-related;Hypogammaglobulinaemia 35094443;31452935;28263302;25418537;8001127;27626380;35947077 False 3 50;50;0 1.2304 True ENSG00000196092 ENSG00000196092 HGNC:8619 PAX6 gene PAX6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Coloboma of optic nerve - MIM# 120430;Coloboma, ocular - MIM#120200;Morning glory disc anomaly - MIM#120430;Aniridia - MIM#106210;Anterior segment dysgenesis 5, multiple subtypes - MIM#604229;Cataract with late-onset corneal dystrophy - MIM#106210;Foveal hypoplasia 1- MIM#136520;Keratitis - MIM#148190;Optic nerve hypoplasia - MIM#165550 31700164;30986449;29930474;22171686 False 3 100;0;0 1.2304 True ENSG00000007372 ENSG00000007372 HGNC:8620 PAX7 gene PAX7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Myopathy, congenital, progressive, with scoliosis, MIM# 618578 31092906;11030621;24065826;31092906;8631261;11030621;24065826 False 3 100;0;0 1.2304 True ENSG00000009709 ENSG00000009709 HGNC:8621 PAX8 gene PAX8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypothyroidism, congenital, due to thyroid dysgenesis or hypoplasia, MIM# 218700;Mayer-Rokitansky-K ster-Hauser syndrome (MRKHS) 33434492;9590296;11232006;15356023;15718293 False 3 100;0;0 1.2304 True ENSG00000125618 ENSG00000125618 HGNC:8622 PAX9 gene PAX9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Tooth agenesis, selective, 3 - MIM#604625 10615120;16479262 False 3 100;0;0 1.2304 True ENSG00000198807 ENSG00000198807 HGNC:8623 PBX1 gene PBX1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Congenital anomalies of kidney and urinary tract syndrome with or without hearing loss, abnormal ears, or developmental delay, MIM# 617641 28566479;29036646 False 3 100;0;0 1.2304 True ENSG00000185630 ENSG00000185630 HGNC:8632 PC gene PC Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pyruvate carboxylase deficiency - MIM#266150 9585612;12112657 False 3 100;0;0 1.2304 True ENSG00000173599 ENSG00000173599 HGNC:8636 PCBD1 gene PCBD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hyperphenylalaninemia, BH4-deficient, D, MIM# 264070 24848070;24204001 False 3 100;0;0 1.2304 True ENSG00000166228 ENSG00000166228 HGNC:8646 PCBP2 gene PCBP2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted neurodevelopmental disorder MONDO:0700092, PCBP2-related 38965372 False 3 100;0;0 1.2304 True ENSG00000197111 ENSG00000197111 HGNC:8648 PCCA gene PCCA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Propionicacidaemia - MIM#606054 17966092;10101253;9887338 False 3 100;0;0 1.2304 True ENSG00000175198 ENSG00000175198 HGNC:8653 PCCB gene PCCB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Propionicacidaemia - MIM#606054 7386459;9683601;10502773 False 3 100;0;0 1.2304 True ENSG00000114054 ENSG00000114054 HGNC:8654 PCDH12 gene PCDH12 Expert Review Green;GeneReviews;Royal Melbourne Hospital;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Diencephalic-mesencephalic junction dysplasia syndrome 1, MIM# 251280 27164683;30178464 False 3 50;0;50 1.2304 True ENSG00000113555 ENSG00000113555 HGNC:8657 PCDH15 gene PCDH15 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Usher syndrome, type 1F, MIM# 602083;Deafness, autosomal recessive 23, MIM# 609533 11398101;11487575;11138007;12782354;16260500;14570705;25930172;28281779 False 3 100;0;0 1.2304 True ENSG00000150275 ENSG00000150275 HGNC:14674 PCDH19 gene PCDH19 Expert Review Green;Victorian Clinical Genetics Services Mendeliome Other "Epileptic encephalopathy, early infantile, 9 300088;PCDH19-related epilepsy (early seizure onset, generalised or focused seizures);cognitive impairment" 18469813;30287595 False 3 100;0;0 1.2304 True ENSG00000165194 ENSG00000165194 HGNC:14270 PCDHGC4 gene PCDHGC4 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with poor growth and skeletal anomalies, MIM# 619880 34244665 False 3 100;0;0 1.2304 True ENSG00000242419 ENSG00000242419 HGNC:8717 PCGF2 gene PCGF2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Turnpenny-Fry syndrome, MIM# 618371 30343942 False 3 100;0;0 1.2304 True ENSG00000056661 ENSG00000277258 HGNC:12929 PCK1 gene PCK1 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Phosphoenolpyruvate carboxykinase deficiency, cytosolic MIM#261680;Disorders of gluconeogenesis 24863970;28216384;26971250;27604308 False 3 100;0;0 1.2304 True ENSG00000124253 ENSG00000124253 HGNC:8724 PCNT gene PCNT Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephalic osteodysplastic primordial dwarfism, type II, MIM# 210720;MONDO:0008872 18174396;12210304;30922925;33460028;32557621;32267100 False 3 100;0;0 1.2304 True ENSG00000160299 ENSG00000160299 HGNC:16068 PCSK1 gene PCSK1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Obesity with impaired prohormone processing MIM#600955 30383237 False 3 100;0;0 1.2304 True ENSG00000175426 ENSG00000175426 HGNC:8743 PCYT1A gene PCYT1A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spondylometaphyseal dysplasia with cone-rod dystrophy, MIM# 608940;Lipodystrophy, congenital generalized, type 5, MIM# 620680 24387990;24387991;24889630 False 3 100;0;0 1.2304 True ENSG00000161217 ENSG00000161217 HGNC:8754 PCYT2 gene PCYT2 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 82, autosomal recessive 618770;global developmental delay;regression;spastic parapesis or tetraparesis;epilepsy;progressive cerebral and cerebellar atrophy False 3 50;0;50 1.2304 True ENSG00000185813 ENSG00000185813 HGNC:8756 PDCD10 gene PDCD10 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cerebral cavernous malformations 3 MIM#603285 30356112;15543491 False 3 100;0;0 1.2304 True ENSG00000114209 ENSG00000114209 HGNC:8761 PDE10A gene PDE10A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Dyskinesia, limb and orofacial, infantile-onset, MIM#616921;Striatal degeneration, autosomal dominant, MIM# 616922 27058446;27058447 False 3 100;0;0 1.2304 True ENSG00000112541 ENSG00000112541 HGNC:8772 PDE12 gene PDE12 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial disease MONDO:0044970, PDE12-related PMID: 39567835 False 3 100;0;0 1.2304 True ENSG00000174840 ENSG00000174840 HGNC:25386 PDE2A gene PDE2A Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Paroxysmal dyskinesia;Intellectual developmental disorder with paroxysmal dyskinesia or seizures, MIM# 619150Intellectual developmental disorder with paroxysmal dyskinesia or seizures, MIM# 619150 32467598;32196122;29392776 False 3 100;0;0 1.2304 True ENSG00000186642 ENSG00000186642 HGNC:8777 PDE3A gene PDE3A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypertension and brachydactyly syndrome - MIM#112410 False 3 100;0;0 1.2304 True ENSG00000172572 ENSG00000172572 HGNC:8778 PDE4D gene PDE4D Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Acrodysostosis 2, with or without hormone resistance, MIM# 614613 22464250;22464252;23033274;24203977 False 3 100;0;0 1.2304 True ENSG00000113448 ENSG00000113448 HGNC:8783 PDE6A gene PDE6A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Retinitis pigmentosa 43 - MIM#613810 35033039;34926197;18849587;21039428;17110911;7493036 False 3 100;0;0 1.2304 True ENSG00000132915 ENSG00000132915 HGNC:8785 PDE6B gene PDE6B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Night blindness, congenital stationary, autosomal dominant 2 - MIM#163500;Retinitis pigmentosa-40 - MIM#613801 8394174;8075643;17044014;7599633;18854872 False 3 100;0;0 1.2304 True ENSG00000133256 ENSG00000133256 HGNC:8786 PDE6C gene PDE6C Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cone dystrophy 4, MIM# 613093;Achromatopsia-5 19615668;30080950 False 3 100;0;0 1.2304 True ENSG00000095464 ENSG00000095464 HGNC:8787 PDE6D gene PDE6D Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 22, OMIM #615665 24166846;30423442 False 3 100;0;0 1.2304 True ENSG00000156973 ENSG00000156973 HGNC:8788 PDE6H gene PDE6H Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Achromatopsia 6 - MIM#610024 22901948 False 3 100;0;0 1.2304 True ENSG00000139053 ENSG00000139053 HGNC:8790 PDE8B gene PDE8B Expert Review;Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Striatal degeneration, autosomal dominant, MIM#609161 20085714;26769607;26475694 False 3 100;0;0 1.2304 True ENSG00000113231 ENSG00000113231 HGNC:8794 PDGFB gene PDGFB Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Basal ganglia calcification, idiopathic, 5 , MIM#615483 23913003;30952898;30609140 False 3 100;0;0 1.2304 True ENSG00000100311 ENSG00000100311 HGNC:8800 PDGFRA gene PDGFRA Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Gastrointestinal stromal tumor/GIST-plus syndrome, somatic or familial - MIM#175510;coloboma MONDO#0001476, PDGFRA-related 14699510;17087943;25975287;29486293;33449152;34107389;17566086;18670346;35034853 False 3 50;0;50 1.2304 True ENSG00000134853 ENSG00000134853 HGNC:8803 PDGFRB gene PDGFRB Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Basal ganglia calcification, idiopathic, 4, MIM# 615007;Kosaki overgrowth syndrome, MIM# 616592;Myeloproliferative disorder with eosinophilia, MIM# 131440;Myofibromatosis, infantile, 1, MIM# 228550;Premature ageing syndrome, Penttinen type, MIM# 601812;Ocular pterygium-digital keloid dysplasia syndrome, MIM# 621091 30573803;26279204;33450762 False 3 100;0;0 1.2304 True Other ENSG00000113721 ENSG00000113721 HGNC:8804 PDHA1 gene PDHA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Pyruvate dehydrogenase E1-alpha deficiency - MIM#312170 8504309 False 3 100;0;0 1.2304 True ENSG00000131828 ENSG00000131828 HGNC:8806 PDHB gene PDHB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pyruvate dehydrogenase E1-beta deficiency - MIM#614111 False 3 100;0;0 1.2304 True ENSG00000168291 ENSG00000168291 HGNC:8808 PDHX gene PDHX Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Lactic acidaemia due to PDX1 deficiency MIM#245349 20002125;34873726;33092611;30981218;25087164;22766002 False 3 100;0;0 1.2304 True ENSG00000110435 ENSG00000110435 HGNC:21350 PDK3 gene PDK3 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Charcot-Marie-Tooth disease, X-linked dominant, 6 MIM#300905;HMSN 23297365;26801680;27388934;28902413;34387338 False 3 100;0;0 1.2304 True ENSG00000067992 ENSG00000067992 HGNC:8811 PDP1 gene PDP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pyruvate dehydrogenase phosphatase deficiency - MIM#608782 31392110;19184109;15855260 False 3 100;0;0 1.2304 True ENSG00000164951 ENSG00000164951 HGNC:9279 PDSS1 gene PDSS1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 2 MIM#614651 17332895;22494076;33285023 False 3 100;0;0 1.2304 True ENSG00000148459 ENSG00000148459 HGNC:17759 PDSS2 gene PDSS2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 3 MIM#614652 29032433;25349199;17186472;21723727;10972372 False 3 100;0;0 1.2304 True ENSG00000164494 ENSG00000164494 HGNC:23041 PDX1 gene PDX1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Pancreatic agenesis 1 - MIM#260370 (AR);MODY, type IV - MIM#606392(AD) 9326926;10545531;10720084;12970316;20009086;19496967 False 3 100;0;0 1.2304 True ENSG00000139515 ENSG00000139515 HGNC:6107 PDXK gene PDXK Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Axonal polyneuropathy;optic atrophy 32522499;31187503;27604308 False 3 33;33;33 1.2304 True ENSG00000160209 ENSG00000160209 HGNC:8819 PDYN gene PDYN Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 23 - MIM#610245 20301317;23471613;23108490;22243190;22287014 False 3 100;0;0 1.2304 True ENSG00000101327 ENSG00000101327 HGNC:8820 PDZD7 gene PDZD7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 57, MIM# 618003;Usher syndrome, type IIC, GPR98/PDZD7 digenic, MIM# 605472 20440071;19028668;26416264;26849169;27068579;26445815;28173822l;24334608 False 3 100;0;0 1.2304 True ENSG00000186862 ENSG00000186862 HGNC:26257 PDZD8 gene PDZD8 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Intellectual developmental disorder with autism and dysmorphic facies, MIM# 620021 35227461 False 3 100;0;0 1.2304 True ENSG00000165650 ENSG00000165650 HGNC:26974 PEPD gene PEPD Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Prolidase deficiency MIM#170100;disorders of peptide metabolism 27604308;2365824 False 3 100;0;0 1.2304 True ENSG00000124299 ENSG00000124299 HGNC:8840 PERP gene PERP Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Olmsted syndrome 2, MIM# 619208;Erythrokeratodermia variabilis et progressiva 7, MIM# 619209 31898316;30321533;31361044 False 3 100;0;0 1.2304 True ENSG00000112378 ENSG00000112378 HGNC:17637 PET100 gene PET100 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 12, MIM# 619055 24462369;25293719;31406627 False 3 100;0;0 1.2304 True ENSG00000229833 ENSG00000229833 HGNC:40038 PEX1 gene PEX1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Heimler syndrome 1 234580;Peroxisome biogenesis disorder 1A (Zellweger) 214100;. Peroxisome biogenesis disorder 1B (NALD/IRD) 601539 26387595 False 3 100;0;0 1.2304 True ENSG00000127980 ENSG00000127980 HGNC:8850 PEX10 gene PEX10 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 6A (Zellweger) (MIM#614870);Peroxisome biogenesis disorder 6B (MIM#614871) 30640048 False 3 100;0;0 1.2304 True ENSG00000157911 ENSG00000157911 HGNC:8851 PEX11B gene PEX11B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 14B - MIM#614920 20301621;22581968 False 3 100;0;0 1.2304 True ENSG00000131779 ENSG00000131779 HGNC:8853 PEX12 gene PEX12 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 3A (Zellweger) - MIM#614859;Peroxisome biogenesis disorder 3B - MIM#266510 False 3 100;0;0 1.2304 True ENSG00000108733 ENSG00000108733 HGNC:8854 PEX13 gene PEX13 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 11A (Zellweger) - MIM#614883;Peroxisome biogenesis disorder 11B - MIM#614885 False 3 100;0;0 1.2304 True ENSG00000162928 ENSG00000162928 HGNC:8855 PEX14 gene PEX14 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 13A (Zellweger) - MIM#614887 18285423;26627464;21686775;15146459 False 3 100;0;0 1.2304 True ENSG00000142655 ENSG00000142655 HGNC:8856 PEX16 gene PEX16 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 8A (Zellweger) - MIM#614876;Peroxisome biogenesis disorder 8B - MIM#614877 20647552;12223482;9837814;11890679 False 3 100;0;0 1.2304 True ENSG00000121680 ENSG00000121680 HGNC:8857 PEX19 gene PEX19 Expert Review Green;Victorian Clinical Genetics Services Mendeliome Unknown Peroxisome biogenesis disorder 12A (Zellweger) - MIM#614886 False 3 100;0;0 1.2304 True ENSG00000162735 ENSG00000162735 HGNC:9713 PEX2 gene PEX2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 5A (Zellweger) - MIM#614866;Peroxisome biogenesis disorder 5B - MIM#614867 14630978;10528859;23430938;1546315 False 3 100;0;0 1.2304 True ENSG00000164751 ENSG00000164751 HGNC:9717 PEX26 gene PEX26 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 7A (Zellweger) - MIM#614872;Peroxisome biogenesis disorder 7B - MIM#614873 12717447;15858711;17336976 False 3 100;0;0 1.2304 True ENSG00000215193 ENSG00000215193 HGNC:22965 PEX3 gene PEX3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 10A (Zellweger), MIM# 614882;Peroxisome biogenesis disorder 10B , MIM# 617370 10942428;10958759;10968777;27557811;33101983 False 3 100;0;0 1.2304 True ENSG00000034693 ENSG00000034693 HGNC:8858 PEX5 gene PEX5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 2A (Zellweger), MIM# 214110;Peroxisome biogenesis disorder 2B, MIM# 202370;Rhizomelic chondrodysplasia punctata, type 5, MIM# 616716 7719337;26220973;20301621 False 3 100;0;0 1.2304 True ENSG00000139197 ENSG00000139197 HGNC:9719 PEX6 gene PEX6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Heimler syndrome 2, MIM# 616617;Peroxisome biogenesis disorder 4A (Zellweger), MIM# 614862;Peroxisome biogenesis disorder 4B, MIM# 614863" False 3 50;0;50 1.2304 True ENSG00000124587 ENSG00000124587 HGNC:8859 PEX7 gene PEX7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 9B, MIM# 614879;Rhizomelic chondrodysplasia punctata, type 1, MIM# 215100 11781871;12522768;12325024 False 3 100;0;0 1.2304 True ENSG00000112357 ENSG00000112357 HGNC:8860 PFKM gene PFKM Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease VII, MIM# 232800 2140573;8444874;7513946;7550225 False 3 100;0;0 1.2304 True ENSG00000152556 ENSG00000152556 HGNC:8877 PFN1 gene PFN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 18 (MIM# 614808);Paget s disease of bone 23141414;22801503;25499087;24309268;22801503;26908597;32392277;31991009;31346562;32589291;31802421;31611772;31401564;30203378;28040732 False 3 67;33;0 1.2304 True ENSG00000108518 ENSG00000108518 HGNC:8881 PGAM2 gene PGAM2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease X, MIM# 261670 8447317;34237446;30310767 False 3 100;0;0 1.2304 True ENSG00000164708 ENSG00000164708 HGNC:8889 PGAP1 gene PGAP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with dysmorphic features, spasticity, and brain abnormalities, MIM# 615802 24482476;24784135;25823418;25804403;26050939 False 3 100;0;0 1.2304 True ENSG00000197121 ENSG00000197121 HGNC:25712 PGAP2 gene PGAP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hyperphosphatasia with mental retardation syndrome 3, MIM# 614207, MONDO:0013628 23561846;23561847;31805394;29119105;27871432 False 3 100;0;0 1.2304 True ENSG00000148985 ENSG00000148985 HGNC:17893 PGAP3 gene PGAP3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hyperphosphatasia with mental retardation syndrome 4, MIM# 615716, MONDO:0014318 24439110;29620724;30345601;30217754 False 3 100;0;0 1.2304 True ENSG00000161395 ENSG00000161395 HGNC:23719 PGK1 gene PGK1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Phosphoglycerate kinase 1 deficiency, MIM# 300653;MONDO:0010392 6933565;1547346;7577653;9512313 False 3 100;0;0 1.2304 True ENSG00000102144 ENSG00000102144 HGNC:8896 PGM1 gene PGM1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type It 614921;Glycogen storage disorder XIV 19625727;24499211 False 3 100;0;0 1.2304 True ENSG00000079739 ENSG00000079739 HGNC:8905 PGM2L1 gene PGM2L1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal severe developmental and speech delay, dysmorphic facial features, ear anomalies, high arched palate, strabismus, hypotonia, and keratosis pilaris 33979636 False 3 100;0;0 1.2304 True ENSG00000165434 ENSG00000165434 HGNC:20898 PGM3 gene PGM3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 23, MIM# 615816;PGM3-CDG, MONDO:0014353 30578875;31231132;33098103;30157810;28704707 False 3 100;0;0 1.2304 True ENSG00000013375 ENSG00000013375 HGNC:8907 PHACTR1 gene PHACTR1 Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Epileptic encephalopathy, early infantile, 70, MIM# 618298" 30256902 False 3 100;0;0 1.2304 True ENSG00000112137 ENSG00000112137 HGNC:20990 PHEX gene PHEX Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Hypophosphatemic rickets, MIM#307800 False 3 100;0;0 1.2304 True ENSG00000102174 ENSG00000102174 HGNC:8918 PHF21A gene PHF21A Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability;dysmorphic features 31649809;30487643;22770980 False 3 100;0;0 1.2304 True ENSG00000135365 ENSG00000135365 HGNC:24156 PHF5A gene PHF5A Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder (MONDO#0700092), PHF5A-related PMID: 37422718 False 3 100;0;0 1.2304 True ENSG00000100410 ENSG00000100410 HGNC:18000 PHF6 gene PHF6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Borjeson-Forssman-Lehmann syndrome, MIM# 301900 16912705 False 3 100;0;0 1.2304 True ENSG00000156531 ENSG00000156531 HGNC:18145 PHF8 gene PHF8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Mental retardation syndrome, X-linked, Siderius type, MIM#300263 17661819;17594395;16199551 False 3 100;0;0 1.2304 True ENSG00000172943 ENSG00000172943 HGNC:20672 PHGDH gene PHGDH Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neu-Laxova syndrome 1 256520;Phosphoglycerate dehydrogenase deficiency 601815 24836451;25152457;11055895;19235232 False 3 100;0;0 1.2304 True ENSG00000092621 ENSG00000092621 HGNC:8923 PHIP gene PHIP Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Chung-Jansen syndrome, MIM# 617991 23033978;27900362;29209020 False 3 100;0;0 1.2304 True ENSG00000146247 ENSG00000146247 HGNC:15673 PHKA1 gene PHKA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Muscle glycogenosis, MIM# 300559 7874115;12825073;9731190 False 3 100;0;0 1.2304 True ENSG00000067177 ENSG00000067177 HGNC:8925 PHKA2 gene PHKA2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Glycogen storage disease, type IXa1 and a2, MIM# 306000 7711737;7847371;8733134 False 3 100;0;0 1.2304 True ENSG00000044446 ENSG00000044446 HGNC:8926 PHKB gene PHKB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Phosphorylase kinase deficiency of liver and muscle, autosomal recessive 261750;Glycogen storage disease IXb, MONDO:0009868 9215682;25266922;30659246 False 3 100;0;0 1.2304 True ENSG00000102893 ENSG00000102893 HGNC:8927 PHKG2 gene PHKG2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease IXc, MIM# 613027 8896567;9384616;10905889 False 3 100;0;0 1.2304 True ENSG00000156873 ENSG00000156873 HGNC:8931 PHOX2A gene PHOX2A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Fibrosis of extraocular muscles, congenital, 2 602078 11600883;18323871;16815872 False 3 50;50;0 1.2304 True ENSG00000165462 ENSG00000165462 HGNC:691 PHOX2B gene PHOX2B Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Central hypoventilation syndrome, congenital, 1, with or without Hirschsprung disease - MIM#209880;Neuroblastoma with Hirschsprung disease - MIM#613013 31444792 False 3 100;0;0 1.2304 True ENSG00000109132 ENSG00000109132 HGNC:9143 PHYH gene PHYH Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Refsum disease, MIM# 266500 9326939;9326940 False 3 100;0;0 1.2304 True ENSG00000107537 ENSG00000107537 HGNC:8940 PI4K2A gene PI4K2A Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "Neurodevelopmental disorder with hyperkinetic movements, seizures and structural brain abnormalities, MIM# 620732;Cutis laxa, intellectual disability, movement disorder" 32418222;30564627;35880319;19581584 False 3 50;0;50 1.2304 True ENSG00000155252 ENSG00000155252 HGNC:30031 PI4KA gene PI4KA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Polymicrogyria, perisylvian, with cerebellar hypoplasia and arthrogryposis, MIM# 616531;Neurodevelopmental syndrome with hypomyelinating leukodystrophy;Spastic paraplegia 84, autosomal recessive, MIM# 619621;Gastrointestinal defects and immunodeficiency syndrome 2, MIM# 619708 25855803;34415322;34415310 False 3 100;0;0 1.2304 True ENSG00000241973 ENSG00000241973 HGNC:8983 PIBF1 gene PIBF1 Expert Review;Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 33;OMIM #617767 26167768;30858804;29695797;33004012 False 3 100;0;0 1.2304 True ENSG00000083535 ENSG00000083535 HGNC:23352 PIDD1 gene PIDD1 Expert Review;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Intellectual developmental disorder, autosomal recessive 75, with neuropsychiatric features and variant lissencephaly, MIM# 619827 28397838;29302074;33414379;34163010 False 3 100;0;0 1.2304 True ENSG00000177595 ENSG00000177595 HGNC:16491 PIEZO1 gene PIEZO1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Lymphatic malformation 6, 616843;Dehydrated hereditary stomatocytosis with or without pseudohyperkalemia and/or perinatal edema, 194380;Erythrocytosis 23695678;26333996;33181827 False 3 100;0;0 1.2304 True Other ENSG00000103335 ENSG00000103335 HGNC:28993 PIEZO2 gene PIEZO2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Marden-Walker syndrome (MIM#248700);Arthrogryposis, distal, type 3 (MIM#114300);Arthrogryposis, distal, type 5 (MIM#108145);Arthrogryposis, distal, with impaired proprioception and touch, MIM# 617146 27653382;27607563;27843126;27974811;24726473 False 3 100;0;0 1.2304 True ENSG00000154864 ENSG00000154864 HGNC:26270 PIGA gene PIGA Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Multiple congenital anomalies-hypotonia-seizures syndrome 2, MIM# 300868, MONDO:0010466;Neurodevelopmental disorder with epilepsy and haemochromatosis, MIM# 301072 22305531;24357517;24706016;26545172;33333793;32694024 False 3 100;0;0 1.2304 True ENSG00000165195 ENSG00000165195 HGNC:8957 PIGB gene PIGB Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 80, MIM# 618580 31256876 False 3 100;0;0 1.2304 True ENSG00000069943 ENSG00000069943 HGNC:8959 PIGC gene PIGC Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Glycosylphosphatidylinositol biosynthesis defect 16, MIM# 617816 27694521;32707268 False 3 100;0;0 1.2304 True ENSG00000135845 ENSG00000135845 HGNC:8960 PIGG gene PIGG Expert Review;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal "Neurodevelopmental disorder with or without hypotonia, seizures, and cerebellar atrophy MIM#616917" 26996948 False 3 100;0;0 1.2304 True ENSG00000174227 ENSG00000174227 HGNC:25985 PIGH gene PIGH Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Glycosylphosphatidylinositol biosynthesis defect 17, MIM# 618010 29573052;29603516;33156547 False 3 100;0;0 1.2304 True ENSG00000100564 ENSG00000100564 HGNC:8964 PIGK gene PIGK Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with hypotonia and cerebellar atrophy, with or without seizures, MIM# 618879 32220290 False 3 100;0;0 1.2304 True ENSG00000142892 ENSG00000142892 HGNC:8965 PIGL gene PIGL Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal CHIME syndrome, MIM# 280000, MONDO:0010221 22444671;31535386;30023290;29473937;28371479;25706356 False 3 100;0;0 1.2304 True ENSG00000108474 ENSG00000108474 HGNC:8966 PIGN gene PIGN Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Multiple congenital anomalies-hypotonia-seizures syndrome 1, MIM# 614080, MONDO:0013563;Fryns syndrome 21493957;24253414;26364997;26394714;33193741;32585529;29330547 False 3 100;0;0 1.2304 True ENSG00000197563 ENSG00000197563 HGNC:8967 PIGO gene PIGO Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hyperphosphatasia with mental retardation syndrome 2, MIM# 614749, MONDO:0013882 22683086;31698102;28900819;28545593;28337824 False 3 100;0;0 1.2304 True ENSG00000165282 ENSG00000165282 HGNC:23215 PIGP gene PIGP Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 55, MIM# 617599 31139695;32042915;28334793 False 3 50;50;0 1.2304 True ENSG00000185808 ENSG00000185808 HGNC:3046 PIGQ gene PIGQ Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Epileptic encephalopathy, early infantile, 77, MIM# 618548" 25558065;24463883;31148362;32588908 False 3 100;0;0 1.2304 True ENSG00000007541 ENSG00000007541 HGNC:14135 PIGS gene PIGS Expert Review;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Glycosylphosphatidylinositol biosynthesis defect 18 618143" 30269814 False 3 100;0;0 1.2304 True ENSG00000087111 ENSG00000087111 HGNC:14937 PIGT gene PIGT Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Multiple congenital anomalies-hypotonia-seizures syndrome 3, MIM# 615398, MONDO:0014165 30976099;25943031;24906948;24906948;24906948;28728837;28728837;28728837 False 3 100;0;0 1.2304 True ENSG00000124155 ENSG00000124155 HGNC:14938 PIGU gene PIGU Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Glycosylphosphatidylinositol biosynthesis defect 21;OMIM #618590 31353022 False 3 100;0;0 1.2304 True ENSG00000101464 ENSG00000101464 HGNC:15791 PIGV gene PIGV Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hyperphosphatasia with mental retardation syndrome 1, MIM# 239300, MONDO:0009398 20802478;22315194;28817240;24129430 False 3 100;0;0 1.2304 True ENSG00000060642 ENSG00000060642 HGNC:26031 PIGW gene PIGW Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Glycosylphosphatidylinositol biosynthesis defect 11, MIM# 616025 24367057;27626616;30813920;32198969 False 3 100;0;0 1.2304 True ENSG00000184886 ENSG00000277161 HGNC:23213 PIH1D3 gene PIH1D3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Ciliary dyskinesia, primary, 36, X-linked (MIM#300991) 28041644;24421334;28176794 False 3 100;0;0 1.2304 True ENSG00000080572 ENSG00000080572 HGNC:28570 PIK3C2A gene PIK3C2A Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Oculoskeletodental syndrome, MIM# 618440 31034465 False 3 100;0;0 1.2304 True ENSG00000011405 ENSG00000011405 HGNC:8971 PIK3CA gene PIK3CA Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Megalencephaly-capillary malformation (MCAP) syndrome , MIM#602501;CLAPO syndrome, somatic, MIM# 613089;CLOVE syndrome, somatic, MIM# 612918 False 3 100;0;0 1.2304 True ENSG00000121879 ENSG00000121879 HGNC:8975 PIK3CD gene PIK3CD Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Immunodeficiency 14B, autosomal recessive, MIM# 619281;Immunodeficiency 14A, autosomal dominant, MIM# 615513 30040974;30336224;29180244;16984281;24136356;24165795;24610295 False 3 100;0;0 1.2304 True ENSG00000171608 ENSG00000171608 HGNC:8977 PIK3CG gene PIK3CG Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "Immunodeficiency 97 with autoinflammation, MIM# 619802;Immune dysregulation;HLH-like;childhood-onset antibody defects;cytopenias;T lymphocytic pneumonitis and colitis" 32001535;31554793 False 3 100;0;0 1.2304 True ENSG00000105851 ENSG00000105851 HGNC:8978 PIK3R1 gene PIK3R1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted SHORT syndrome, MIM # 269880;Immunodeficiency 36, MIM#616005 32048120;27076228;23810378;23810379;23810382 False 3 100;0;0 1.2304 True ENSG00000145675 ENSG00000145675 HGNC:8979 PIK3R2 gene PIK3R2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 1, MIM# 603387 22729224;23745724;33604570 False 3 100;0;0 1.2304 True ENSG00000105647 ENSG00000105647 HGNC:8980 PIKFYVE gene PIKFYVE Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Corneal fleck dystrophy, MIM# 121850 15902656;23288988;26396486 False 3 100;0;0 1.2304 True ENSG00000115020 ENSG00000115020 HGNC:23785 PIP5K1C gene PIP5K1C Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodevelopmental disorder and microcephaly, MONDO:0700092, PIP5K1C-related;Lethal congenital contractural syndrome 3, MIM# 611369 17701898;37451268 False 3 50;50;0 1.2304 True ENSG00000186111 ENSG00000186111 HGNC:8996 PISD gene PISD Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Liberfarb syndrome, MIM# 618889;Intellectual disability;cataracts;retinal degeneration;microcephaly;deafness;short stature;white matter abnormalities 31263216;30858161 False 3 100;0;0 1.2304 True ENSG00000241878 ENSG00000241878 HGNC:8999 PITRM1 gene PITRM1 Expert list;Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia-30 (SCAR30), MIM#619405;intellectual disability;cognitive decline;psychosis 26697887;29764912;29383861 False 3 100;0;0 1.2304 True ENSG00000107959 ENSG00000107959 HGNC:17663 PITX1 gene PITX1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Brachydactyly-elbow wrist dysplasia syndrome, MONDO:0008520;Clubfoot, MONDO:0007342;Liebenberg syndrome, OMIM:186550;Clubfoot, congenital, with or without deficiency of long bones and/or mirror-image polydactyly, OMIM:119800 21775501;22258522;18950742 False 3 100;0;0 1.2304 True ENSG00000069011 ENSG00000069011 HGNC:9004 PITX2 gene PITX2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Anterior segment dysgenesis 4, MIM# 137600;Axenfeld-Rieger syndrome, type 1, MIM# 180500 32499604;32400113;31341655;31185933;30457409 False 3 100;0;0 1.2304 True ENSG00000164093 ENSG00000164093 HGNC:9005 PITX3 gene PITX3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Anterior segment dysgenesis 1, multiple subtypes, MIM# 107250;Cataract 11, multiple types, MIM# 610623;Microphthalmia MONDO:0021129 29405783 False 3 100;0;0 1.2304 True ENSG00000107859 ENSG00000107859 HGNC:9006 PKD1 gene PKD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Polycystic kidney disease 1, MIM# 173900 False 3 100;0;0 1.2304 True ENSG00000008710 ENSG00000008710 HGNC:9008 PKD1L1 gene PKD1L1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Heterotaxy, visceral, 8, autosomal (MIM#617205) 27616478;30664273;20080492;31026592 False 3 100;0;0 1.2304 True ENSG00000158683 ENSG00000158683 HGNC:18053 PKD2 gene PKD2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Polycystic kidney disease 2, MIM# 613095 False 3 100;0;0 1.2304 True ENSG00000118762 ENSG00000118762 HGNC:9009 PKDCC gene PKDCC Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Rhizomelic limb shortening with dysmorphic features, MIM# 618821 30478137;19097194;36896672 False 3 50;50;0 1.2304 True ENSG00000162878 ENSG00000162878 HGNC:25123 PKHD1 gene PKHD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Polycystic kidney disease 4, with or without hepatic disease, MIM# 263200;Nephrocalcinosis, MONDO:0001567, PKHD1-related 28375157;21945273 False 3 100;0;0 1.2304 True ENSG00000170927 ENSG00000170927 HGNC:9016 PKHD1L1 gene PKHD1L1 Expert Review Green;Other Mendeliome BIALLELIC, autosomal or pseudoautosomal non syndromic hearing loss (MONDO:0020678) 38459354 False 3 100;0;0 1.2304 True ENSG00000205038 ENSG00000205038 HGNC:20313 PKLR gene PKLR Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pyruvate kinase deficiency, MIM# 266200;Adenosine triphosphate, elevated, of erythrocytes, MIM# 102900 1896471;9160692;9057665;16704447;9090535 False 3 100;0;0 1.2304 True ENSG00000143627 ENSG00000143627 HGNC:9020 PKP1 gene PKP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ectodermal dysplasia/skin fragility syndrome, MIM# 604536 24073657;16781314;11994137;10951270;32346906 False 3 100;0;0 1.2304 True ENSG00000081277 ENSG00000081277 HGNC:9023 PLA2G16 gene PLA2G16 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Lipodystrophy, familial partial, type 9, MIM# 620683 PMID: 37919452 False 3 100;0;0 1.2304 True ENSG00000176485 ENSG00000176485 HGNC:17825 PLA2G4A gene PLA2G4A Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Gastrointestinal ulceration, recurrent, with dysfunctional platelets, MIM# 618372 18451993;25102815;23268370 False 3 100;0;0 1.2304 True ENSG00000116711 ENSG00000116711 HGNC:9035 PLA2G5 gene PLA2G5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal [Fleck retina, familial benign], MIM# 228980 22137173 False 3 100;0;0 1.2304 True ENSG00000127472 ENSG00000127472 HGNC:9038 PLAA gene PLAA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with progressive microcephaly, spasticity, and brain anomalies, MIM# 617527 28007986;28413018;31322726 False 3 100;0;0 1.2304 True ENSG00000137055 ENSG00000137055 HGNC:9043 PLAG1 gene PLAG1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Silver-Russell syndrome, MIM#618907 28796236;29913240;33291420;32546215 False 3 100;0;0 1.2304 True ENSG00000181690 ENSG00000181690 HGNC:9045 PLAU gene PLAU Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Quebec platelet disorder, MIM# 601709" 20007542 False 3 100;0;0 1.2304 True ENSG00000122861 ENSG00000122861 HGNC:9052 PLCB1 gene PLCB1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Epileptic encephalopathy, early infantile, 12 (MIM#613722) 24684524;20833646;22690784;26818157 False 3 100;0;0 1.2304 True ENSG00000182621 ENSG00000182621 HGNC:15917 PLCB4 gene PLCB4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Auriculocondylar syndrome 2A, MIM# 614669;Auriculocondylar syndrome 2B, MIM# 620458 22560091;23315542;33131036;32201334;28328130;27007857;23913798 False 3 100;0;0 1.2304 True ENSG00000101333 ENSG00000101333 HGNC:9059 PLCD1 gene PLCD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Nail disorder, nonsyndromic congenital, 3, (leukonychia) MIM#151600;nonsyndromic congenital nail disorder 3 MONDO:0007900 21665001;22458588;21665001;30003652;33786625;31082376;32265483;31049339 False 3 100;0;0 1.2304 True ENSG00000187091 ENSG00000187091 HGNC:9060 PLCE1 gene PLCE1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Nephrotic syndrome, type 3, MIM# 610725 17086182;18065803;20591883 False 3 100;0;0 1.2304 True ENSG00000138193 ENSG00000138193 HGNC:17175 PLCG2 gene PLCG2 Expert Review Green;Literature;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Common variable immunodeficiency;Autoinflammation, antibody deficiency, and immune dysregulation syndrome MIM#614878 31853824;32671674;22236196 False 3 100;0;0 1.2304 True Other ENSG00000197943 ENSG00000197943 HGNC:9066 PLD1 gene PLD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cardiac valvular defect, developmental, MIM# 212093;neonatal cardiomyopathy 27799408;33645542 False 3 100;0;0 1.2304 True ENSG00000075651 ENSG00000075651 HGNC:9067 PLEC gene PLEC Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Epidermolysis bullosa simplex with nail dystrophy, MIM# 616487;Epidermolysis bullosa simplex with muscular dystrophy, MIM# 226670;Epidermolysis bullosa simplex with pyloric atresia, MIM# 612138;Epidermolysis bullosa simplex, Ogna type MIM#131950;Muscular dystrophy, limb-girdle, autosomal recessive 17, MIM# 613723;Progressive familial intrahepatic cholestasis, MONDO:0015762, PLEC-related" 22144912;39168815 False 3 50;50;0 1.2304 True ENSG00000178209 ENSG00000178209 HGNC:9069 PLEKHG5 gene PLEKHG5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, recessive intermediate C, MIM# 615376;Spinal muscular atrophy, distal, autosomal recessive, 4, MIM# 611067 17564964;23777631;23844677;33492783;33275839;33220101;23777631 False 3 100;0;0 1.2304 True ENSG00000171680 ENSG00000171680 HGNC:29105 PLEKHM1 gene PLEKHM1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Osteopetrosis, autosomal dominant 3, MIM# 618107;Osteopetrosis, autosomal recessive 6 , MIM# 611497 27291868;21054159;17997709;17404618;28290981 False 3 100;0;0 1.2304 True ENSG00000225190 ENSG00000225190 HGNC:29017 PLG gene PLG Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hereditary angioedema-4 (HAE4), MIM#619360;Plasminogen deficiency, type I, MIM# 217090 28795768;29548426;29987869;9242524;10233898 False 3 100;0;0 1.2304 True ENSG00000122194 ENSG00000122194 HGNC:9071 PLK1 gene PLK1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Epilepsy;microcephaly;intellectual disability 33875846 False 3 100;0;0 1.2304 True ENSG00000166851 ENSG00000166851 HGNC:9077 PLK4 gene PLK4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephaly and chorioretinopathy, autosomal recessive, 2, MIM# 616171 25344692;25320347;27650967 False 3 100;0;0 1.2304 True ENSG00000142731 ENSG00000142731 HGNC:11397 PLN gene PLN Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cardiomyopathy, dilated, 1P, MIM# 609909;Cardiomyopathy, hypertrophic, 18 (MIM #613874) 33947203 False 3 100;0;0 1.2304 True ENSG00000198523 ENSG00000198523 HGNC:9080 PLOD1 gene PLOD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ehlers-Danlos syndrome, kyphoscoliotic type, 1, MIM## 225400 28306225 False 3 100;0;0 1.2304 True ENSG00000083444 ENSG00000083444 HGNC:9081 PLOD2 gene PLOD2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bruck syndrome 2, MIM# 609220 22689593;12881513;33664768;33778323;29178448 False 3 100;0;0 1.2304 True ENSG00000152952 ENSG00000152952 HGNC:9082 PLOD3 gene PLOD3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal False 3 100;0;0 1.2304 True ENSG00000106397 ENSG00000106397 HGNC:9083 PLP1 gene PLP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Pelizaeus-Merzbacher disease MIM#312080;Spastic paraplegia 2, X-linked MIM#312920 20301361 False 3 100;0;0 1.2304 True ENSG00000123560 ENSG00000123560 HGNC:9086 PLPBP gene PLPBP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Epilepsy, early-onset, vitamin B6-dependent, MIM#617290 29689137;27912044;30668673 False 3 100;0;0 1.2304 True ENSG00000147471 ENSG00000147471 HGNC:9457 PLS1 gene PLS1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Deafness, autosomal dominant 76, MIM# 618787 31397523;31432506;30872814 False 3 100;0;0 1.2304 True ENSG00000120756 ENSG00000120756 HGNC:9090 PLS3 gene PLS3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Bone mineral density QTL18, osteoporosis - MIM#300910;Diaphragmatic hernia 5, X-linked, MIM# 306950 32655496;25209159;29736964;29884797;28777485;24088043;37751738 False 3 100;0;0 1.2304 True ENSG00000102024 ENSG00000102024 HGNC:9091 PLVAP gene PLVAP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Diarrhoea 10, protein-losing enteropathy type, MIM# 618183 29875123;29661969;26207260;31215290 False 3 100;0;0 1.2304 True ENSG00000130300 ENSG00000130300 HGNC:13635 PLXNA1 gene PLXNA1 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Dworschak-Punetha neurodevelopmental syndrome, MIM# 619955 34054129 False 3 100;0;0 1.2304 True ENSG00000114554 ENSG00000114554 HGNC:9099 PLXNA3 gene PLXNA3 Expert Review Green;Literature Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Hypogonadotropic hypogonadism 33495532 False 3 100;0;0 1.2304 True ENSG00000130827 ENSG00000130827 HGNC:9101 PLXNB2 gene PLXNB2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Syndromic disease MONDO:0002254, PLXNB2 -related PMID: 38458752 False 3 100;0;0 1.2304 True ENSG00000196576 ENSG00000196576 HGNC:9104 PLXND1 gene PLXND1 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal M bius syndrome, MONDO:0008006;Congenital heart defects, multiple types, 9, MIM# 620294 26068067;35396997 False 3 100;0;0 1.2304 True ENSG00000004399 ENSG00000004399 HGNC:9107 PMFBP1 gene PMFBP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Male infertility with teratozoospermia due to single gene mutation, MONDO:0018394 33484382;33452591;32285443 False 3 100;0;0 1.2304 True ENSG00000118557 ENSG00000118557 HGNC:17728 PMM2 gene PMM2 Expert Review;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Ia (MIM#212065);Hyperinsulinaemic Hypoglycaemia and Polycystic Kidney Disease (HIPKD), MONDO:0020642, PMM2-related 28108845;28373276;32595772 False 3 50;50;0 1.2304 True ENSG00000140650 ENSG00000140650 HGNC:9115 PMP22 gene PMP22 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, type 1A, MIM# 118220;Charcot-Marie-Tooth disease, type 1E, MIM# 118300;Dejerine-Sottas disease, MIM# 145900;Neuropathy, recurrent, with pressure palsies 162500;Roussy-Levy syndrome 180800 32356557 False 3 100;0;0 1.2304 True ENSG00000109099 ENSG00000109099 HGNC:9118 PMPCA gene PMPCA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 2, MIM# 213200 25808372;26657514;33272776;30617178 False 3 100;0;0 1.2304 True ENSG00000165688 ENSG00000165688 HGNC:18667 PMPCB gene PMPCB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Multiple mitochondrial dysfunctions syndrome 6, MIM# 617954 29576218 False 3 100;0;0 1.2304 True ENSG00000105819 ENSG00000105819 HGNC:9119 PMVK gene PMVK Expert Review;Expert Review Green Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Porokeratosis 1, multiple types, MIM# 175800;Autoinflammatory syndrome, MONDO:0019751, PMVK-related 26202976;37364720;36410683 False 3 100;0;0 1.2304 True ENSG00000163344 ENSG00000163344 HGNC:9141 PNKD gene PNKD Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Paroxysmal nonkinesigenic dyskinesia 1, MIM# 118800;MONDO:0007326 15262732;15496428;15824259;19124534;21487022 False 3 100;0;0 1.2304 True ENSG00000127838 ENSG00000127838 HGNC:9153 PNKP gene PNKP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ataxia-oculomotor apraxia 4, MIM#616267;Microcephaly, seizures, and developmental delay, MIM#613402 31436889;31707899 False 3 100;0;0 1.2304 True ENSG00000039650 ENSG00000039650 HGNC:9154 PNLDC1 gene PNLDC1 Expert Review;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Spermatogenic failure 57, MIM# 619528" 34347949 False 3 100;0;0 1.2304 True ENSG00000146453 ENSG00000146453 HGNC:21185 PNP gene PNP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency due to purine nucleoside phosphorylase deficiency, MIM# 613179 3029074;1384322;11453975;32695102;32514656 False 3 100;0;0 1.2304 True ENSG00000198805 ENSG00000198805 HGNC:7892 PNPLA1 gene PNPLA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ichthyosis, congenital, autosomal recessive 10, MIM# 615024 22246504;24344921;26691440 False 3 100;0;0 1.2304 True ENSG00000180316 ENSG00000180316 HGNC:21246 PNPLA2 gene PNPLA2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neutral lipid storage disease with myopathy MIM#610717 18952067;25287355;25956450;21544567 False 3 100;0;0 1.2304 True ENSG00000177666 ENSG00000177666 HGNC:30802 PNPLA6 gene PNPLA6 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Boucher-Neuhauser syndrome, 215470;?Laurence-Moon syndrome, 245800;Oliver-McFarlane syndrome, 275400;Spastic paraplegia 39, autosomal recessive, 612020 25480986;24355708;33818269;32758583;30097146 False 3 100;0;0 1.2304 True ENSG00000032444 ENSG00000032444 HGNC:16268 PNPLA8 gene PNPLA8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Complex neurodevelopmental disorder, MONDO:0100038, PNPLA8-related;Mitochondrial myopathy with lactic acidosis (MIM#251950), AR 29681094;25512002 False 3 100;0;0 1.2304 True ENSG00000135241 ENSG00000135241 HGNC:28900 PNPO gene PNPO Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pyridoxamine 5'-phosphate oxidase deficiency, MIM# 610090 34769443;33981986;33748042;32888189 False 3 100;0;0 1.2304 True ENSG00000108439 ENSG00000108439 HGNC:30260 PNPT1 gene PNPT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 13 (MIM#614932);Deafness, autosomal recessive 70 (MIM#614934);Spinocerebellar ataxia 25, MIM# 608703 31752325;30244537;28594066;28645153;33199448;33199448 False 3 67;33;0 1.2304 True ENSG00000138035 ENSG00000138035 HGNC:23166 POC1A gene POC1A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Short stature, onychodysplasia, facial dysmorphism, and hypotrichosis, MIM# 614813 22840364;22840363;26374189;26162852;26791357 False 3 100;0;0 1.2304 True ENSG00000164087 ENSG00000164087 HGNC:24488 POC1B gene POC1B Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cone-rod dystrophy 20 (MIM#615973) 25018096;24945461;25044745;29220607;29377742;31390656 False 3 50;0;50 1.2304 True ENSG00000139323 ENSG00000139323 HGNC:30836 POC5 gene POC5 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Idiopathic scoliosis;retinitis pigmentosa;short stature;microcephaly;recurrent glomerulonephritis 25642776;29272404 False 3 100;0;0 1.2304 True ENSG00000152359 ENSG00000152359 HGNC:26658 PODXL gene PODXL Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Nephrotic syndrome, MONDO:0005377, PODXL-related 30523047;29244787;28117080;24048372 False 3 100;0;0 1.2304 True ENSG00000128567 ENSG00000128567 HGNC:9171 POFUT1 gene POFUT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dowling-Degos disease 2 (MIM# 615327) 23684010;29452367;25157627 False 3 100;0;0 1.2304 True ENSG00000101346 ENSG00000101346 HGNC:14988 POGLUT1 gene POGLUT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 21 (MIM# 617232), Dowling-Degos disease 4 (MIM# 615696) 27807076;24387993 False 3 100;0;0 1.2304 True ENSG00000163389 ENSG00000163389 HGNC:22954 POGZ gene POGZ Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted White-Sutton syndrome, MIM# 616364 26942287;26739615 False 3 50;50;0 1.2304 True ENSG00000143442 ENSG00000143442 HGNC:18801 POLA1 gene POLA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Pigmentary disorder, reticulate, with systemic manifestations, X-linked, MIM# 301220;Van Esch-O'Driscoll syndrome OMIM# 301030 27019227;31006512 False 3 100;0;0 1.2304 True ENSG00000101868 ENSG00000101868 HGNC:9173 POLA2 gene POLA2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Telomere biology syndrome MONDO:0100137 39616267 False 3 100;0;0 1.2304 True ENSG00000014138 ENSG00000014138 HGNC:30073 POLD1 gene POLD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Mandibular hypoplasia, deafness, progeroid features, and lipodystrophy syndrome, MIM# 615381;MONDO:0014157;Immunodeficiency 120, MIM# 620836" 31629014;31449058;23770608;33618333;33369179;32826474;30023403;29199204;28791128 False 3 100;0;0 1.2304 True ENSG00000062822 ENSG00000062822 HGNC:9175 POLD3 gene POLD3 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 122, MIM# 620869 37030525;36395985;27524497;38099988 False 3 50;50;0 1.2304 True ENSG00000077514 ENSG00000077514 HGNC:20932 POLE gene POLE Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal FILS syndrome, 615139;IMAGE-I syndrome, 618336;{Colorectal cancer, susceptibility to, 12}, 615083 30503519;23230001 False 3 100;0;0 1.2304 True Other ENSG00000177084 ENSG00000177084 HGNC:9177 POLG gene POLG Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 4A (Alpers type) MIM#203700;Mitochondrial DNA depletion syndrome 4B (MNGIE type) MIM#613662;Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) MIM#607459;Progressive external ophthalmoplegia, autosomal recessive 1 MIM#258450;Progressive external ophthalmoplegia, autosomal dominant 1, MIM# 157640 30451971 False 3 100;0;0 1.2304 True ENSG00000140521 ENSG00000140521 HGNC:9179 POLG2 gene POLG2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 4, MIM# 610131;Mitochondrial DNA depletion syndrome 16 , MIM# 618528 16685652;21555342;27592148;31778857 False 3 100;0;0 1.2304 True ENSG00000256525 ENSG00000256525 HGNC:9180 POLH gene POLH Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Xeroderma pigmentosum, variant type, MIM# 278750;MONDO:0010214 10385124;10398605 False 3 100;0;0 1.2304 True ENSG00000170734 ENSG00000170734 HGNC:9181 POLR1A gene POLR1A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 27, MIM# 620675;Acrofacial dysostosis, Cincinnati type, (MIM#616462) 25913037;28051070;36917474 False 3 67;33;0 1.2304 True ENSG00000068654 ENSG00000068654 HGNC:17264 POLR1B gene POLR1B Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Treacher-Collins syndrome type 4 31649276 False 3 50;50;0 1.2304 True ENSG00000125630 ENSG00000125630 HGNC:20454 POLR1C gene POLR1C Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Treacher Collins syndrome 3, MIM# 248390;Leukodystrophy, hypomyelinating, 11, MIM# 616494 21131976;30957429;26151409;32042905 False 3 100;0;0 1.2304 True ENSG00000171453 ENSG00000171453 HGNC:20194 POLR1D gene POLR1D Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Treacher Collins syndrome 2, MIM# 613717 21131976;24603435;27448281;25790162 False 3 100;0;0 1.2304 True ENSG00000186184 ENSG00000186184 HGNC:20422 POLR2A gene POLR2A Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Neurodevelopmental disorder with hypotonia and variable intellectual and behavioral abnormalities, MIM# 618603" 31353023 False 3 100;0;0 1.2304 True Other ENSG00000181222 ENSG00000181222 HGNC:9187 POLR3A gene POLR3A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 7, with or without oligodontia and/or hypogonadotropic hypogonadism, MIM# 607694;Wiedemann-Rautenstrauch syndrome, MIM# 264090;Susceptibility to severe VZV infection;POLR3A-related spastic ataxia 31637490 False 3 100;0;0 1.2304 True ENSG00000148606 ENSG00000148606 HGNC:30074 POLR3B gene POLR3B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, demyelinating, type 1I, MIM# 619742;Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism, MIM# 614381 33417887;22036171;22036172 False 3 100;0;0 1.2304 True ENSG00000013503 ENSG00000013503 HGNC:30348 POLR3K gene POLR3K Expert Review;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal POLR3-related leukodystrophy MONDO:0700282 30584594;33659930;https://doi.org/10.1155/2024/8807171 False 3 50;50;0 1.2304 True ENSG00000161980 ENSG00000161980 HGNC:14121 POLRMT gene POLRMT Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 55, MIM# 619743;intellectual disability;hypotonia 33602924 False 3 100;0;0 1.2304 True ENSG00000099821 ENSG00000099821 HGNC:9200 POMC gene POMC Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Obesity, adrenal insufficiency, and red hair due to POMC deficiency MIM#609734 33666293 False 3 100;0;0 1.2304 True ENSG00000115138 ENSG00000115138 HGNC:9201 POMGNT1 gene POMGNT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 8 MIM#614830;Muscular dystrophy-dystroglycanopathy (limb-girdle) type C, 8 MIM#618135;Retinitis pigmentosa 76 617123 27391550;26908613;30961548;30937090 False 3 100;0;0 1.2304 True ENSG00000085998 ENSG00000085998 HGNC:19139 POMGNT2 gene POMGNT2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 8, MIM# 614830;Muscular dystrophy-dystroglycanopathy (limb-girdle) type C, 8, MIM# 618135 34301702;27066570;26060116;22958903 False 3 100;0;0 1.2304 True ENSG00000144647 ENSG00000144647 HGNC:25902 POMK gene POMK Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 12, MIM# 615249;Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 12, MIM# 616094 32907597;31833209;29910097;28109637;24925318;24556084 False 3 100;0;0 1.2304 True ENSG00000185900 ENSG00000185900 HGNC:26267 POMP gene POMP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Keratosis linearis with ichthyosis congenita and sclerosing keratoderma MIM#601952;Proteasome-associated autoinflammatory syndrome 2, MIM# 618048 20226437;27503413;29805043 False 3 100;0;0 1.2304 True ENSG00000132963 ENSG00000132963 HGNC:20330 POMT1 gene POMT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 1 236670;Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 1 613155;Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 1 609308 False 3 100;0;0 1.2304 True ENSG00000130714 ENSG00000130714 HGNC:9202 POMT2 gene POMT2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 2 613150;Muscular dystrophy-dystroglycanopathy (congenital with mental retardation), type B, 2 613156;Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 2 613158 False 3 100;0;0 1.2304 True ENSG00000009830 ENSG00000009830 HGNC:19743 POP1 gene POP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Anauxetic dysplasia 2, OMIM:617396;Anauxetic dysplasia 2, MONDO:0054561 21455487;27380734;28067412 False 3 100;0;0 1.2304 True ENSG00000104356 ENSG00000104356 HGNC:30129 POPDC2 gene POPDC2 Expert Review Green;Other Mendeliome BIALLELIC, autosomal or pseudoautosomal Sinoatrial node disorder, MONDO:0000469, POPDC2-related False 3 100;0;0 1.2304 True ENSG00000121577 ENSG00000121577 HGNC:17648 POPDC3 gene POPDC3 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 26, MIM# 618848 31610034 False 3 100;0;0 1.2304 True ENSG00000132429 ENSG00000132429 HGNC:17649 POR gene POR Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Antley-Bixler syndrome with genital anomalies and disordered steroidogenesis, MIM#201750;Disordered steroidogenesis due to cytochrome P450 oxidoreductase, MIM#613571 27068427 False 3 100;0;0 1.2304 True ENSG00000127948 ENSG00000127948 HGNC:9208 PORCN gene PORCN Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Focal dermal hypoplasia, MIM# 305600 False 3 100;0;0 1.2304 True ENSG00000102312 ENSG00000102312 HGNC:17652 POU1F1 gene POU1F1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Pituitary hormone deficiency, combined, 1 MIM# 613038;pituitary hypoplasia;severe growth failure;combined GH, PRL and TSH deficiency;distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils) 1302000;1472057;9392392;15928241;7833912;12773133 False 3 100;0;0 1.2304 True ENSG00000064835 ENSG00000064835 HGNC:9210 POU3F2 gene POU3F2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Autism spectrum disorder, NDD, and adolescent-onset obesity;neurodevelopmental disorder MONDO:0700092, POU3F2-related PMID: 37207645 False 3 100;0;0 1.2304 True Other ENSG00000184486 ENSG00000184486 HGNC:9215 POU3F3 gene POU3F3 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Snijders Blok-Fisher syndrome MIM#618604 24550763;31303265 False 3 100;0;0 1.2304 True ENSG00000198914 ENSG00000198914 HGNC:9216 POU3F4 gene POU3F4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Deafness, X-linked 2, MIM#304400 31786483;30176854 False 3 100;0;0 1.2304 True ENSG00000196767 ENSG00000196767 HGNC:9217 POU4F1 gene POU4F1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Childhood-onset ataxia, intention tremor, and hypotonia syndrome (ATITHS) , MIM#619352 33783914;8876243 False 3 100;0;0 1.2304 True ENSG00000152192 ENSG00000152192 HGNC:9218 POU4F3 gene POU4F3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Deafness, autosomal dominant 15, MIM# 602459 18228599;9506947;20434433;28545070;15254021;8637595 False 3 100;0;0 1.2304 True ENSG00000091010 ENSG00000091010 HGNC:9220 PPA2 gene PPA2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Sudden cardiac failure, alcohol-induced, 617223;Sudden cardiac failure, infantile, 617222 27523598;34400813 False 3 100;0;0 1.2304 True ENSG00000138777 ENSG00000138777 HGNC:28883 PPARG gene PPARG Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Lipodystrophy, familial partial, type 3, MIM# 604367;MONDO:0011448 10622252;12453919;11788685;31863320 False 3 100;0;0 1.2304 True ENSG00000132170 ENSG00000132170 HGNC:9236 PPCS gene PPCS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cardiomyopathy, dilated, 2C, MIM# 618189 35616428;29754768 False 3 50;50;0 1.2304 True ENSG00000127125 ENSG00000127125 HGNC:25686 PPFIA3 gene PPFIA3 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, PPFIA3-related 38723631 False 3 100;0;0 1.2304 True ENSG00000177380 ENSG00000177380 HGNC:9247 PPFIBP1 gene PPFIBP1 Expert Review;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with seizures, microcephaly, and brain abnormalities, MIM# 620024 35830857 False 3 100;0;0 1.2304 True ENSG00000110841 ENSG00000110841 HGNC:9249 PPIB gene PPIB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Osteogenesis imperfecta, type IX, MIM# 259440 19781681;32392875 False 3 100;0;0 1.2304 True ENSG00000166794 ENSG00000166794 HGNC:9255 PPIL1 gene PPIL1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 14, MIM# 619301;microcephaly;seizures 33220177 False 3 100;0;0 1.2304 True ENSG00000137168 ENSG00000137168 HGNC:9260 PPM1D gene PPM1D Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Jansen de Vries syndrome, MIM #617450 28343630;31916397;30795918;29758292 False 3 100;0;0 1.2304 True ENSG00000170836 ENSG00000170836 HGNC:9277 PPOX gene PPOX Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Porphyria variegata , MIM#176200;Variegate porphyria, childhood-onset, MIM# 620483 12357337;32247286;23324528;27982422;9811936;11286631;33159949 False 3 100;0;0 1.2304 True ENSG00000143224 ENSG00000143224 HGNC:9280 PPP1CB gene PPP1CB Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Noonan syndrome-like disorder with loose anagen hair 2, OMIM # 617506 32476286;28211982;27264673;27681385;27868344 False 3 100;0;0 1.2304 True ENSG00000213639 ENSG00000213639 HGNC:9282 PPP1R12A gene PPP1R12A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability;holoprosencephaly;disorder of sex development 31883643 False 3 100;0;0 1.2304 True ENSG00000058272 ENSG00000058272 HGNC:7618 PPP1R13L gene PPP1R13L Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Arrhythmogenic cardiomyopathy with or without ectodermal abnormalities, MIM#620519 32666529;28864777 False 3 100;0;0 1.2304 True ENSG00000104881 ENSG00000104881 HGNC:18838 PPP1R21 gene PPP1R21 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "Neurodevelopmental disorder with hypotonia, facial dysmorphism, and brain abnormalities, MIM# 619383;Hypotonia;intellectual disability;white matter abnormalities" 30520571 False 3 100;0;0 1.2304 True ENSG00000162869 ENSG00000162869 HGNC:30595 PPP1R3F gene PPP1R3F Expert Review Green;Literature Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Neurodevelopmental Disorder, MONDO:0700092,PPP1R3F-related 37531237 False 3 100;0;0 1.2304 True ENSG00000049769 ENSG00000049769 HGNC:14944 PPP2CA gene PPP2CA Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder and language delay with or without structural brain abnormalities;OMIM #618354 30595372 False 3 100;0;0 1.2304 True ENSG00000113575 ENSG00000113575 HGNC:9299 PPP2R1A gene PPP2R1A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 36, MIM#616362;Microcephaly-corpus callosum hypoplasia-intellectual disability-facial dysmorphism syndrome, MONDO:0014605 26168268;33106617 False 3 100;0;0 1.2304 True ENSG00000105568 ENSG00000105568 HGNC:9302 PPP2R3C gene PPP2R3C Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Gonadal dysgenesis, dysmorphic facies, retinal dystrophy, and myopathy, OMIM # 618419 30893644;34714774;34750818 False 3 100;0;0 1.2304 True ENSG00000092020 ENSG00000092020 HGNC:17485 PPP2R5C gene PPP2R5C Expert Review Green;Research Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, PPP2R5C-related (MONDO:070092);macrocephaly;intellectual disability 25972378 False 3 50;50;0 1.2304 True ENSG00000078304 ENSG00000078304 HGNC:9311 PPP2R5D gene PPP2R5D Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Houge-Janssens syndrome 1, MIM#616355 32074998;26168268 False 3 100;0;0 1.2304 True Other ENSG00000112640 ENSG00000112640 HGNC:9312 PPP3CA gene PPP3CA Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 91, MIM#617711;Arthrogryposis, cleft palate, craniosynostosis and impaired intellectual development, MIM#618265 29432562;32593294 False 3 100;0;0 1.2304 True ENSG00000138814 ENSG00000138814 HGNC:9314 PPT1 gene PPT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 1, MIM# 256730;MONDO:0009744 7637805;9425237;9664077 False 3 100;0;0 1.2304 True ENSG00000131238 ENSG00000131238 HGNC:9325 PQBP1 gene PQBP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Renpenning syndrome, MIM#309500 31840929;14634649;20410308 False 3 100;0;0 1.2304 True Other ENSG00000102103 ENSG00000102103 HGNC:9330 PQLC2 gene PQLC2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Retinitis pigmentosa, MONDO:0019200, PQLC2-related PMID: 35486108;and online publication GiM Open Feb 2024 False 3 100;0;0 1.2304 True ENSG00000040487 ENSG00000040487 HGNC:26001 PRCD gene PRCD Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Retinitis pigmentosa 36, MIM# 610599 16938425;20507925;33087780;31640229;31189593;26497376 False 3 100;0;0 1.2304 True ENSG00000214140 ENSG00000214140 HGNC:32528 PRDM12 gene PRDM12 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neuropathy, hereditary sensory and autonomic, type VIII, MIM# 616488;MONDO:0014662 26005867;33789102;33010785;32828702 False 3 100;0;0 1.2304 True ENSG00000130711 ENSG00000130711 HGNC:13997 PRDM13 gene PRDM13 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Chorioretinal atrophy, progressive bifocal, MIM# 600790;Pontocerebellar hypoplasia, type 17, MIM# 619909;Cerebellar dysfunction, impaired intellectual development, and hypogonadotropic hypogonadism, MIM# 61976 30710461;34730112;35390279;34730112 False 3 67;33;0 1.2304 True Other ENSG00000112238 ENSG00000112238 HGNC:13998 PRDM16 gene PRDM16 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cardiomyopathy, dilated, 1LL MIM#615373;Left ventricular noncompaction 8 MIM#615373 23768516;29367541;34915728;31965688;29367541;29367541;29447731;30847666;33082984;32183154;33500567;34540771;34350506;34935411 False 3 50;50;0 1.2304 True ENSG00000142611 ENSG00000142611 HGNC:14000 PRDM5 gene PRDM5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Brittle cornea syndrome 2, MIM# 614170 21664999;22122778;21664999;33739556;27032025 False 3 100;0;0 1.2304 True ENSG00000138738 ENSG00000138738 HGNC:9349 PRDM6 gene PRDM6 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Patent ductus arteriosus 3 MIM#617039 38071433;27716515;27181681 False 3 100;0;0 1.2304 True ENSG00000061455 ENSG00000061455 HGNC:9350 PRDM9 gene PRDM9 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Inherited primary ovarian failure MONDO:0019852 34257419 False 3 100;0;0 1.2304 True ENSG00000164256 ENSG00000164256 HGNC:13994 PRDX1 gene PRDX1 Expert Review Green;Literature Mendeliome Other methylmalonic aciduria and homocystinuria type cblC MONDO:0010184 29302025;35190856 False 3 100;0;0 1.2304 True Other ENSG00000117450 ENSG00000117450 HGNC:9352 PRDX3 gene PRDX3 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal cerebellar ataxia (early onset, mild to moderate, progressive) PMID: 33889951 False 3 100;0;0 1.2304 True ENSG00000165672 ENSG00000165672 HGNC:9354 PREPL gene PREPL Expert Review Green;Literature;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 22 MIM#616224;hypotonia-cystinuria syndrome;Disorders of amino acid transport 28726805;27604308;24610330 False 3 100;0;0 1.2304 True ENSG00000138078 ENSG00000138078 HGNC:30228 PRF1 gene PRF1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Aplastic anemia 609135;Hemophagocytic lymphohistiocytosis, familial, 2 603553;Lymphoma, non-Hodgkin 605027 19487666 False 3 100;0;0 1.2304 True ENSG00000180644 ENSG00000180644 HGNC:9360 PRG4 gene PRG4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Camptodactyly-arthropathy-coxa vara-pericarditis syndrome, MIM# 208250 10545950;29397575 False 3 100;0;0 1.2304 True ENSG00000116690 ENSG00000116690 HGNC:9364 PRIM1 gene PRIM1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Primordial dwarfism-immunodeficiency-lipodystrophy syndrome, MIM# 620005 33060134 False 3 50;50;0 1.2304 True ENSG00000198056 ENSG00000198056 HGNC:9369 PRKACA gene PRKACA Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Cardioacrofacial dysplasia 1, MIM# 619142;Postaxial hand polydactyly;Postaxial foot polydactyly;Common atrium;Atrioventricular canal defect;Narrow chest;Abnormality of the teeth;Intellectual disability 33058759;31130284 False 3 100;0;0 1.2304 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000072062 ENSG00000072062 HGNC:9380 PRKACB gene PRKACB Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Cardioacrofacial dysplasia 2, MIM# 619143;Postaxial hand polydactyly;Postaxial foot polydactyly;Common atrium;Atrioventricular canal defect;Narrow chest;Abnormality of the teeth;Intellectual disability 33058759 False 3 100;0;0 1.2304 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000142875 ENSG00000142875 HGNC:9381 PRKAR1A gene PRKAR1A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Acrodysostosis 1, with or without hormone resistance, MIM# 101800;Carney complex, type 1, MIM# 160980;Myxoma, intracardiac, MIM# 255960;Pigmented nodular adrenocortical disease, primary, 1, MIM# 610489 10973256;11115848;12424709;21651393 False 3 100;0;0 1.2304 True ENSG00000108946 ENSG00000108946 HGNC:9388 PRKAR1B gene PRKAR1B Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Marbach-Schaaf neurodevelopmental syndrome MIM#619680;Global developmental delay;Intellectual disability;Autism;Attention deficit hyperactivity disorder;Aggressive behavior;Abnormality of movement;Upslanted palpebral fissure https://doi.org/10.1101/2020.09.10.20190314;25414040;33057194 False 3 50;50;0 1.2304 True ENSG00000188191 ENSG00000188191 HGNC:9390 PRKCD gene PRKCD Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Autoimmune lymphoproliferative syndrome, type III, MIM# 615559;CVID 9 23319571;23666743;23430113;11976687;33047643;29867916 False 3 100;0;0 1.2304 True ENSG00000163932 ENSG00000163932 HGNC:9399 PRKCG gene PRKCG Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 14, MIM# 605361 12644968;14676051;14694043;16193476;33739604;34292398 False 3 100;0;0 1.2304 True ENSG00000126583 ENSG00000126583 HGNC:9402 PRKCSH gene PRKCSH Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Polycystic liver disease 1 (MIM#174050) 11047756;29038287;12529853;12577059;19876928 False 3 50;50;0 1.2304 True ENSG00000130175 ENSG00000130175 HGNC:9411 PRKD1 gene PRKD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Congenital heart defects and ectodermal dysplasia, 617364;Congenital heart disease, autosomal recessive 27479907;32817298;25713110;33919081 False 3 100;0;0 1.2304 True ENSG00000184304 ENSG00000184304 HGNC:9407 PRKDC gene PRKDC Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 26, with or without neurologic abnormalities MIM# 615966;Absent T and B cells;normal NK cells;SCID;recurrent respiratory infections;microcephaly;seizures;developmental delay 19075392;23722905 False 3 100;0;0 1.2304 True ENSG00000253729 ENSG00000253729 HGNC:9413 PRKG1 gene PRKG1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Aortic aneurysm, familial thoracic 8, MIM# 615436 30071989;23910461;30577811 False 3 100;0;0 1.2304 True ENSG00000185532 ENSG00000185532 HGNC:9414 PRKG2 gene PRKG2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Acromesomelic dysplasia 4, MIM# 619636;Spondylometaphyseal dysplasia, Pagnamenta type, MIM# 619638 33106379;34782440 False 3 100;0;0 1.2304 True ENSG00000138669 ENSG00000138669 HGNC:9416 PRKRA gene PRKRA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Dystonia 16, MIM# 612067;MONDO:0012789 18243799;25142429;29279192 False 3 100;0;0 1.2304 True ENSG00000180228 ENSG00000180228 HGNC:9438 PRMT7 gene PRMT7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Short stature, brachydactyly, intellectual developmental disability, and seizures, MIM# 617157 26437029;27718516;30513135 False 3 100;0;0 1.2304 True ENSG00000132600 ENSG00000132600 HGNC:25557 PROC gene PROC Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Thrombophilia due to protein C deficiency, autosomal dominant (176860);Thrombophilia due to protein C deficiency, autosomal recessive (612304) 22545135;30925296 False 3 100;0;0 1.2304 True ENSG00000115718 ENSG00000115718 HGNC:9451 PRODH gene PRODH Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hyperprolinaemia, type I 239500;Proline oxidase deficiency 17412540;12217952 False 3 100;0;0 1.2304 True ENSG00000100033 ENSG00000100033 HGNC:9453 PROK2 gene PROK2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hypogonadotropic hypogonadism 4 with or without anosmia, MIM# 610628 18559922;17054399;17959774;18285834 False 3 100;0;0 1.2304 True ENSG00000163421 ENSG00000163421 HGNC:18455 PROKR2 gene PROKR2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hypogonadotropic hypogonadism 3 with or without anosmia, MIM# 244200 18826963;29161432 False 3 100;0;0 1.2304 True Other ENSG00000101292 ENSG00000101292 HGNC:15836 PROM1 gene PROM1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Inherited retinal dystrophy, MONDO:0019118;Cone-rod dystrophy 12, MIM# 612657;Macular dystrophy, retinal, 2, MI# 608051;Retinitis pigmentosa 41, MIM# 612095;Stargardt disease 4, MIM# 603786 10587575;17605048;18654668;29416601;31576780;34664634;32820593 False 3 100;0;0 1.2304 True ENSG00000007062 ENSG00000007062 HGNC:9454 PROP1 gene PROP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pituitary hormone deficiency, combined, 2 MIM# 262600;Ateliotic dwarfism with hypogonadism;growth failure;short stature;failure to thrive;absent sexual development at puberty;GH, PRL, TSH, LH, and FSH deficiency;pituitary hypoplasia 20301521;31090814 False 3 100;0;0 1.2304 True ENSG00000175325 ENSG00000175325 HGNC:9455 PROS1 gene PROS1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Thrombophilia 5 due to protein S deficiency, autosomal dominant, MIM# 612336;Thrombophilia 5 due to protein S deficiency, autosomal recessive, MIM# 614514 7545463;19466456;10063989;20484936;19729839 False 3 100;0;0 1.2304 True ENSG00000184500 ENSG00000184500 HGNC:9456 PRPF19 gene PRPF19 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder (MONDO:0700092), PRPF19-related PMID: 37962958 False 3 100;0;0 1.2304 True ENSG00000110107 ENSG00000110107 HGNC:17896 PRPF3 gene PRPF3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Retinitis pigmentosa 18, MIM# 601414 11773002;27886254 False 3 100;0;0 1.2304 True ENSG00000117360 ENSG00000117360 HGNC:17348 PRPF31 gene PRPF31 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Retinitis pigmentosa 11, MIM#600138 32014492 False 3 100;0;0 1.2304 True ENSG00000105618 ENSG00000105618 HGNC:15446 PRPF4 gene PRPF4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Retinitis pigmentosa 70, MIM# 615922 24419317;25383878 False 3 100;0;0 1.2304 True ENSG00000136875 ENSG00000136875 HGNC:17349 PRPF8 gene PRPF8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Retinitis pigmentosa 13, MIM#600059;Neurodevelopmental disorder MONDO:0700092, PRPF8-related 11468273;22039234 False 3 100;0;0 1.2304 True ENSG00000174231 ENSG00000174231 HGNC:17340 PRPH2 gene PRPH2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Leber congenital amaurosis 18, MIM#608133;Macular dystrophy, vitelliform, 3, MIM#608161;Retinitis pigmentosa 7 and digenic form, MIM#608133;Choroidal dystrophy, central areolar 2, MIM#613105;Macular dystrophy, patterned, 1, MIM#169150;Retinitis punctata albescens, MIM#136880 32660024 False 3 100;0;0 1.2304 True ENSG00000112619 ENSG00000112619 HGNC:9942 PRPS1 gene PRPS1 Expert Review;Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Arts syndrome MIM#301835;Charcot-Marie-Tooth disease, X-linked recessive, 5 MIM#311070;Deafness, X-linked 1 MIM#304500;Gout, PRPS-related MIM#300661;Phosphoribosylpyrophosphate synthetase superactivity MIM#300661 32781272;17701896;7593598 False 3 100;0;0 1.2304 True Other ENSG00000147224 ENSG00000147224 HGNC:9462 PRR12 gene PRR12 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuroocular syndrome, MIM#619539;Intellectual disability;Iris abnormalities;Complex microphthalmia 33314030;29556724 False 3 100;0;0 1.2304 True ENSG00000126464 ENSG00000126464 HGNC:29217 PRRT2 gene PRRT2 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Convulsions, familial infantile, with paroxysmal choreoathetosis 602066;Episodic kinesigenic dyskinesia 1 128200;Seizures, benign familial infantile, 2 605751 33126500;30501978;30713971;27423591;25595153 False 3 100;0;0 1.2304 True ENSG00000167371 ENSG00000167371 HGNC:30500 PRRX1 gene PRRX1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Agnathia-otocephaly complex, MIM# 202650 21294718;22211708;22674740;23444262 False 3 100;0;0 1.2304 True ENSG00000116132 ENSG00000116132 HGNC:9142 PRSS1 gene PRSS1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Pancreatitis, hereditary, MIM# 167800 8841182;10204851;10529393;11097832;11702203;15776435;16791840;18461367;17072318 False 3 100;0;0 1.2304 True ENSG00000204983 ENSG00000204983 HGNC:9475 PRSS56 gene PRSS56 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microphthalmia, isolated 6, MIM# 613517 21532570;23127749;31992737 False 3 100;0;0 1.2304 True ENSG00000237412 ENSG00000237412 HGNC:39433 PRUNE1 gene PRUNE1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly, hypotonia, and variable brain anomalies , MIM#617481 26539891;28334956;33105479 False 3 100;0;0 1.2304 True ENSG00000143363 ENSG00000143363 HGNC:13420 PRX gene PRX Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, type 4F, MIM# 614895;Dejerine-Sottas disease, MIM# 145900 11133365;11157804;15197604;21079185;22847150;10839370;32460404;31523542;31426691 False 3 100;0;0 1.2304 True ENSG00000105227 ENSG00000105227 HGNC:13797 PSAP gene PSAP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Parkinson disease, AD;Combined SAP deficiency, MIM# 611721;Encephalopathy due to prosaposin deficiency, MONDO:0012719;Krabbe disease, atypical, MIM# 611722;MONDO:0012720;Metachromatic leukodystrophy due to SAP-b deficiency, MIM# 249900;MONDO:0009590;Gaucher disease, atypical, MIM# 610539;MONDO:0012517 32201884 False 3 100;0;0 1.2304 True ENSG00000197746 ENSG00000197746 HGNC:9498 PSAT1 gene PSAT1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Phosphoserine aminotransferase deficiency 610992;Neu-Laxova syndrome 2 616038 32077105 False 3 100;0;0 1.2304 True ENSG00000135069 ENSG00000135069 HGNC:19129 PSENEN gene PSENEN Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Acne inversa, familial, 2, with or without Dowling-Degos disease MIM#613736 20929727;21412258;27900998 False 3 100;0;0 1.2304 True ENSG00000205155 ENSG00000205155 HGNC:30100 PSKH1 gene PSKH1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Cholestasis, progressive familial intrahepatic, 13, MIM# 620962 39132680 False 3 100;0;0 1.2304 True ENSG00000159792 ENSG00000159792 HGNC:9529 PSMB10 gene PSMB10 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Proteasome-associated autoinflammatory syndrome 5, MIM# 619175;Severe combined immunodeficiency, MONDO:0015974, PSMB10-related 31783057;37600812;38503300 False 3 100;0;0 1.2304 True ENSG00000205220 ENSG00000205220 HGNC:9538 PSMB8 gene PSMB8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Proteasome-associated autoinflammatory syndrome 1, MIM# 256040;MONDO:0054698 21129723;21881205;21852578;21953331 False 3 100;0;0 1.2304 True ENSG00000204264 ENSG00000204264 HGNC:9545 PSMB9 gene PSMB9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Proteasome-associated autoinflammatory syndrome 3, digenic, MIM# 617591;Proteasome-associated autoinflammatory syndrome 6, MIM# 620796 26524591;34819510 False 3 100;0;0 1.2304 True ENSG00000240065 ENSG00000240065 HGNC:9546 PSMC3 gene PSMC3 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal neurodevelopmental disorder, MONDO:0700092, PSMC3-related;Deafness, cataract, impaired intellectual development, and polyneuropathy, MIM#619354 32500975;37256937 False 3 100;0;0 1.2304 True ENSG00000165916 ENSG00000165916 HGNC:9549 PSMC3IP gene PSMC3IP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ovarian dysgenesis 3, MIM# 614324 21963259;35352317;34878148;30406445;29240891 False 3 100;0;0 1.2304 True ENSG00000131470 ENSG00000131470 HGNC:17928 PSMC5 gene PSMC5 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder (MONDO#0700092), PSMC5-related 33057194;38776958;38293138 False 3 50;50;0 1.2304 True ENSG00000087191 ENSG00000087191 HGNC:9552 PSMD11 gene PSMD11 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, PSMD11-related 38866022;30733659 False 3 100;0;0 1.2304 True ENSG00000108671 ENSG00000108671 HGNC:9556 PSMD12 gene PSMD12 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Stankiewicz-Isidor syndrome, MIM# 617516 28132691;34906456 False 3 100;0;0 1.2304 True ENSG00000197170 ENSG00000197170 HGNC:9557 PSMF1 gene PSMF1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Complex neurodevelopmental disorder with motor features, MONDO:0100516, PSMF1-related https://www.medrxiv.org/content/10.1101/2024.06.19.24308302v1 False 3 100;0;0 1.2304 True ENSG00000125818 ENSG00000125818 HGNC:9571 PSPH gene PSPH Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Phosphoserine phosphatase deficiency MIM#614023;Disorders of serine, glycine or glycerate metabolism 14673469;25080166;27604308;26888760;25152457 False 3 100;0;0 1.2304 True ENSG00000146733 ENSG00000146733 HGNC:9577 PSTPIP1 gene PSTPIP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Autoinflammatory syndrome with cytopenia, hyperzincemia, and hypercalprotectinemia, MIMM# 601979;Pyogenic sterile arthritis, pyoderma gangrenosum, and acne, MIM# 604416;PSTPIP1-associated myeloid-related proteinemia inflammatory (PAMI) syndrome 11971877;34938582;34778321;34745107;34492165;34047005 False 3 100;0;0 1.2304 True ENSG00000140368 ENSG00000140368 HGNC:9580 PTCD3 gene PTCD3 Expert Review Green;NHS GMS Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency-51, MIM#619057;Intellectual disability;optic atrophy;Leigh-like syndrome 30607703;19427859;36450274 False 3 100;0;0 1.2304 True ENSG00000132300 ENSG00000132300 HGNC:24717 PTCH1 gene PTCH1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Holoprosencephaly 7, MIM# 610828;Bladder exstrophy and epispadias complex (BEEC) 11941477;17001668;29575684 False 3 100;0;0 1.2304 True ENSG00000185920 ENSG00000185920 HGNC:9585 PTCHD1 gene PTCHD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females intellectual disability MIM#300830 33856728;25131214 False 3 100;0;0 1.2304 True ENSG00000165186 ENSG00000165186 HGNC:26392 PTCRA gene PTCRA Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 126, MIM# 620931 38422122 False 3 100;0;0 1.2304 True ENSG00000171611 ENSG00000171611 HGNC:21290 PTDSS1 gene PTDSS1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Lenz-Majewski hyperostotic dwarfism MIM#151050 24241535;29341480;31403251 False 3 100;0;0 1.2304 True ENSG00000156471 ENSG00000156471 HGNC:9587 PTF1A gene PTF1A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pancreatic agenesis 2, MIM# 615935;Pancreatic and cerebellar agenesis, MIM# 609069 24212882;21749365;10507728;15543146;19650412 False 3 100;0;0 1.2304 True ENSG00000168267 ENSG00000168267 HGNC:23734 PTH gene PTH Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hypoparathyroidism, familial isolated 1, MIM# 146200 2212001;1302009;10523031;35165722;32421798 False 3 100;0;0 1.2304 True ENSG00000152266 ENSG00000152266 HGNC:9606 PTH1R gene PTH1R Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Failure of tooth eruption, primary MIM#125350;Eiken syndrome MIM#600002;Metaphyseal chondrodysplasia, Murk Jansen type MIM#156400;Chondrodysplasia, Blomstrand type MIM#215045 7701349;8855805;17164305;15525660;19061984 False 3 100;0;0 1.2304 True ENSG00000160801 ENSG00000160801 HGNC:9608 PTHLH gene PTHLH Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Brachydactyly, type E2, MIM# 613382 20015959;34897794;29947179;28211986 False 3 100;0;0 1.2304 True ENSG00000087494 ENSG00000087494 HGNC:9607 PTPMT1 gene PTPMT1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal inborn mitochondrial metabolism disorder MONDO:0004069 39279645;37672386 False 3 100;0;0 1.2304 True ENSG00000110536 ENSG00000110536 HGNC:26965 PTPN11 gene PTPN11 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted LEOPARD syndrome 1 (MIM#151100);Noonan syndrome 1 (MIM#163950);Metachondromatosis (MIM#156250) 24935154;11704759;21533187 False 3 100;0;0 1.2304 True Other ENSG00000179295 ENSG00000179295 HGNC:9644 PTPN14 gene PTPN14 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Choanal atresia and lymphoedema, MIM# 613611 20826270 False 3 100;0;0 1.2304 True ENSG00000152104 ENSG00000152104 HGNC:9647 PTPN23 gene PTPN23 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder and structural brain anomalies with or without seizures and spasticity, MIM# 618890 31395947;29899372;29090338;27848944;25558065 False 3 100;0;0 1.2304 True ENSG00000076201 ENSG00000076201 HGNC:14406 PTPN4 gene PTPN4 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, PTPN4-related 17953619;25424712;30238967;34527963 False 3 100;0;0 1.2304 True ENSG00000088179 ENSG00000088179 HGNC:9656 PTPRC gene PTPRC Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Severe combined immunodeficiency, T cell-negative, B-cell/natural killer-cell positive MIM# 608971;Hepatitis C virus, susceptibility to MIM# 609532 11145714;12073144;22689986;10700239 False 3 100;0;0 1.2304 True ENSG00000081237 ENSG00000081237 HGNC:9666 PTPRO gene PTPRO Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Nephrotic syndrome, type 6, MIM# 614196 21722858;34546508;30065916 False 3 100;0;0 1.2304 True ENSG00000151490 ENSG00000151490 HGNC:9678 PTPRQ gene PTPRQ Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Deafness, autosomal recessive 84A, MIM# 613391;Deafness, autosomal dominant 73, MIM# 617663 33229591;20346435;20472657;25919374;14534255;22357859;29849575;29309402;31655630 False 3 100;0;0 1.2304 True ENSG00000139304 ENSG00000139304 HGNC:9679 PTRH2 gene PTRH2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Infantile-onset multisystem neurologic, endocrine, and pancreatic disease, MIM# 616263 25558065;25574476;31057140;27129381 False 3 100;0;0 1.2304 True ENSG00000141378 ENSG00000141378 HGNC:24265 PTRHD1 gene PTRHD1 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with early-onset parkinsonism and behavioral abnormalities, MIM# 620747 30398675;27134041;27753167;29143421 False 3 100;0;0 1.2304 True ENSG00000184924 ENSG00000184924 HGNC:33782 PTS gene PTS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hyperphenylalaninemia, BH4-deficient, A, MIM# 261640 False 3 100;0;0 1.2304 True ENSG00000150787 ENSG00000150787 HGNC:9689 PUF60 gene PUF60 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Verheij syndrome, MIM# 615583" False 3 100;0;0 1.2304 True ENSG00000179950 ENSG00000179950 HGNC:17042 PUM1 gene PUM1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 47, MIM# 617931;Neurodevelopmental disorder with motor abnormalities, seizures, and facial dysmorphism, MIM# 620719 29474920;25768905;30903679;31859446 False 3 100;0;0 1.2304 True ENSG00000134644 ENSG00000134644 HGNC:14957 PURA gene PURA Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with neonatal respiratory insufficiency, hypotonia, and feeding difficulties (OMIM 616158) 25439098;25342064;12972605 False 3 100;0;0 1.2304 True ENSG00000185129 ENSG00000185129 HGNC:9701 PUS1 gene PUS1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Myopathy, lactic acidosis, and sideroblastic anemia 1, MIM# 600462 25227147;17056637;15108122;32287105;31641589;28832011 False 3 100;0;0 1.2304 True ENSG00000177192 ENSG00000177192 HGNC:15508 PUS3 gene PUS3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly and gray sclerae, MIM# 617051 30308082;28454995;27055666;30697592;31444731 False 3 100;0;0 1.2304 True ENSG00000110060 ENSG00000110060 HGNC:25461 PUS7 gene PUS7 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Intellectual developmental disorder with abnormal behavior, microcephaly, and short stature;OMIM #618342 30526862;30778726;31583274 False 3 100;0;0 1.2304 True ENSG00000091127 ENSG00000091127 HGNC:26033 PXDN gene PXDN Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Anterior segment dysgenesis 7, with sclerocornea, MIM# 269400 21907015;24939590;32499604;32224865;32015378;31817535 False 3 100;0;0 1.2304 True ENSG00000130508 ENSG00000130508 HGNC:14966 PYCR1 gene PYCR1 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal cutis laxa 19648921;4076251;22052856;19576563;19648921;9648921;22052856;28294978;27756598 False 3 100;0;0 1.2304 True ENSG00000183010 ENSG00000183010 HGNC:9721 PYCR2 gene PYCR2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 10, MIM# 616420 25865492;27130255 False 3 100;0;0 1.2304 True ENSG00000143811 ENSG00000143811 HGNC:30262 PYGL gene PYGL Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease VI, MIM# 232700 9529348;9536091;33505429;32961316;32892177 False 3 100;0;0 1.2304 True ENSG00000100504 ENSG00000100504 HGNC:9725 PYGM gene PYGM Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal McArdle disease, MIM# 232600;Glycogen storage disease, autosomal dominant 32386344 False 3 100;0;0 1.2304 True ENSG00000068976 ENSG00000068976 HGNC:9726 PYROXD1 gene PYROXD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Myopathy, myofibrillar, 8 , MIM#617258 27745833 False 3 100;0;0 1.2304 True ENSG00000121350 ENSG00000121350 HGNC:26162 QARS gene QARS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephaly, progressive, seizures, and cerebral and cerebellar atrophy, MIM# 615760 28620870;25471517;25432320;25041233;24656866;32042906 False 3 100;0;0 1.2304 True ENSG00000172053 ENSG00000172053 HGNC:9751 QDPR gene QDPR Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hyperphenylalaninemia, BH4-deficient, C, MIM# 261630 11153907 False 3 100;0;0 1.2304 True ENSG00000151552 ENSG00000151552 HGNC:9752 QRICH1 gene QRICH1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ververi-Brady syndrome, MIM#617982 28692176;30281152;33009816 False 3 100;0;0 1.2304 True ENSG00000198218 ENSG00000198218 HGNC:24713 QRSL1 gene QRSL1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 40 26741492;29440775;30283131;30642647 False 3 100;0;0 1.2304 True ENSG00000130348 ENSG00000130348 HGNC:21020 RAB11A gene RAB11A Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability;seizures 29100083;33875846 False 3 100;0;0 1.2304 True ENSG00000103769 ENSG00000103769 HGNC:9760 RAB11B gene RAB11B Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with ataxic gait, absent speech, and decreased cortical white matter 617807 29106825 False 3 100;0;0 1.2304 True ENSG00000185236 ENSG00000185236 HGNC:9761 RAB18 gene RAB18 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Warburg micro syndrome 3, MIM# 614222 11237903;23420520 False 3 100;0;0 1.2304 True ENSG00000099246 ENSG00000099246 HGNC:14244 RAB23 gene RAB23 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Carpenter syndrome (MIM#201000) 17503333;21412941;23599695;25168863 False 3 100;0;0 1.2304 True ENSG00000112210 ENSG00000112210 HGNC:14263 RAB27A gene RAB27A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Griscelli syndrome, type 2, MIM# 607624 10835631;10704277;19030707;15163896;12058346;10859366 False 3 100;0;0 1.2304 True ENSG00000069974 ENSG00000069974 HGNC:9766 RAB28 gene RAB28 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cone-rod dystrophy 18 (MIM#615374) 25356532;33396523;32084271;23746546 False 3 100;0;0 1.2304 True ENSG00000157869 ENSG00000157869 HGNC:9768 RAB33B gene RAB33B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Smith-McCort dysplasia 2 (MIM#615222) 22652534;28127940;23042644;34284742 False 3 100;0;0 1.2304 True ENSG00000172007 ENSG00000172007 HGNC:16075 RAB34 gene RAB34 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Orofaciodigital syndrome 20, MIM#620718 PMID: 37384395 False 3 100;0;0 1.2304 True ENSG00000109113 ENSG00000109113 HGNC:16519 RAB39B gene RAB39B Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Intellectual developmental disorder, X-linked 72 MIM#300271;Waisman syndrome MIM#311510 34761259;20159109;25434005;27066548;26399558;27943471;28851564;28851564;29152164;33880059;27448726;32670181 False 3 100;0;0 1.2304 True ENSG00000155961 ENSG00000155961 HGNC:16499 RAB3GAP1 gene RAB3GAP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal "Warburg micro syndrome 1, MIM# 600118;Martsolf syndrome 2, MIM# 619420" 15696165;20512159;23420520;23420520;30730599 False 3 100;0;0 1.2304 True ENSG00000115839 ENSG00000115839 HGNC:17063 RAB3GAP2 gene RAB3GAP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Warburg micro syndrome 2, MIM# 614225 23420520;20967465 False 3 100;0;0 1.2304 True ENSG00000118873 ENSG00000118873 HGNC:17168 RAB5C gene RAB5C Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder MONDO:0700092, RAB5C-related PMID: 37552066 False 3 100;0;0 1.2304 True ENSG00000108774 ENSG00000108774 HGNC:9785 RAB7A gene RAB7A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, type 2B, MIM# 600882;MONDO:0010949 12545426;17060578;32326241;29130394;25614874 False 3 100;0;0 1.2304 True ENSG00000075785 ENSG00000075785 HGNC:9788 RABGAP1 gene RABGAP1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, RABGAP1-related,MONDO:0700092 36083289 False 3 100;0;0 1.2304 True ENSG00000011454 ENSG00000011454 HGNC:17155 RAC1 gene RAC1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Mental retardation, autosomal dominant 48, MIM# 617751" 30042656;29276006;30293988 False 3 100;0;0 1.2304 True Other ENSG00000136238 ENSG00000136238 HGNC:9801 RAC2 gene RAC2 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Immunodeficiency 73A with defective neutrophil chemotaxix and leukocytosis MIM# 608203;Immunodeficiency 73C with defective neutrophil chemotaxis and hypogammaglobulinaemia MIM# 618987;Immunodeficiency 73B with defective neutrophil chemotaxis and lymphopaenia MIM# 618986 21167572;10758162;10072071;25512081;32542921;31919089;32048120;14564011 False 3 67;33;0 1.2304 True Other ENSG00000128340 ENSG00000128340 HGNC:9802 RAC3 gene RAC3 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with structural brain anomalies and dysmorphic facies, MIM#618577 PMID: 30293988;29276006 False 3 100;0;0 1.2304 True ENSG00000169750 ENSG00000169750 HGNC:9803 RAD21 gene RAD21 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Mungan syndrome, 611376;Cornelia de Lange syndrome 4, 614701;Holoprocencephaly 31334757;25575569;32193685;31704779;14638363;25575569 False 3 100;0;0 1.2304 True ENSG00000164754 ENSG00000164754 HGNC:9811 RAD50 gene RAD50 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Nijmegen breakage syndrome-like disorder, MIM# 613078;MONDO:0013118 33378670;19409520;32212377 False 3 100;0;0 1.2304 True ENSG00000113522 ENSG00000113522 HGNC:9816 RAD51 gene RAD51 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Fanconi anaemia, complementation group R, MIM# 617244 26253028;26681308;30907510 False 3 100;0;0 1.2304 True ENSG00000051180 ENSG00000051180 HGNC:9817 RAD51C gene RAD51C Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Fanconi anaemia, complementation group O (MIM#613390) 29278735;20400963;22167183 False 3 100;0;0 1.2304 True ENSG00000108384 ENSG00000108384 HGNC:9820 RAF1 gene RAF1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Noonan syndrome 5, MIM# 611553;Cardiomyopathy, dilated, 1NN, MIM# 615916 17603483;17603482;31145547;31030682;29271604;24777450 False 3 100;0;0 1.2304 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000132155 ENSG00000132155 HGNC:9829 RAG1 gene RAG1 Expert Review Green;Melbourne Genomics Health Alliance Immunology Flagship;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Alpha/beta T-cell lymphopenia with gamma/delta T-cell expansion, severe cytomegalovirus infection, and autoimmunity MIM# 609889;Combined cellular and humoral immune defects with granulomas MIM# 233650;Omenn syndrome MIM# 603554;Severe combined immunodeficiency, B cell-negative MIM# 601457 16276422;18463379;20489056;9630231;11313270;17476359;8810255;6823332 False 3 100;0;0 1.2304 True ENSG00000166349 ENSG00000166349 HGNC:9831 RAG2 gene RAG2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Omenn syndrome MIM# 603554;Severe combined immunodeficiency, B cell-negative MIM# 601457;Combined cellular and humoral immune defects with granulomas MIM# 233650 9630231;11313270;31885011;8810255;15025726;18463379 False 3 100;0;0 1.2304 True ENSG00000175097 ENSG00000175097 HGNC:9832 RAI1 gene RAI1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Smith-Magenis syndrome (MIM#182290) 11404004;12652298;15788730 False 3 100;0;0 1.2304 True ENSG00000108557 ENSG00000108557 HGNC:9834 RALA gene RALA Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hiatt-Neu-Cooper neurodevelopmental syndrome, MIM# 619311;Intellectual disability;Seizures 30500825 False 3 100;0;0 1.2304 True ENSG00000006451 ENSG00000006451 HGNC:9839 RALGAPA1 gene RALGAPA1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Intellectual disability;hypotonia;infantile spasms. 32004447 False 3 100;0;0 1.2304 True ENSG00000174373 ENSG00000174373 HGNC:17770 RALGAPB gene RALGAPB Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorders, autism PMID: 32853829 False 3 100;0;0 1.2304 True ENSG00000170471 ENSG00000170471 HGNC:29221 RANBP2 gene RANBP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted familial acute necrotizing encephalopathy MONDO:0011953 19118815;25128471;25522933;32048120 False 3 100;0;0 1.2304 True ENSG00000153201 ENSG00000153201 HGNC:9848 RAP1B gene RAP1B Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Thrombocytopenia 1 with multiple congenital anomalies and dysmorphic facies, MIM# 620654 32627184;26280580 False 3 100;0;0 1.2304 True ENSG00000127314 ENSG00000127314 HGNC:9857 RAP1GDS1 gene RAP1GDS1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Alfadhel syndrome, MIM# 620655 32431071;33875846 False 3 100;0;0 1.2304 True ENSG00000138698 ENSG00000138698 HGNC:9859 RAPSN gene RAPSN Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Fetal akinesia deformation sequence 2 (MIM#618388);Myasthenic syndrome, congenital, 11, associated with acetylcholine receptor deficiency (MIM#616326) 18252226;19620612;22482962;28495245;18179903;28495245 False 3 100;0;0 1.2304 True ENSG00000165917 ENSG00000165917 HGNC:9863 RARB gene RARB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Microphthalmia, syndromic 12, MIM# 615524 30880327;30281527;24075189;27120018;25457163;17506106 False 3 100;0;0 1.2304 True Other ENSG00000077092 ENSG00000077092 HGNC:9865 RARS gene RARS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 9 MIM# 616140 31814314 False 3 100;0;0 1.2304 True ENSG00000113643 ENSG00000113643 HGNC:9870 RARS2 gene RARS2 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 6, MIM# 611523;early onset cerebellar ataxia 17847012;25809939;20635367;31429931 False 3 50;0;50 1.2304 True ENSG00000146282 ENSG00000146282 HGNC:21406 RASA1 gene RASA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Capillary malformation-arteriovenous malformation 1, MIM#608354 14639529;29891884;24038909;31300548 False 3 100;0;0 1.2304 True ENSG00000145715 ENSG00000145715 HGNC:9871 RASGRP1 gene RASGRP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 64 (MIM#618534) 30030704;29155103;28822832;17675473 False 3 100;0;0 1.2304 True ENSG00000172575 ENSG00000172575 HGNC:9878 RASGRP2 gene RASGRP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bleeding disorder, platelet-type, 18 (MIM#615888) 28762304;27663674;28637664;27235135 False 3 100;0;0 1.2304 True ENSG00000068831 ENSG00000068831 HGNC:9879 RAX gene RAX Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microphthalmia, isolated 3, MIM# 611038 14662654;18783408;30811539;24033328;22524605 False 3 100;0;0 1.2304 True ENSG00000134438 ENSG00000134438 HGNC:18662 RAX2 gene RAX2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Cone-rod dystrophy 11, MIM# 610381;Retinitis pigmentosa-95 (RP95), MIM#620102 15028672;25789692;30607024 False 3 100;0;0 1.2304 True ENSG00000173976 ENSG00000173976 HGNC:18286 RBBP5 gene RBBP5 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted neurodevelopmental disorder MONDO:0700092, RBBP5-related 39036895 False 3 100;0;0 1.2304 True ENSG00000117222 ENSG00000117222 HGNC:9888 RBBP8 gene RBBP8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Jawad syndrome, MIM#251255;Seckel syndrome 2, MIM#606744 21998596;34270086 False 3 100;0;0 1.2304 True ENSG00000101773 ENSG00000101773 HGNC:9891 RBCK1 gene RBCK1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Polyglucosan body myopathy 1 with or without immunodeficiency MIM# 615895;muscular weakness;cardiomyopathy;recurrent bacterial/viral infections;autoinflammation;immunodeficiency;Poor antibody responses to polysaccharides;failure to thrive;fever;pneumonia 29260357;29695863 False 3 100;0;0 1.2304 True ENSG00000125826 ENSG00000125826 HGNC:15864 RBFOX1 gene RBFOX1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder (MONDO:0700092), RBFOX1-related 24664471;37962958 False 3 50;0;50 1.2304 True ENSG00000078328 ENSG00000078328 HGNC:18222 RBFOX2 gene RBFOX2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted RBFOX2-related congenital heart disorder (MONDO:0100557) PMID: 26785492;27670201;27485310;25205790;35137168 False 3 50;50;0 1.2304 True ENSG00000100320 ENSG00000100320 HGNC:9906 RBL2 gene RBL2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Intellectual disability;Brunet-Wagner neurodevelopmental syndrome, MIM# 619690 32105419;9806916 False 3 50;0;50 1.2304 True ENSG00000103479 ENSG00000103479 HGNC:9894 RBM10 gene RBM10 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females TARP syndrome, MIM# 311900 20451169;24259342;30450804;30189253;33340101 False 3 100;0;0 1.2304 True ENSG00000182872 ENSG00000182872 HGNC:9896 RBM20 gene RBM20 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cardiomyopathy, dilated, 1DD 613172 AD 30871351 False 3 100;0;0 1.2304 True ENSG00000203867 ENSG00000203867 HGNC:27424 RBM8A gene RBM8A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Thrombocytopenia-absent radius syndrome, MIM# 274000 False 3 100;0;0 1.2304 True ENSG00000131795 ENSG00000265241 HGNC:9905 RBP3 gene RBP3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Retinitis pigmentosa 66, MIM# 615233 19074801;29571629;26066594;25766589 False 3 100;0;0 1.2304 True ENSG00000107618 ENSG00000265203 HGNC:9921 RBP4 gene RBP4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Microphthalmia, isolated, with coloboma 10 MIM#616428;Retinal dystrophy, iris coloboma, and comedogenic acne syndrome MIM#615147 25910211;29178648;23189188;9888420;32323592 False 3 100;0;0 1.2304 True ENSG00000138207 ENSG00000138207 HGNC:9922 RBPJ gene RBPJ Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Adams-Oliver syndrome 3, MIM# 614814 22883147;29924900 False 3 100;0;0 1.2304 True ENSG00000168214 ENSG00000168214 HGNC:5724 RBSN gene RBSN Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Kariminejad-Reversade neurodevelopmental syndrome, MIM# 620937 25233840;29784638;35652444 False 3 100;0;0 1.2304 True ENSG00000131381 ENSG00000131381 HGNC:20759 RCBTB1 gene RCBTB1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Retinal dystrophy with or without extraocular anomalies, MIM# 617175 27486781;35057699;33624564;33104391 False 3 100;0;0 1.2304 True ENSG00000136144 ENSG00000136144 HGNC:18243 RD3 gene RD3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Leber congenital amaurosis 12, MIM#610612 23308101;22531706;17186464 False 3 100;0;0 1.2304 True ENSG00000198570 ENSG00000198570 HGNC:19689 RDH12 gene RDH12 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Leber congenital amaurosis 13, MIM# 612712;Retinitis pigmentosa, autosomal dominant 16269441;15322982;15258582;31505163 False 3 100;0;0 1.2304 True ENSG00000139988 ENSG00000139988 HGNC:19977 RDH5 gene RDH5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Fundus albipunctatus (MIM#136880) 32232344;10369264 False 3 100;0;0 1.2304 True ENSG00000135437 ENSG00000135437 HGNC:9940 RDX gene RDX Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 24, MIM# 611022 17226784;19215054;22567349;26226137;15314067 False 3 100;0;0 1.2304 True ENSG00000137710 ENSG00000137710 HGNC:9944 REC114 gene REC114 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Female infertility;Oocyte maturation defect 10, MIM# 619176 30388401;31704776 False 3 100;0;0 1.2304 True ENSG00000183324 ENSG00000183324 HGNC:25065 RECQL4 gene RECQL4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Baller-Gerold syndrome, MIM# 218600;RAPADILINO syndrome, MIM# 266280;Rothmund-Thomson syndrome, type 2,MIM# 268400;RECON progeroid syndrome, MIM# 620370 35025765 False 3 50;0;50 1.2304 True ENSG00000160957 ENSG00000160957 HGNC:9949 REEP1 gene REEP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Spinal muscular atrophy, distal, autosomal recessive, 6, MIM#620011;Neuronopathy, distal hereditary motor, type VB MIM#614751;Spastic paraplegia 31, autosomal dominant MIM#610250 27066569;31872057;22703882;29124833 False 3 100;0;0 1.2304 True ENSG00000068615 ENSG00000068615 HGNC:25786 REEP2 gene REEP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 72, dominant and recessive, MIM# 615625;MONDO:0014282 33526816;28491902;24388663 False 3 100;0;0 1.2304 True ENSG00000132563 ENSG00000132563 HGNC:17975 REEP6 gene REEP6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Retinitis pigmentosa 77, MIM# 617304 27889058;33917198;31538292;29120066;28475715 False 3 100;0;0 1.2304 True ENSG00000115255 ENSG00000115255 HGNC:30078 RELA gene RELA Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Mucocutaneous ulceration, chronic, MIM# 618287;Impaired NFkB activation;reduced production of inflammatory cytokines;autoimmune cytopaenias" 28600438;29305315;37273177 False 3 100;0;0 1.2304 True ENSG00000173039 ENSG00000173039 HGNC:9955 RELB gene RELB Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Immunodeficiency 53, MIM# 617585;T cells: normal number, poor diversity, poor function;recurrent infections" 7834753;26385063;39231201 False 3 50;50;0 1.2304 True ENSG00000104856 ENSG00000104856 HGNC:9956 RELN gene RELN Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Lissencephaly 2 (Norman-Roberts type), MIM# 257320;{Epilepsy, familial temporal lobe, 7}, MIM# 616436;ankylosing spondylitis" 32001840;35769015 False 3 33;67;0 1.2304 True ENSG00000189056 ENSG00000189056 HGNC:9957 RELT gene RELT Expert Review;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Amelogenesis imperfecta, type IIIC, MIM# 618386 30506946 False 3 100;0;0 1.2304 True ENSG00000054967 ENSG00000054967 HGNC:13764 REN gene REN Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Renal tubular dysgenesis, MIM# 267430;Autosomal dominant tubulointerstitial disease 16116425;31586593;31406136;28701203;21473025 False 3 100;0;0 1.2304 True ENSG00000143839 ENSG00000143839 HGNC:9958 RERE gene RERE Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with or without anomalies of the brain, eye, or heart, MIM# 616975 27087320;23451234;30896913;30061196 False 3 100;0;0 1.2304 True ENSG00000142599 ENSG00000142599 HGNC:9965 REST gene REST Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Deafness, autosomal dominant 27, MIM# 612431;{Wilms tumor 6, susceptibility to}, MIM# 616806;Fibromatosis, gingival, 5, MIM# 617626 29961578;34828371;26551668;28686854 False 3 100;0;0 1.2304 True ENSG00000084093 ENSG00000084093 HGNC:9966 RETREG1 gene RETREG1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neuropathy, hereditary sensory and autonomic, type IIB, MIM# 613115;MONDO:0013142 19838196;24327336;31737055;31596031 False 3 100;0;0 1.2304 True ENSG00000154153 ENSG00000154153 HGNC:25964 REV3L gene REV3L Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Moebius syndrome 26068067;26068067 False 3 100;0;0 1.2304 True ENSG00000009413 ENSG00000009413 HGNC:9968 RFC1 gene RFC1 Expert list;Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575 30926972;33103729;35883251;36478048;36289003 False 3 50;50;0 1.2304 True Other ENSG00000035928 ENSG00000035928 HGNC:9969 RFC4 gene RFC4 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Morimoto-Ryu-Malicdan neuromuscular syndrome, MIM# 621010 PMID: 39106866 False 3 100;0;0 1.2304 True ENSG00000163918 ENSG00000163918 HGNC:9972 RFT1 gene RFT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type In, MIM# 612015;RFT1-CDG, MONDO:0012783 18313027;19701946;19856127;23111317;30071302;29923091;27927990;26892341 False 3 100;0;0 1.2304 True ENSG00000163933 ENSG00000163933 HGNC:30220 RFX3 gene RFX3 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ID, ASD, ADHD 33658631 False 3 100;0;0 1.2304 True ENSG00000080298 ENSG00000080298 HGNC:9984 RFX4 gene RFX4 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ID, ASD, ADHD 33658631 False 3 100;0;0 1.2304 True ENSG00000111783 ENSG00000111783 HGNC:9985 RFX5 gene RFX5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bare lymphocyte syndrome, type II, complementation group C MIM# 209920;Bare lymphocyte syndrome, type II, complementation group E MIM# 209920 9401005;29527204;30170160;7990905;8642248;7699327 False 3 100;0;0 1.2304 True ENSG00000143390 ENSG00000143390 HGNC:9986 RFX6 gene RFX6 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal "Mitchell-Riley syndrome, MIM# 615710" 20148032;25048417;27185633;29026101;31001871 False 3 100;0;0 1.2304 True ENSG00000185002 ENSG00000185002 HGNC:21478 RFX7 gene RFX7 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder, autosomal dominant 71, with behavioral abnormalities, MIM# 620330 33658631 False 3 100;0;0 1.2304 True ENSG00000181827 ENSG00000181827 HGNC:25777 RFXANK gene RFXANK Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal MHC class II deficiency, complementation group B MIM# 209920;Bare Lymphocyte Syndrome, type II, complementation group B;Low CD4+ T cells;reduced MHC II expression on lymphocytes;Normal-low Ig levels;Failure to thrive;respiratory/gastrointestinal infections;liver/biliary tract disease;diarrhoea;Severe autoimmune cytopaenia;agammaglobulinaemia 12618906 False 3 100;0;0 1.2304 True ENSG00000064490 ENSG00000064490 HGNC:9987 RFXAP gene RFXAP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bare lymphocyte syndrome, type II, complementation group D MIM# 209920;Low CD4+ T cells;reduced MHC II expression on lymphocytes;Normal-low Ig levels;Failure to thrive;respiratory/gastrointestinal infections;liver/biliary tract disease;diarrhoea;Severe autoimmune cytopaenia;agammaglobulinaemia 9118943;32875002;11258423 False 3 100;0;0 1.2304 True ENSG00000133111 ENSG00000133111 HGNC:9988 RGS9 gene RGS9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bradyopsia, MIM# 608415 14702087;10676965;19818506 False 3 100;0;0 1.2304 True ENSG00000108370 ENSG00000108370 HGNC:10004 RGS9BP gene RGS9BP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bradyopsia, MIM# 608415 14702087;19818506 False 3 100;0;0 1.2304 True ENSG00000186326 ENSG00000186326 HGNC:30304 RHAG gene RHAG Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Anaemia, haemolytic, Rh-null, regulator type MIM# 268150;Overhydrated hereditary stomatocytosis MIM#185000 30990901;28470789;4962358;18931342;21849667;23406318 False 3 100;0;0 1.2304 True ENSG00000112077 ENSG00000112077 HGNC:10006 RHBDF2 gene RHBDF2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Tylosis with esophageal cancer, MIM# 148500;Immune dysregulation 22265016;22638770;34937930 False 3 100;0;0 1.2304 True ENSG00000129667 ENSG00000129667 HGNC:20788 RHCE gene RHCE Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Rh-null disease, amorph type, MIM# 617970 9657766;16271106;25413218 False 3 100;0;0 1.2304 True ENSG00000188672 ENSG00000188672 HGNC:10008 RHEB gene RHEB Expert Review Green;Victorian Clinical Genetics Services Mendeliome Other Neurodevelopmental disorder MONDO:0700092, RHEB-related;Intellectual disability;Macrocephaly;Focal cortical dysplasia 31337748;29051493 False 3 100;0;0 1.2304 True ENSG00000106615 ENSG00000106615 HGNC:10011 RHO gene RHO Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Night blindness, congenital stationary, autosomal dominant 1, MIM# 610445;Retinitis pigmentosa 4, autosomal dominant or recessive, MIM# 613731 18487375;27812022;31213501;1303237 False 3 100;0;0 1.2304 True ENSG00000163914 ENSG00000163914 HGNC:10012 RHOA gene RHOA Expert Review Green;Literature Mendeliome Other normal cognition;leukoencephalopathy;micro-ophthalmia;strabismus;linear hypopigmentation;malar hypoplasia;downslanting palpebral fissures;microstomia;dental anomalies;body asymmetry;limb length discrepancy 31570889;31821646 False 3 100;0;0 1.2304 True ENSG00000067560 ENSG00000067560 HGNC:667 RHOBTB2 gene RHOBTB2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Epileptic encephalopathy, early infantile, 64, MIM#618004 29276004;29768694;37165955 False 3 100;0;0 1.2304 True ENSG00000008853 ENSG00000008853 HGNC:18756 RIC1 gene RIC1 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Cleft lip/palate MONDO:0016044, RIC1-related;Cleft lip;cataract;tooth abnormality;intellectual disability;facial dysmorphism;ADHD 31932796;36493769 False 3 50;50;0 1.2304 True ENSG00000107036 ENSG00000107036 HGNC:17686 RICTOR gene RICTOR Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder MONDO:0700092, RICTOR-related 39738822 False 3 100;0;0 1.2304 True ENSG00000164327 ENSG00000164327 HGNC:28611 RIMS1 gene RIMS1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cone-rod dystrophy 7 , MIM#603649;Autism MONDO:0005260 12659814;25284784;25961944 False 3 100;0;0 1.2304 True ENSG00000079841 ENSG00000079841 HGNC:17282 RIMS2 gene RIMS2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "nystagmus;retinal dysfunction;autism;night blindness;Cone-rod synaptic disorder syndrome, congenital nonprogressive , MIM#618970" 32470375 False 3 100;0;0 1.2304 True ENSG00000176406 ENSG00000176406 HGNC:17283 RIN2 gene RIN2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Macrocephaly, alopecia, cutis laxa, and scoliosis, MIM#613075 19631308;20424861;20954239;24449201;30769224 False 3 100;0;0 1.2304 True ENSG00000132669 ENSG00000132669 HGNC:18750 RINT1 gene RINT1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Infantile liver failure syndrome 3, MIM# 618641;Hereditary spastic paraplegia, MONDO:0019064, RINT1-related PMID: 31204009;37463447;38990652 False 3 100;0;0 1.2304 True ENSG00000135249 ENSG00000135249 HGNC:21876 RIPK1 gene RIPK1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Immunodeficiency 57, MIM#618108 30026316;30591564;31213653;31827280 False 3 100;0;0 1.2304 True ENSG00000137275 ENSG00000137275 HGNC:10019 RIPK4 gene RIPK4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Popliteal pterygium syndrome, Bartsocas-Papas type, MIM# 263650 28940926;22197489;22197488 False 3 100;0;0 1.2304 True ENSG00000183421 ENSG00000183421 HGNC:496 RIPPLY2 gene RIPPLY2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spondylocostal dysostosis 6, MIM# 616566 25343988;33410135;32212228;29761784 False 3 100;0;0 1.2304 True ENSG00000203877 ENSG00000203877 HGNC:21390 RIT1 gene RIT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Noonan syndrome 8, MIM# 615355 23791108;25124994;24939608;27101134 False 3 100;0;0 1.2304 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000143622 ENSG00000143622 HGNC:10023 RLBP1 gene RLBP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Fundus albipunctatus MIM#136880;Bothnia retinal dystrophy MIM#607475 9326942;11453974;11868161;21447491;25429852;14718298 False 3 100;0;0 1.2304 True ENSG00000140522 ENSG00000140522 HGNC:10024 RLIM gene RLIM Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Tonne-Kalscheuer syndrome, MIM# 300978 29728705;25735484;25644381 False 3 100;0;0 1.2304 True ENSG00000131263 ENSG00000131263 HGNC:13429 RMND1 gene RMND1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 11 MIM#614922 False 3 100;0;0 1.2304 True ENSG00000155906 ENSG00000155906 HGNC:21176 RMRP gene RMRP Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cartilage-hair hypoplasia MIM#250250 16244706;21396580;22420014;16838329;11207361 False 3 100;0;0 1.2304 True ENSG00000269900 ENSG00000269900 HGNC:10031 RNASEH1 gene RNASEH1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 2 MIM#616479 26094573;31258551 False 3 100;0;0 1.2304 True ENSG00000171865 ENSG00000171865 HGNC:18466 RNASEH2A gene RNASEH2A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 4 MIM#610333 15870678;25604658;23592335;20301648 False 3 100;0;0 1.2304 True ENSG00000104889 ENSG00000104889 HGNC:18518 RNASEH2B gene RNASEH2B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 2, MIM# 610181 16845400;33307271;29239743 False 3 100;0;0 1.2304 True ENSG00000136104 ENSG00000136104 HGNC:25671 RNASEH2C gene RNASEH2C Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 3 (MIM# 610329), AR 24183309;23322642 False 3 100;0;0 1.2304 True ENSG00000172922 ENSG00000172922 HGNC:24116 RNASET2 gene RNASET2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy, cystic, without megalencephaly MIM#612951 31349848;19525954;27091087;29336640;18545798;15851732 False 3 100;0;0 1.2304 True ENSG00000026297 ENSG00000026297 HGNC:21686 RNF113A gene RNF113A Expert Review Green;Literature;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Trichothiodystrophy 5, nonphotosensitive;OMIM #300953 25612912;31793730;31880405 False 3 50;50;0 1.2304 True ENSG00000125352 ENSG00000125352 HGNC:12974 RNF125 gene RNF125 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Tenorio syndrome - MIM# 616260 25196541 False 3 100;0;0 1.2304 True ENSG00000101695 ENSG00000101695 HGNC:21150 RNF13 gene RNF13 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Epileptic encephalopathy, early infantile, 73, MIM# 618379" 30595371 False 3 100;0;0 1.2304 True Other ENSG00000082996 ENSG00000082996 HGNC:10057 RNF168 gene RNF168 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal RIDDLE syndrome MIM# 611943;Radiosensitivity;Immune Deficiency;Dysmorphic Features;Learning difficulties;Low IgG or IgA;Short stature;mild defect of motor control to ataxia;normal intelligence to learning difficulties;mild facial dysmorphism to microcephaly 19203578;21394101;29255463;21552324 False 3 100;0;0 1.2304 True ENSG00000163961 ENSG00000163961 HGNC:26661 RNF170 gene RNF170 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 85, autosomal recessive, MIM# 619686;Ataxia, sensory, 1, autosomal dominant, MIM# 608984 False 3 100;0;0 1.2304 True ENSG00000120925 ENSG00000120925 HGNC:25358 RNF213 gene RNF213 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Susceptibility to Moyamoya disease 2, (MIM# 607151) 37924258;28635953 False 3 100;0;0 1.2304 True ENSG00000173821 ENSG00000173821 HGNC:14539 RNF216 gene RNF216 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia and hypogonadotropic hypogonadism MIM#212840 23656588 False 3 100;0;0 1.2304 True ENSG00000011275 ENSG00000011275 HGNC:21698 RNF220 gene RNF220 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "Leukodystrophy, hypomyelinating, 23, with ataxia, deafness, liver dysfunction, and dilated cardiomyopathy, MIM# 619688;Leukodystrophy;CNS hypomyelination;Ataxia;Intellectual disability;Sensorineural hearing impairment;Elevated hepatic transaminases;Hepatic fibrosis;Dilated cardiomyopathy;Spastic paraplegia;Dysarthria;Abnormality of the corpus callosum" 33964137;10881263 False 3 100;0;0 1.2304 True ENSG00000187147 ENSG00000187147 HGNC:25552 RNH1 gene RNH1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "Neurodevelopmental disorder, MONDO:0700092, RNH1-related;{Encephalopathy, acute, infection-induced, susceptibiliyt to, 12}, MIM# 620461" PMID: 36935417;37191094 False 3 33;0;67 1.2304 True ENSG00000023191 ENSG00000023191 HGNC:10074 RNPC3 gene RNPC3 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Pituitary hormone deficiency, combined or isolated, 7, MIM# 618160 29866761;32462814;33650182 False 3 100;0;0 1.2304 True ENSG00000185946 ENSG00000185946 HGNC:18666 RNU12 gene RNU12 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal CDAGS syndrome MIM#603116;Craniosynostosis, Delayed closure of the fontanelles, cranial defects, clavicular hypoplasia, Anal and Genitourinary malformations, and Skin manifestations 34085356;27863452 False 3 100;0;0 1.2304 True - - HGNC:19380 RNU2-2P gene RNU2-2P Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, RNU2-2P-related https://www.medrxiv.org/content/10.1101/2024.09.03.24312863v1 False 3 100;0;0 1.2304 True ENSG00000222328 ENSG00000222328 HGNC:10152 RNU4-2 gene RNU4-2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with hypotonia, brain anomalies, distinctive facies, and absent language, MIM# 620851 38991538 False 3 100;0;0 1.2304 True ENSG00000202538 ENSG00000202538 HGNC:10193 RNU4ATAC gene RNU4ATAC Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephalic osteodysplastic primordial dwarfism, type I (MIM# 210710);Roifman syndrome (MIM# 616651);Lowry-Wood syndrome, MIM# 226960 23794361;26522830;30455926;29265708;12605445 False 3 100;0;0 1.2304 True ENSG00000264229 ENSG00000264229 HGNC:34016 RNU5B-1 gene RNU5B-1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, RNU5B-1 related https://www.medrxiv.org/content/10.1101/2024.10.04.24314692v1.full.pdf;https://www.medrxiv.org/content/10.1101/2024.10.07.24314689v1 False 3 100;0;0 1.2304 True ENSG00000200156 ENSG00000200156 HGNC:10212 RNU7-1 gene RNU7-1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 9, MIM# 619487 PMID: 33230297 False 3 100;0;0 1.2304 True ENSG00000238923 ENSG00000238923 HGNC:34033 ROBO1 gene ROBO1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Pituitary hormone deficiency, combined or isolated, 8, MIM# 620303;Nystagmus 8, congenital, autosomal recessive, MIM# 257400;Neurooculorenal syndrome, MIM# 620305 28286008;30692597;35227688;35348658;28592524;30530901;33270637;28402530 False 3 100;0;0 1.2304 True ENSG00000169855 ENSG00000169855 HGNC:10249 ROBO2 gene ROBO2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Vesicoureteral reflux 2 - MIM#610878;CAKUT 18235093;19350278;24429398;17357069;26026792;29194579;34059960 False 3 100;0;0 1.2304 True ENSG00000185008 ENSG00000185008 HGNC:10250 ROBO3 gene ROBO3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Gaze palsy, familial horizontal, with progressive scoliosis, 1 (MIM# 607313) 15105459;32373565 False 3 100;0;0 1.2304 True ENSG00000154134 ENSG00000154134 HGNC:13433 ROGDI gene ROGDI Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Kohlschutter-Tonz syndrome, MIM# 226750 22424600;23086778;33866847 False 3 100;0;0 1.2304 True ENSG00000067836 ENSG00000067836 HGNC:29478 ROM1 gene ROM1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Retinitis pigmentosa 7, digenic form, MIM# 608133 32036094;8202715;30630813;24618324;20300562;32716032 False 3 100;0;0 1.2304 True ENSG00000149489 ENSG00000149489 HGNC:10254 ROR2 gene ROR2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Robinow syndrome, autosomal recessive MIM# 268310;hypertelorism;short stature;mesomelic shortening of the limbs;hypoplastic genitalia;rib/vertebral anomalies;abnormal morphogenesis of the face;Brachydactyly, type B1 MIM# 113000;hypoplasia/aplasia of distal phalanges and nails (2-5) 10932186;10932187;10986040;19461659 False 3 100;0;0 1.2304 True ENSG00000169071 ENSG00000169071 HGNC:10257 RORA gene RORA Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder with or without epilepsy or cerebellar ataxia, MIM# 618060 29656859 False 3 100;0;0 1.2304 True ENSG00000069667 ENSG00000069667 HGNC:10258 RORB gene RORB Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Epilepsy, idiopathic generalized, susceptibility to, 15} (MIM#618357), AD;Genetic generalized epilepsy (GGE);Photosensitive generalized and occipital epilepsy 27352968;32162308 False 3 100;0;0 1.2304 True ENSG00000198963 ENSG00000198963 HGNC:10259 RORC gene RORC Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Immunodeficiency 42, MIM# 616622;Autosomal recessive mendelian susceptibility to mycobacterial diseases due to complete RORgamma receptor deficiency, MONDO:0014710 26160376;32960152 False 3 100;0;0 1.2304 True ENSG00000143365 ENSG00000143365 HGNC:10260 RP1 gene RP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Retinitis pigmentosa 1 MIM#180100 10391211;10465120;10465120;10484783;29425069;31213501 False 3 100;0;0 1.2304 True ENSG00000104237 ENSG00000104237 HGNC:10263 RP1L1 gene RP1L1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Occult macular dystrophy (MIM#613587) AD;Retinitis pigmentosa 88 (MIM#618826) AR 23281133;30025130;32360662 False 3 100;0;0 1.2304 True ENSG00000183638 ENSG00000183638 HGNC:15946 RP2 gene RP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Retinitis pigmentosa 2 MIM#312600 9697692;10053026;10942419;11462235;12417528;8225316;26143542 False 3 100;0;0 1.2304 True ENSG00000102218 ENSG00000102218 HGNC:10274 RPA1 gene RPA1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Pulmonary fibrosis and/or bone marrow failure, telomere-related, 6, MIM# 619767;Bone marrow failure;T- and B-cell lymphopaenia;pulmonary fibrosis;skin manifestations;short telomeres 34767620 False 3 100;0;0 1.2304 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000132383 ENSG00000132383 HGNC:10289 RPE65 gene RPE65 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Leber congenital amaurosis 2 MIM#204100;Retinitis pigmentosa 20 MIM#613794;Retinitis pigmentosa 87 with choroidal involvement MIM#618697 14962443;12960219;11786058;21654732;27307694;9501220;16754667;15557452 False 3 100;0;0 1.2304 True ENSG00000116745 ENSG00000116745 HGNC:10294 RPGR gene RPGR Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Retinitis pigmentosa 3 (MIM#300029) 19815619;31775781;26093275;30105367 False 3 100;0;0 1.2304 True ENSG00000156313 ENSG00000156313 HGNC:10295 RPGRIP1 gene RPGRIP1 Expert Review;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cone-rod dystrophy 13 (MIM#608194) , Leber congenital amaurosis (MIM#61382) 33308271;31666973 False 3 100;0;0 1.2304 True ENSG00000092200 ENSG00000092200 HGNC:13436 RPGRIP1L gene RPGRIP1L Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 7, MIM# 611560;Meckel syndrome 5, MIM# 611561;COACH syndrome 3, MIM# 619113;Nephronophthisis 17558409;17558407;17960139;26071364;19574260;29991045 False 3 100;0;0 1.2304 True ENSG00000103494 ENSG00000103494 HGNC:29168 RPH3A gene RPH3A Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder (MONDO#0700092), RPH3A-related 37403762;29441694 False 3 100;0;0 1.2304 True ENSG00000089169 ENSG00000089169 HGNC:17056 RPIA gene RPIA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal "Ribose 5-phosphate isomerase deficiency, MIM# 608611" 31247379;14988808;31056085 False 3 100;0;0 1.2304 True ENSG00000153574 ENSG00000153574 HGNC:10297 RPL10 gene RPL10 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Mental retardation, X-linked, syndromic, 35, MIM# 300998 25316788;25846674;26290468 False 3 100;0;0 1.2304 True ENSG00000147403 ENSG00000147403 HGNC:10298 RPL11 gene RPL11 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Diamond-Blackfan anemia 7, MIM# 612562;MONDO:0012938 19061985 False 3 100;0;0 1.2304 True ENSG00000142676 ENSG00000142676 HGNC:10301 RPL13 gene RPL13 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spondyloepimetaphyseal Dysplasia with Severe Short Stature 31630789 False 3 100;0;0 1.2304 True ENSG00000167526 ENSG00000167526 HGNC:10303 RPL15 gene RPL15 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Diamond-Blackfan anemia 12, MIM# 615550 23812780;29599205 False 3 100;0;0 1.2304 True ENSG00000174748 ENSG00000174748 HGNC:10306 RPL26 gene RPL26 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Diamond-Blackfan anaemia 11, MIM# 614900 22431104;39268718 False 3 50;0;50 1.2304 True ENSG00000161970 ENSG00000161970 HGNC:10327 RPL35A gene RPL35A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Diamond-Blackfan anemia 5, MIM# 612528;MONDO:0012925 18535205;32241839 False 3 100;0;0 1.2304 True ENSG00000182899 ENSG00000182899 HGNC:10345 RPL3L gene RPL3L Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Cardiomyopathy, dilated, 2D, MIM# 619371;Neonatal dilated cardiomyopathy PMID: 32514796;32870709 False 3 100;0;0 1.2304 True ENSG00000140986 ENSG00000140986 HGNC:10351 RPL5 gene RPL5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Diamond-Blackfan anemia 6, MIM# 612561;MONDO:0012937 19061985 False 3 100;0;0 1.2304 True ENSG00000122406 ENSG00000122406 HGNC:10360 RPS10 gene RPS10 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Diamond-Blackfan anaemia 9, MIM# 613308 20116044;23718193;25946618 False 3 100;0;0 1.2304 True ENSG00000124614 ENSG00000124614 HGNC:10383 RPS17 gene RPS17 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Diamond-Blackfan anaemia 4, MIM# 612527;MONDO:0012924 17647292;19061985;23812780;23718193 False 3 100;0;0 1.2304 True ENSG00000182774 ENSG00000182774 HGNC:10397 RPS19 gene RPS19 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Diamond-Blackfan anemia 1, MIM# 105650;MONDO:0007110 9988267;10590074 False 3 100;0;0 1.2304 True ENSG00000105372 ENSG00000105372 HGNC:10402 RPS24 gene RPS24 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Diamond-blackfan anemia 3, MIM# 610629;MONDO:0012529 17186470;23812780;25946618 False 3 100;0;0 1.2304 True ENSG00000138326 ENSG00000138326 HGNC:10411 RPS26 gene RPS26 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Diamond-Blackfan anemia 10, MIM# 613309;MONDO:0013217 20116044;23812780;24942156 False 3 100;0;0 1.2304 True ENSG00000197728 ENSG00000197728 HGNC:10414 RPS6KA3 gene RPS6KA3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Coffin-Lowry syndrome MIM# 303600;Intellectual disability;short stature;delayed bone age;hearing deficit;hypotonia;tapering fingers;abnormal facies (hypertelorism, anteverted nares, prominent frontal region) 6879200 False 3 100;0;0 1.2304 True ENSG00000177189 ENSG00000177189 HGNC:10432 RPS7 gene RPS7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Diamond-Blackfan anemia 8, MIM# 612563;MONDO:0012939 19061985;23718193;27882484;32772263 False 3 100;0;0 1.2304 True ENSG00000171863 ENSG00000171863 HGNC:10440 RPSA gene RPSA Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Asplenia, isolated congenital 271400;Idiopathic intestinal varices 23579497;31498527 False 3 100;0;0 1.2304 True ENSG00000168028 ENSG00000168028 HGNC:6502 RRAGC gene RRAGC Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Long-Olsen syndrome, MIM# 620609" 37057673;27234373;33057194 False 3 50;0;50 1.2304 True ENSG00000116954 ENSG00000116954 HGNC:19902 RRAGD gene RRAGD Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Inherited renal tubular disease, MONDO:0015962, RRAGD-related;dilated cardiomyopathy;hypomagnesaemia;renal salt-wasting;nephrocalcinosis PMID: 34607910 False 3 100;0;0 1.2304 True ENSG00000025039 ENSG00000025039 HGNC:19903 RRAS2 gene RRAS2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Noonan syndrome 12, OMIM #618624 31130282 False 3 100;0;0 1.2304 True ENSG00000133818 ENSG00000133818 HGNC:17271 RRM2B gene RRM2B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 8A (encephalomyopathic type with renal tubulopathy) MIM#612075;Mitochondrial DNA depletion syndrome 8B (MNGIE type) MIM#612075;Rod-cone dystrophy, sensorineural deafness, and Fanconi-type renal dysfunction, MIM# 268315 24741716;32827185 False 3 100;0;0 1.2304 True ENSG00000048392 ENSG00000048392 HGNC:17296 RS1 gene RS1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Retinoschisis, MIM#312700 15932525;23453514;23847049 False 3 100;0;0 1.2304 True ENSG00000102104 ENSG00000102104 HGNC:10457 RSPH1 gene RSPH1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 24 MIM#615481 23993197 False 3 100;0;0 1.2304 True ENSG00000160188 ENSG00000160188 HGNC:12371 RSPH3 gene RSPH3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 32 MIM#616481 26073779 False 3 100;0;0 1.2304 True ENSG00000130363 ENSG00000130363 HGNC:21054 RSPH4A gene RSPH4A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 11, OMIM#612649 23798057;23798057;23798057;25789548;22448264 False 3 100;0;0 1.2304 True ENSG00000111834 ENSG00000111834 HGNC:21558 RSPH9 gene RSPH9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 12, MIM#612650 25789548;22384920;23993197;19200523;27626380 False 3 100;0;0 1.2304 True ENSG00000172426 ENSG00000172426 HGNC:21057 RSPO1 gene RSPO1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Palmoplantar hyperkeratosis with squamous cell carcinoma of skin and sex reversal MIM#610644;Palmoplantar hyperkeratosis and true hermaphroditism MIM#610644 17041600;18085567;18250098;18250097 False 3 100;0;0 1.2304 True ENSG00000169218 ENSG00000169218 HGNC:21679 RSPO2 gene RSPO2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Tetraamelia syndrome 2, MIM# 618021 29769720;32457899 False 3 100;0;0 1.2304 True ENSG00000147655 ENSG00000147655 HGNC:28583 RSPO4 gene RSPO4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Anonychia congenita MIM# 206800 17041604;17914448;18070203 False 3 100;0;0 1.2304 True ENSG00000101282 ENSG00000101282 HGNC:16175 RSRC1 gene RSRC1 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Intellectual developmental disorder, autosomal recessive 70, MIM# 618402" 28640246;29522154 False 3 100;0;0 1.2304 True ENSG00000174891 ENSG00000174891 HGNC:24152 RTEL1 gene RTEL1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Dyskeratosis congenita, autosomal dominant 4 MIM# 615190;Dyskeratosis congenita, autosomal recessive 5 MIM# 615190;Pulmonary fibrosis and/or bone marrow failure, telomere-related, 3 MIM# 616373 20301779;23329068;15210109;23453664;19461895;25848748;25607374 False 3 100;0;0 1.2304 True ENSG00000258366 ENSG00000258366 HGNC:15888 RTN2 gene RTN2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 12, autosomal dominant, 604805;MONDO:0011489;Neuronopathy, distal hereditary motor, autosomal recessive 11, with spasticity, MIM# 620854 22232211;27165006;38527963 False 3 100;0;0 1.2304 True ENSG00000125744 ENSG00000125744 HGNC:10468 RTN4IP1 gene RTN4IP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Optic atrophy 10 with or without ataxia, mental retardation, and seizures, MIM#616732 26593267;31077085 False 3 100;0;0 1.2304 True ENSG00000130347 ENSG00000130347 HGNC:18647 RTTN gene RTTN Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal "Microcephaly, short stature, and polymicrogyria with seizures, MIM# 614833;microcephalic primordial dwarfism due to RTTN deficiency MONDO:0018764" 30879067 False 3 100;0;0 1.2304 True ENSG00000176225 ENSG00000176225 HGNC:18654 RUBCN gene RUBCN Expert Review Green;Royal Melbourne Hospital;Royal Melbourne Hospital Clinical Genetics Department;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 15, MIM#615705 20826435;30237576 False 3 100;0;0 1.2304 True ENSG00000145016 ENSG00000145016 HGNC:28991 RUNX1 gene RUNX1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Platelet disorder, familial, with associated myeloid malignancy, MIM# 601399;Leukemia, acute myeloid, MIM# 601626 10508512;11830488 False 3 100;0;0 1.2304 True ENSG00000159216 ENSG00000159216 HGNC:10471 RUNX1T1 gene RUNX1T1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder MONDO:0700092, RUNX1T1-related 39568205;19172993;22644616;31223340 False 3 100;0;0 1.2304 True ENSG00000079102 ENSG00000079102 HGNC:1535 RUNX2 gene RUNX2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cleidocranial dysplasia MIM#119600;Cleidocranial dysplasia, forme fruste, dental anomalies only MIM#119600;Cleidocranial dysplasia, forme fruste, with brachydactyly MIM#119600;Metaphyseal dysplasia with maxillary hypoplasia with or without brachydactyly MIM#156510 20301686 False 3 100;0;0 1.2304 True ENSG00000124813 ENSG00000124813 HGNC:10472 RYBP gene RYBP Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, RYBP-related 39891528 False 3 100;0;0 1.2304 True ENSG00000163602 ENSG00000163602 HGNC:10480 RYR1 gene RYR1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal {Malignant hyperthermia susceptibility 1} MIM#145600;Central core disease, MIM# 117000;King-Denborough syndrome , MIM#619542;Minicore myopathy with external ophthalmoplegia , MIM#255320;Neuromuscular disease, congenital, with uniform type 1 fiber, MIM# 117000 20301325 False 3 100;0;0 1.2304 True ENSG00000196218 ENSG00000196218 HGNC:10483 S1PR2 gene S1PR2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 68, MIM# 610419 26805784;29776397;27383011 False 3 100;0;0 1.2304 True ENSG00000267534 ENSG00000267534 HGNC:3169 SACS gene SACS Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic ataxia, Charlevoix-Saguenay type MIM#270550 False 3 100;0;0 1.2304 True ENSG00000151835 ENSG00000151835 HGNC:10519 SAG gene SAG Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Oguchi disease-1, MIM# 258100;Retinitis pigmentosa 47, MIM# 613758 7670478;9565049;15234147;28549094;33047631 False 3 100;0;0 1.2304 True ENSG00000130561 ENSG00000130561 HGNC:10521 SALL1 gene SALL1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Townes-Brocks syndrome 1, MIM#107480;MONDO:0054581 False 3 100;0;0 1.2304 True ENSG00000103449 ENSG00000103449 HGNC:10524 SALL4 gene SALL4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Duane-radial ray syndrome, MIM# 607323;MONDO:0011812;IVIC syndrome, MIM# 147750;MONDO:0007836 20301547 False 3 100;0;0 1.2304 True ENSG00000101115 ENSG00000101115 HGNC:15924 SAMD7 gene SAMD7 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Macular dystrophy with or without cone dysfunction, MIM# 620762 38272031 False 3 100;0;0 1.2304 True ENSG00000187033 ENSG00000187033 HGNC:25394 SAMD9 gene SAMD9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal MIRAGE syndrome, MIM#617053;Tumoral calcinosis, familial, normophosphatemic, MIM#610455;Monosomy 7 myelodysplasia and leukemia syndrome 2, MIM# 619041 33237688;32619790;16960814;18094730 False 3 100;0;0 1.2304 True ENSG00000205413 ENSG00000205413 HGNC:1348 SAMD9L gene SAMD9L Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ataxia-pancytopenia syndrome, MIM# 159550;Intellectual disability 27259050;30923096;30322869;33710394 False 3 100;0;0 1.2304 True Other ENSG00000177409 ENSG00000177409 HGNC:1349 SAMHD1 gene SAMHD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 5, MIM# 612952 19525956;21102625;33307271;20301648 False 3 100;0;0 1.2304 True ENSG00000101347 ENSG00000101347 HGNC:15925 SAR1B gene SAR1B Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Chylomicron retention disease, MIM# 246700 12692552 False 3 100;0;0 1.2304 True ENSG00000152700 ENSG00000152700 HGNC:10535 SARS gene SARS Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal neurodevelopmental disorder MONDO#070009, SARS1-related;Genetic peripheral neuropathy MONDO#0020127, SARS1-related 28236339;34570399;35790048;36041817;36088542 False 3 67;33;0 1.2304 True ENSG00000031698 ENSG00000031698 HGNC:10537 SARS2 gene SARS2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hyperuricemia, pulmonary hypertension, renal failure, and alkalosis, MIM#613845 24034276;21255763;33751860 False 3 100;0;0 1.2304 True ENSG00000104835 ENSG00000104835 HGNC:17697 SART3 gene SART3 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder (MONDO#0700092), SART3-related;46,XY disorder of sex development (MONDO:0020040), SART3-related PMID: 37296101 False 3 100;0;0 1.2304 False ENSG00000075856 ENSG00000075856 HGNC:16860 SASH1 gene SASH1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dyschromatosis universalis hereditaria 1, MIM #127500;familial generalized lentiginosis MONDO:007891 23333244;27885802;32981204 False 3 50;50;0 1.2304 True ENSG00000111961 ENSG00000111961 HGNC:19182 SASH3 gene SASH3 Expert Review Green;Literature Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Immunodeficiency 102, MIM# 301082 33876203 False 3 100;0;0 1.2304 True ENSG00000122122 ENSG00000122122 HGNC:15975 SASS6 gene SASS6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephaly 14, primary, autosomal recessive, MIM# 616402 24951542;30639237;38501757;36739862 False 3 50;50;0 1.2304 True ENSG00000156876 ENSG00000156876 HGNC:25403 SAT1 gene SAT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Systemic lupus erythematosus, MONDO:0007915, SAT1-related;Keratosis follicularis spinulosa decalvans 12215835;20672378;9228047;35977808 False 3 33;33;33 1.2304 True ENSG00000130066 ENSG00000130066 HGNC:10540 SATB1 gene SATB1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Kohlschutter-Tonz syndrome-like, MIM# 619229;Developmental delay with dysmorphic facies and dental anomalies, MIM# 619228;Neurodevelopmental disorder;intellectual disability;epilepsy;microcephaly 33057194;33513338 False 3 75;25;0 1.2304 True Other ENSG00000182568 ENSG00000182568 HGNC:10541 SATB2 gene SATB2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Glass syndrome, MIM# 612313;MONDO:0100147 29023086;28151491;32446642 False 3 100;0;0 1.2304 True ENSG00000119042 ENSG00000119042 HGNC:21637 SBDS gene SBDS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Shwachman-Diamond syndrome, MIM# 260400 False 3 100;0;0 1.2304 True ENSG00000126524 ENSG00000126524 HGNC:19440 SBF1 gene SBF1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, type 4B3 , MIM#615284;MONDO:0014117 23749797;23749797;32444983;30039846;28005197 False 3 100;0;0 1.2304 True ENSG00000100241 ENSG00000100241 HGNC:10542 SBF2 gene SBF2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, type 4B2 , MIM#604563 12554688;15477569;12687498;15304601;31772832;31070812 False 3 100;0;0 1.2304 True ENSG00000133812 ENSG00000133812 HGNC:2135 SC5D gene SC5D Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Lathosterolosis, MIM# 607330 17853487;12189593;12812989;24142275 False 3 100;0;0 1.2304 True ENSG00000109929 ENSG00000109929 HGNC:10547 SCAF4 gene SCAF4 Expert Review;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Fliedner-Zweier syndrome, MIM#620511 32730804 False 3 100;0;0 1.2304 True ENSG00000156304 ENSG00000156304 HGNC:19304 SCAMP5 gene SCAMP5 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability;seizures;autism 31439720;33390987 False 3 100;0;0 1.2304 True Other ENSG00000198794 ENSG00000198794 HGNC:30386 SCAPER gene SCAPER Expert Review;Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Intellectual disability;retinitis pigmentosa 28794130;31069901;31192531;30723319 False 3 100;0;0 1.2304 True ENSG00000140386 ENSG00000140386 HGNC:13081 SCARB2 gene SCARB2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Progressive Myoclonus Epilepsy, MONDO:0020074;Epilepsy, progressive myoclonic 4, with or without renal failure, MIM #254900 18308289;18424452;23659519;19847901;18022370;19933215 False 3 100;0;0 1.2304 True ENSG00000138760 ENSG00000138760 HGNC:1665 SCARF2 gene SCARF2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Van den Ende-Gupta syndrome, MIM# 600920 20887961;23808541;24478002;27375131;24478002 False 3 100;0;0 1.2304 True ENSG00000244486 ENSG00000244486 HGNC:19869 SCLT1 gene SCLT1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Orofaciodigital syndrome type IX;Senior-Loken syndrome;Bardet-Biedl syndrome 32253632;28486600;30425282;30237576;28005958;24285566 False 3 50;50;0 1.2304 True ENSG00000151466 ENSG00000151466 HGNC:26406 SCN10A gene SCN10A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic pain syndrome, familial, 2, MIM# 615551 23115331;33775738;30731422;30554136 False 3 100;0;0 1.2304 True ENSG00000185313 ENSG00000185313 HGNC:10582 SCN11A gene SCN11A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuropathy, hereditary sensory and autonomic, type VII, MIM# 615548;Episodic pain syndrome, familial, 3, MIM# 615552 24036948;25118027;30395542;33884296;32831372;30046661 False 3 100;0;0 1.2304 True ENSG00000168356 ENSG00000168356 HGNC:10583 SCN1A gene SCN1A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 6 (Dravet syndrome), MIM# 607208;Developmental and epileptic encephalopathy 6B, non-Dravet, MIM# 619317;Genetic Epilepsy Febrile Seizures plus (GEFS+) Syndrome;Febrile seizures;Arthrogryposis multiplex congenita 30368457;12754708;25754450;32928894;29543227 False 3 67;33;0 1.2304 True ENSG00000144285 ENSG00000144285 HGNC:10585 SCN2A gene SCN2A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic ataxia, type 9, MIM# 618924;Seizures, benign familial infantile, 3, MIM# 607745;Developmental and epileptic encephalopathy 11, MIM# 613721 19786696;23662938;15028761;30185235;20956790;24650168;23935176;22495306 False 3 100;0;0 1.2304 True ENSG00000136531 ENSG00000136531 HGNC:10588 SCN3A gene SCN3A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epilepsy, familial focal, with variable foci 4, MIM# 617935;Epileptic encephalopathy, early infantile, 62, MIM# 617938;Intellectual disability;Malformations of cortical development 32515017 False 3 100;0;0 1.2304 True Other ENSG00000153253 ENSG00000153253 HGNC:10590 SCN4A gene SCN4A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Congenital myopathy 22A, classic, MIM# 620351;Congenital myopathy 22B, severe fetal, MIM# 620369;Hyperkalemic periodic paralysis, type 2, MIM# 170500;Hypokalemic periodic paralysis, type 2, MIM# 613345;Myasthenic syndrome, congenital, 16, MIM# 614198;Myotonia congenita, atypical, acetazolamide-responsive , MIM#608390;Paramyotonia congenita , MIM#168300 34671263 False 3 100;0;0 1.2304 True ENSG00000007314 ENSG00000007314 HGNC:10591 SCN8A gene SCN8A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 13, MIM#614558, dominant and recessive;Myoclonus, familial, 2, MIM# 618364;paroxysmal kinesigenic dyskinesias;Cognitive impairment with or without cerebellar ataxia, MIM# 614306 31625145;29726066;27098556;28702509;16236810;31904124;31887642;31675620;30615093 False 3 100;0;0 1.2304 True Other ENSG00000196876 ENSG00000196876 HGNC:10596 SCN9A gene SCN9A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Erythermalgia, primary, MIM# 133020;Insensitivity to pain, congenital, MIM# 243000;Neuropathy, hereditary sensory and autonomic, type IID, MIM# 243000;Paroxysmal extreme pain disorder, MIM# 167400;Small fiber neuropathy,MIM# 133020 False 3 100;0;0 1.2304 True ENSG00000169432 ENSG00000169432 HGNC:10597 SCNM1 gene SCNM1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Orofaciodigital syndrome XIX, MIM# 620107 PMID: 36084634 False 3 100;0;0 1.2304 True ENSG00000163156 ENSG00000163156 HGNC:23136 SCNN1A gene SCNN1A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Liddle syndrome 3 618126, MIM# AD, MONDO:0029132;Bronchiectasis with or without elevated sweat chloride 2, MIM# 613021 AD, MONDO:0013087;Pseudohypoaldosteronism, type I, MIM# 264350 AR, MIM#0009917 31301676;28710092;19462466;19017867 False 3 100;0;0 1.2304 True ENSG00000111319 ENSG00000111319 HGNC:10599 SCNN1B gene SCNN1B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Liddle syndrome 1, MIM# 177200;Pseudohypoaldosteronism, type I, MIM# 264350;Bronchiectasis with or without elevated sweat chloride 1 (MIM#211400) False 3 100;0;0 1.2304 True ENSG00000168447 ENSG00000168447 HGNC:10600 SCNN1G gene SCNN1G Expert Review;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Liddle syndrome 2, MIM# 618114;Pseudohypoaldosteronism, type I, MIM# 264350 22207244;31655555;30801930;28484659 False 3 50;50;0 1.2304 True ENSG00000166828 ENSG00000166828 HGNC:10602 SCO1 gene SCO1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 4, MIM# 619048 11013136;19295170;31352446;23878101 False 3 100;0;0 1.2304 True ENSG00000133028 ENSG00000133028 HGNC:10603 SCO2 gene SCO2 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency 1;Myopia 6;Charcot-Marie-Tooth type 4;Cerebellar ataxia and progressive peripheral axonal neuropthy 31844624;29351582;26427993 False 3 50;50;0 1.2304 True ENSG00000130489 ENSG00000130489 HGNC:10604 SCUBE3 gene SCUBE3 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Short stature, facial dysmorphism, and skeletal anomalies with or without cardiac anomalies, MIM# 619184;Short stature;skeletal abnormalities;craniofacial abnormalities;dental anomalies 33308444 False 3 100;0;0 1.2304 True ENSG00000146197 ENSG00000146197 HGNC:13655 SCYL1 gene SCYL1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 21, MIM# 616719 29419818;17571074;26581903;30531813 False 3 100;0;0 1.2304 True ENSG00000142186 ENSG00000142186 HGNC:14372 SDCCAG8 gene SDCCAG8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 16, MIM# 615993;MONDO:0014444;Senior-Loken syndrome 7, MIM# 613615;MONDO:0013326;Nephronophthisis 20835237;22626039;22626039;32432520;31534065;26968886 False 3 100;0;0 1.2304 True ENSG00000054282 ENSG00000054282 HGNC:10671 SDHA gene SDHA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial complex II deficiency, nuclear type 1, MIM# 252011;Cardiomyopathy, dilated, 1GG, MIM# 613642;Neurodegeneration with ataxia and late-onset optic atrophy, MIM# 619259;Paragangliomas 5 , MIM#614165 10976639;27683074;7550341;22972948;20551992;21752896 False 3 100;0;0 1.2304 True ENSG00000073578 ENSG00000073578 HGNC:10680 SDHAF1 gene SDHAF1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex II deficiency, nuclear type 2, MIM# 619166 19465911;26749241;22995659 False 3 100;0;0 1.2304 True ENSG00000205138 ENSG00000205138 HGNC:33867 SDR9C7 gene SDR9C7 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Ichthyosis, congenital, autosomal recessive 13 MIM#617574 28173123;28369735 False 3 100;0;0 1.2304 True ENSG00000170426 ENSG00000170426 HGNC:29958 SEC23B gene SEC23B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal "Dyserythropoietic anemia, congenital, type II , MIM#224100;Cowden syndrome 7, MIM# 616858" 19561605;19621418;26522472 False 3 100;0;0 1.2304 True ENSG00000101310 ENSG00000101310 HGNC:10702 SEC24D gene SEC24D Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cole-Carpenter syndrome 2, MIM# 616294 30462379;27942778;26467156;25683121 False 3 100;0;0 1.2304 True ENSG00000150961 ENSG00000150961 HGNC:10706 SEC61A1 gene SEC61A1 Expert list;Expert Review Amber;Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hyperuricemic nephropathy, familial juvenile, 4, MIM# 617056;Immunodeficiency, common variable, 15, MIM# 620670;Neutropenia, severe congenital, 11, autosomal dominant, MIM# 620674 27392076;32325141;28782633 False 3 67;33;0 1.2304 True ENSG00000058262 ENSG00000058262 HGNC:18276 SEC63 gene SEC63 Expert Review Amber;Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Polycystic liver disease 2, MIM# 617004 23209713;20095989 False 3 50;50;0 1.2304 True ENSG00000025796 ENSG00000025796 HGNC:21082 SECISBP2 gene SECISBP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Thyroid hormone metabolism, abnormal, MIM# 609698 16228000;19602558;21084748;22247018 False 3 100;0;0 1.2304 True ENSG00000187742 ENSG00000187742 HGNC:30972 SEL1L gene SEL1L Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with hypotonia, poor growth, dysmorphic facies, and agammaglobulinaemia, MIM# 621068;Neurodevelopmental disorder with poor growth, absent speech, progressive ataxia, and dysmorphic facies, MIM# 621067 PMID: 37943610;PMID: 37943617 False 3 100;0;0 1.2304 True ENSG00000071537 ENSG00000071537 HGNC:10717 SELENBP1 gene SELENBP1 ClinGen;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal extraoral halitosis due to methanethiol oxidase deficiency MONDO:0029144 29255262 False 3 100;0;0 1.2304 True ENSG00000143416 ENSG00000143416 HGNC:10719 SELENON gene SELENON Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Myopathy, congenital, with fiber-type disproportion, MIM# 255310;Muscular dystrophy, rigid spine, 1, MIM# 602771 11528383;12192640;16365872;21131290;21131290;32154989;32796131 False 3 100;0;0 1.2304 True ENSG00000162430 ENSG00000162430 HGNC:15999 SEMA3A gene SEMA3A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Hypogonadotropic hypogonadism 16 with or without anosmia - MIM#614897;congenital heart disease;short stature 28075028;33369061;20301509;21059704;24124006;22927827 False 3 100;0;0 1.2304 True ENSG00000075213 ENSG00000075213 HGNC:10723 SEMA3F gene SEMA3F Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypogonadotropic hypogonadism 33495532 False 3 100;0;0 1.2304 True ENSG00000001617 ENSG00000001617 HGNC:10728 SEMA6B gene SEMA6B Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Progressive myoclonic epilepsy;Intellectual disability, MONDO:0001071, SEMA6B related 32169168;35604360 False 3 100;0;0 1.2304 True Other ENSG00000167680 ENSG00000167680 HGNC:10739 SENP7 gene SENP7 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Arthrogryposis multiplex congenita, MONDO:0015168, SENP7-related PMID: 37460201;38972567 False 3 50;50;0 1.2304 True ENSG00000138468 ENSG00000138468 HGNC:30402 SEPHS1 gene SEPHS1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, SEPHS1-related 38531365 False 3 100;0;0 1.2304 True ENSG00000086475 ENSG00000086475 HGNC:19685 SEPSECS gene SEPSECS Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia type 2D, 613811;cerebellar ataxia and cognitive impairment 20920667;25044680;31748115;29464431 False 3 50;0;50 1.2304 True ENSG00000109618 ENSG00000109618 HGNC:30605 SEPT4 gene SEPT4 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal male infertility MONDO:0005372 36135717;15737931;15737930 False 3 100;0;0 1.2304 True ENSG00000108387 ENSG00000108387 HGNC:9165 SEPT9 gene SEPT9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophy, hereditary neuralgic, MIM# 162100 16186812;19451530;19939853;19139049 False 3 100;0;0 1.2304 True ENSG00000184640 ENSG00000184640 HGNC:7323 SERAC1 gene SERAC1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome, MIM# 614739 29205472;32684373;24741715 False 3 100;0;0 1.2304 True ENSG00000122335 ENSG00000122335 HGNC:21061 SERPINA1 gene SERPINA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Emphysema due to AAT deficiency, MIM#613490;Emphysema-cirrhosis, due to AAT deficiency, MIM#613490;Hemorrhagic diathesis due to antithrombin Pittburgh, MIM#613490;alpha 1-antitrypsin deficiency, MONDO#0013282 20301692;9041988;34408829 False 3 100;0;0 1.2304 True ENSG00000197249 ENSG00000197249 HGNC:8941 SERPINA6 gene SERPINA6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Corticosteroid-binding globulin deficiency, MIM#611489;Corticosteroid-binding globulin deficiency, MONDO#0012675 11502797;27214312;21795453;34308089;22013108 False 3 100;0;0 1.2304 True ENSG00000170099 ENSG00000170099 HGNC:1540 SERPINA7 gene SERPINA7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Thyroxine-binding globulin QTL MIM#300932;Thyroxine-binding globulin deficiency 34126618;32266677;17887925;28553659;29733970;16947003 False 3 100;0;0 1.2304 True ENSG00000123561 ENSG00000123561 HGNC:11583 SERPINB6 gene SERPINB6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 91, MIM# 613453 20451170;25719458;23669344 False 3 100;0;0 1.2304 True ENSG00000124570 ENSG00000124570 HGNC:8950 SERPINB7 gene SERPINB7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Palmoplantar keratoderma, Nagashima type (MIM#615598) 24773080;24207119;24514002;31706940 False 3 100;0;0 1.2304 True ENSG00000166396 ENSG00000166396 HGNC:13902 SERPINB8 gene SERPINB8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Peeling skin syndrome 5, MIM#617115 27476651 False 3 100;0;0 1.2304 True ENSG00000166401 ENSG00000166401 HGNC:8952 SERPINC1 gene SERPINC1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal hereditary antithrombin deficiency MONDO:0013144;Thrombophilia 7 due to antithrombin III deficiency, MIM#613118 31359133;30356112;23910795;28317092;29747524;11018075;14590998 False 3 100;0;0 1.2304 True ENSG00000117601 ENSG00000117601 HGNC:775 SERPIND1 gene SERPIND1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted heparin cofactor 2 deficiency, MONDO:0012876;Thrombophilia 10 due to heparin cofactor II deficiency, MIM#612356 2863444;8902986;2647747;15337701;31064749;11204559;8562924;29296762 False 3 100;0;0 1.2304 True ENSG00000099937 ENSG00000099937 HGNC:4838 SERPINE1 gene SERPINE1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Plasminogen activator inhibitor-1 deficiency, MIM# 613329 9207454;15650551 False 3 100;0;0 1.2304 True ENSG00000106366 ENSG00000106366 HGNC:8583 SERPINF1 gene SERPINF1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Osteogenesis imperfecta, type VI, MIM# 613982 21353196;23054245 False 3 100;0;0 1.2304 True ENSG00000132386 ENSG00000132386 HGNC:8824 SERPINF2 gene SERPINF2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Alpha-2-plasmin inhibitor deficiency, MIM# 262850 2572590;10583218;31441040;31282989;29656168 False 3 100;0;0 1.2304 True ENSG00000167711 ENSG00000167711 HGNC:9075 SERPING1 gene SERPING1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Angioedema, hereditary, 1 and 2, MIM#106100;Complement component 4, partial deficiency of, MIM#120790 35386643;31517426;29753808 False 3 100;0;0 1.2304 True ENSG00000149131 ENSG00000149131 HGNC:1228 SERPINH1 gene SERPINH1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Osteogenesis imperfecta, type X, MIM# 613848;Osteogenesis imperfecta type 10, MONDO:0013459 20188343;25510505;31179625;29520608 False 3 100;0;0 1.2304 True ENSG00000149257 ENSG00000149257 HGNC:1546 SERPINI1 gene SERPINI1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Encephalopathy, familial, with neuroserpin inclusion bodies MIM#604218 28631894;25401298;12103288 False 3 100;0;0 1.2304 True ENSG00000163536 ENSG00000163536 HGNC:8943 SET gene SET Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder, autosomal dominant 58, MIM#618106;intellectual disability, autosomal dominant 58, MONDO:0020847 29688601;29907757;25356899 False 3 100;0;0 1.2304 True ENSG00000119335 ENSG00000119335 HGNC:10760 SETBP1 gene SETBP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Schinzel-Giedion midface retraction syndrome, MIM# 269150;Intellectual disability, autosomal dominant 29, MIM# 616078 20436468;25217958;34807554 False 3 100;0;0 1.2304 True ENSG00000152217 ENSG00000152217 HGNC:15573 SETD1A gene SETD1A Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epilepsy, early-onset, with or without developmental delay, MIM# 618832;Neurodevelopmental disorder with speech impairment and dysmorphic facies, MIM# 619056 31197650;32346159 False 3 100;0;0 1.2304 True ENSG00000099381 ENSG00000099381 HGNC:29010 SETD1B gene SETD1B Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epilepsy with myoclonic absences;intellectual disability;Intellectual developmental disorder with seizures and language delay (IDDSELD), MIM#619000 32546566;29322246;31440728;31685013 False 3 100;0;0 1.2304 True ENSG00000139718 ENSG00000139718 HGNC:29187 SETD2 gene SETD2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Luscan-Lumish syndrome, MIM#616831;Rabin-Pappas syndrome,MIM# 620155;Intellectual developmental disorder, autosomal dominant 70, MIM# 620157 29681085;32710489 False 3 100;0;0 1.2304 True ENSG00000181555 ENSG00000181555 HGNC:18420 SETD5 gene SETD5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability, autosomal dominant 23 (MIM # 615761) 29484850 False 3 0;0;0 1.2304 True ENSG00000168137 ENSG00000168137 HGNC:25566 SF3B1 gene SF3B1 Expert Review Green;Other Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted complex neurodevelopmental disorder MONDO:0100038 False 3 0;100;0 1.2304 True ENSG00000115524 ENSG00000115524 HGNC:10768 SF3B2 gene SF3B2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Craniofacial microsomia, MIM#164210 34344887 False 3 100;0;0 1.2304 True ENSG00000087365 ENSG00000087365 HGNC:10769 SF3B4 gene SF3B4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Acrofacial dysostosis 1, Nager type, MIM# 154400 22541558;23568615;24003905 False 3 100;0;0 1.2304 True ENSG00000143368 ENSG00000143368 HGNC:10771 SFRP4 gene SFRP4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pyle disease, MIM#265900 27355534;31239337 False 3 100;0;0 1.2304 True ENSG00000106483 ENSG00000106483 HGNC:10778 SFTPA1 gene SFTPA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal "Idiopathic pulmonary fibrosis;Interstitial lung disease 1, MIM# 619611" 31601679;30854216;28869238;26792177;32855221 False 3 100;0;0 1.2304 True ENSG00000122852 ENSG00000122852 HGNC:10798 SFTPA2 gene SFTPA2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Pulmonary fibrosis, idiopathic, MIM# 178500 19100526;32602668 False 3 100;0;0 1.2304 True ENSG00000185303 ENSG00000185303 HGNC:10799 SFTPB gene SFTPB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Surfactant metabolism dysfunction, pulmonary, 1, MIM# 265120 8163685;8021783;10378403;10571948 False 3 100;0;0 1.2304 True ENSG00000168878 ENSG00000168878 HGNC:10801 SFTPC gene SFTPC Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Surfactant metabolism dysfunction, pulmonary, 2, MIM# 610913 11207353;11991887;11893657;15557112;19443464 False 3 100;0;0 1.2304 True ENSG00000168484 ENSG00000168484 HGNC:10802 SFXN4 gene SFXN4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 18, MIM#615578 31059822;24119684 False 3 100;0;0 1.2304 True ENSG00000183605 ENSG00000183605 HGNC:16088 SGCA gene SGCA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 3 MIM#608099;autosomal recessive limb-girdle muscular dystrophy, MONDO:0015152 30007747;9192266;34404573 False 3 100;0;0 1.2304 True ENSG00000108823 ENSG00000108823 HGNC:10805 SGCB gene SGCB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 4 MIM#604286;autosomal recessive limb-girdle muscular dystrophy, MONDO:0015152 18285821 False 3 100;0;0 1.2304 True ENSG00000163069 ENSG00000163069 HGNC:10806 SGCD gene SGCD Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 6, MIM# 601287;autosomal recessive limb-girdle muscular dystrophy MONDO:0015152 8841194;19259135;20623375;10838250;10735275;9832045;30733730 False 3 50;0;50 1.2304 True ENSG00000170624 ENSG00000170624 HGNC:10807 SGCE gene SGCE Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) Dystonia-11, myoclonic, MIM# 159900;MONDO:0008044 11528394;12821748;16227522 False 3 100;0;0 1.2304 True ENSG00000127990 ENSG00000127990 HGNC:10808 SGCG gene SGCG Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 5 MIM#253700;autosomal recessive limb-girdle muscular dystrophy MONDO:0015152 18285821;8923014;7481775;8968757;27708273 False 3 100;0;0 1.2304 True ENSG00000102683 ENSG00000102683 HGNC:10809 SGMS2 gene SGMS2 Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Calvarial doughnut lesions with bone fragility with or without spondylometaphyseal dysplasia MIM#126550 30779713;32028018 False 3 100;0;0 1.2304 True ENSG00000164023 ENSG00000164023 HGNC:28395 SGPL1 gene SGPL1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal RENI syndrome (MIM#617575) 33074640 False 3 100;0;0 1.2304 True ENSG00000166224 ENSG00000166224 HGNC:10817 SGSH gene SGSH Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mucopolysaccharidosis type IIIA (Sanfilippo A), MIM# 252900;MONDO:0009655 7493035;9158154;9401012;9554748 False 3 100;0;0 1.2304 True ENSG00000181523 ENSG00000181523 HGNC:10818 SGSM3 gene SGSM3 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder (MONDO:0700092), SGSM3-related PMID: 37833060;39390489 False 3 50;50;0 1.2304 True ENSG00000100359 ENSG00000100359 HGNC:25228 SH2B3 gene SH2B3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Predisposition to haematological malignancies;Myeloproliferation and multi-organ autoimmunity;juvenile myelomonocytic leukemia MONDO:001190, SH2B3-related 26457647;23908464;31102422;31173385;37206266;38152053 False 3 100;0;0 1.2304 True ENSG00000111252 ENSG00000111252 HGNC:29605 SH2D1A gene SH2D1A Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Lymphoproliferative syndrome, X-linked, 1, MIM# 308240 6306053;9771704;11049992;20301580 False 3 100;0;0 1.2304 True ENSG00000183918 ENSG00000183918 HGNC:10820 SH3BP2 gene SH3BP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cherubism, MIM#118400 11381256;22640988;20301316;22153076 False 3 100;0;0 1.2304 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000087266 ENSG00000087266 HGNC:10825 SH3PXD2B gene SH3PXD2B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Frank-ter Haar syndrome, MIM# 249420 24105366;20137777;34538861;33234702;31978614 False 3 100;0;0 1.2304 True ENSG00000174705 ENSG00000174705 HGNC:29242 SH3TC2 gene SH3TC2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, type 4C MIM#601596, Mononeuropathy of the median nerve, mild MIM#613353 19744956;20220177;19744956;20028792 False 3 100;0;0 1.2304 True ENSG00000169247 ENSG00000169247 HGNC:29427 SHANK1 gene SHANK1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, SHANK1-related 34113010;22503632;25188300 False 3 100;0;0 1.2304 True ENSG00000161681 ENSG00000161681 HGNC:15474 SHANK2 gene SHANK2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Autism susceptibility 17};Autism spectrum disorder with or without intellectual disability 30072871;30911184;20473310 False 3 100;0;0 1.2304 True ENSG00000162105 ENSG00000162105 HGNC:14295 SHANK3 gene SHANK3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Phelan-McDermid syndrome 606232;MONDO:0011652" 16284256;17173049;20186804;22892527 False 3 100;0;0 1.2304 True ENSG00000251322 ENSG00000251322 HGNC:14294 SHARPIN gene SHARPIN Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Autoinflammation with episodic fever and immune dysregulation, MIM# 620795 38609546 False 3 100;0;0 1.2304 True ENSG00000179526 ENSG00000179526 HGNC:25321 SHH gene SHH Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Holoprosencephaly 3, MIM#142945;Microphthalmia with coloboma 5, MIM#611638;Single median maxillary central incisor, MIM#147250;Hypertelorism, ACC, intellectual disability 21976454;12503095;22791840;19057928;19533790;38562108;29321670;32703609 False 3 100;0;0 1.2304 True ENSG00000164690 ENSG00000164690 HGNC:10848 SHMT2 gene SHMT2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with cardiomyopathy, spasticity, and brain abnormalities (NEDCASB), MIM#619121;Congenital microcephaly;Infantile axial hypotonia;Spastic paraparesis;Global developmental delay;Intellectual disability;Abnormality of the corpus callosum;Abnormal cortical gyration;Hypertrophic cardiomyopathy;Abnormality of the face;Proximal placement of thumb;2-3 toe syndactyly 33015733 False 3 100;0;0 1.2304 True ENSG00000182199 ENSG00000182199 HGNC:10852 SHOC2 gene SHOC2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Noonan syndrome-like with loose anagen hair 1, MIM# 607721 19684605;23918763;20882035 False 3 100;0;0 1.2304 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000108061 ENSG00000108061 HGNC:15454 SHOX gene SHOX Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Langer mesomelic dysplasia, MIM# 249700;Leri-Weill dyschondrosteosis, MIM# 127300 False 3 100;0;0 1.2304 True ENSG00000185960 ENSG00000185960 HGNC:10853 SHQ1 gene SHQ1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Dystonia 35, childhood-onset , MIM# 619921;Neurodevelopmental disorder with dystonia and seizures, MIM# 619922 34542157;29178645;36847845;37475611 False 3 100;0;0 1.2304 True ENSG00000144736 ENSG00000144736 HGNC:25543 SHROOM4 gene SHROOM4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Congenital anomaly of the kidney and urinary tracy (CAKUT), SHROOM4-related, MONDO:0019719;epilepsy, idiopathic generalised, SHROOM4-related, MONDO:0005579 16249884;26740508 False 3 50;50;0 1.2304 True ENSG00000158352 ENSG00000158352 HGNC:29215 SI gene SI Expert Review;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Sucrase-isomaltase deficiency, congenital #222900 3149304;31557950 False 3 100;0;0 1.2304 True ENSG00000090402 ENSG00000090402 HGNC:10856 SIAH1 gene SIAH1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Buratti-Harel syndrome, MIM# 619314;Developmental delay;Infantile hypotonia;Dysmorphic features;Laryngomalacia 32430360 False 3 100;0;0 1.2304 True ENSG00000196470 ENSG00000196470 HGNC:10857 SIGMAR1 gene SIGMAR1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Amyotrophic lateral sclerosis 16, juvenile 614373;?Spinal muscular atrophy, distal, autosomal recessive, 2 605726;distal hereditary motor neuropathy of Jerash type (HMNJ) 31511340 False 3 100;0;0 1.2304 True ENSG00000147955 ENSG00000147955 HGNC:8157 SIK1 gene SIK1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 30, MIM#616341;developmental and epileptic encephalopathy, MONDO#0100062 25839329;27966542;35267137 False 3 100;0;0 1.2304 True ENSG00000142178 ENSG00000142178 HGNC:11142 SIL1 gene SIL1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Marinesco-Sjogren syndrome, MIM#248800;MONDO#0009567 24176978;16282977;20301371 False 3 100;0;0 1.2304 True ENSG00000120725 ENSG00000120725 HGNC:24624 SIM1 gene SIM1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted congenital obesity;Prader-Willi-like syndrome 33434169;30926952;23778136;23778139 False 3 100;0;0 1.2304 True ENSG00000112246 ENSG00000112246 HGNC:10882 SIN3A gene SIN3A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Witteveen-Kolk syndrome, OMIM # 613406 27399968 False 3 100;0;0 1.2304 True ENSG00000169375 ENSG00000169375 HGNC:19353 SIN3B gene SIN3B Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Syndromic intellectual disability/autism spectrum disorder PMID: 33811806 False 3 100;0;0 1.2304 True ENSG00000127511 ENSG00000127511 HGNC:19354 SIX1 gene SIX1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Deafness, autosomal dominant 23, MIM# 605192;Branchiootic syndrome 3, MIM# 608389;Sagittal synostosis;Multi-suture synostosis 15141091;18330911;21254961;17637804;29500469;21700001;24164807;33436522 False 3 100;0;0 1.2304 True ENSG00000126778 ENSG00000126778 HGNC:10887 SIX3 gene SIX3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Holoprosencephaly 2, MIM# 157170;MONDO:0007999 10369266;16323008;19346217 False 3 100;0;0 1.2304 True ENSG00000138083 ENSG00000138083 HGNC:10889 SIX6 gene SIX6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Optic disc anomalies with retinal and/or macular dystrophy, MIM# 212550 23167593;24702266;33108933;31207931;24702266 False 3 100;0;0 1.2304 True ENSG00000184302 ENSG00000184302 HGNC:10892 SKI gene SKI Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Shprintzen-Goldberg syndrome, MIM#182212 15884042;23023332 False 3 100;0;0 1.2304 True ENSG00000157933 ENSG00000157933 HGNC:10896 SKIV2L gene SKIV2L Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal "Trichohepatoenteric syndrome 2 614602;Intellectual disability" 22444670;29334452 False 3 50;50;0 1.2304 True ENSG00000204351 ENSG00000204351 HGNC:10898 SLC10A1 gene SLC10A1 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Familial hypercholanemia-2, MIM#619256 24867799;27882152;28835676;29290974;31201272 False 3 100;0;0 1.2304 True ENSG00000100652 ENSG00000100652 HGNC:10905 SLC10A7 gene SLC10A7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Short stature, amelogenesis imperfecta, and skeletal dysplasia with scoliosis, MIM# 618363 30082715;29878199;31191616 False 3 100;0;0 1.2304 True ENSG00000120519 ENSG00000120519 HGNC:23088 SLC11A2 gene SLC11A2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Anaemia, hypochromic microcytic, with iron overload 1 MIM#206100 21871825;15459009 False 3 100;0;0 1.2304 True ENSG00000110911 ENSG00000110911 HGNC:10908 SLC12A1 gene SLC12A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bartter syndrome, type 1, MIM# 601678 8640224;9355073;28095294 False 3 100;0;0 1.2304 True ENSG00000074803 ENSG00000074803 HGNC:10910 SLC12A2 gene SLC12A2 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Delpire-McNeill syndrome, MIM# 619083;Kilquist syndrome, MIM#619080;deafness, intellectual disability, dysmorphic features, absent salivation;Deafness, autosomal dominant 78, MIM#619081;Congenital, severe to profound hearing loss" 28135719;32658972;27900370;32294086;29288388;30740830;32754646 False 3 100;0;0 1.2304 True ENSG00000064651 ENSG00000064651 HGNC:10911 SLC12A3 gene SLC12A3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Gitelman syndrome, MIM# 263800 8528245;11102542 False 3 100;0;0 1.2304 True ENSG00000070915 ENSG00000070915 HGNC:10912 SLC12A5 gene SLC12A5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Developmental and epileptic encephalopathy 34, MIM# 616645;{Epilepsy, idiopathic generalized, susceptibility to, 14}, MIM# 616685 26333769;27436767;24928908;30763027;24668262 False 3 100;0;0 1.2304 True ENSG00000124140 ENSG00000124140 HGNC:13818 SLC12A6 gene SLC12A6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Andermann syndrome;Agenesis of the corpus callosum with peripheral neuropathy, MIM#21800;Charcot-Marie-Tooth disease, axonal, type 2II , MIM#620068 31439721 False 3 100;0;0 1.2304 True ENSG00000140199 ENSG00000140199 HGNC:10914 SLC12A9 gene SLC12A9 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092, SLC12A9-related 38334070 False 3 100;0;0 1.2304 True ENSG00000146828 ENSG00000146828 HGNC:17435 SLC13A3 gene SLC13A3 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy, acute reversible, with increased urinary alpha-ketoglutarate (MIM# 618384) 30635937;35527102;https://www.neurology.org/doi/full/10.1212/NXG.0000000000200101 (No PMID) False 3 100;0;0 1.2304 True ENSG00000158296 ENSG00000158296 HGNC:14430 SLC13A5 gene SLC13A5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 25, with amelogenesis imperfecta MIM#615905;MONDO:0014392 24995870;26384929 False 3 100;0;0 1.2304 True ENSG00000141485 ENSG00000141485 HGNC:23089 SLC16A1 gene SLC16A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Erythrocyte lactate transporter defect, MIM# 245340;Hyperinsulinemic hypoglycaemia, familial, 7, MIM# 610021;Monocarboxylate transporter 1 deficiency, MIM# 616095 25390740;32170320 False 3 100;0;0 1.2304 True ENSG00000155380 ENSG00000155380 HGNC:10922 SLC16A12 gene SLC16A12 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cataract 47, juvenile, with microcornea, MIM# 612018 20181839;21778275;18304496;29088427;34126080 False 3 100;0;0 1.2304 True ENSG00000152779 ENSG00000152779 HGNC:23094 SLC16A2 gene SLC16A2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Allan-Herndon-Dudley syndrome, MIM# 300523 15980113;31410843;20301789 False 3 100;0;0 1.2304 True ENSG00000147100 ENSG00000147100 HGNC:10923 SLC17A5 gene SLC17A5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Salla disease 604369;MONDO:0011449;Sialic acid storage disorder, infantile 269920;MONDO:0010027 10581036;10947946;33862140 False 3 100;0;0 1.2304 True ENSG00000119899 ENSG00000119899 HGNC:10933 SLC17A8 gene SLC17A8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Deafness, autosomal dominant 25, MIM# 605583 18674745;26797701;28647561 False 3 100;0;0 1.2304 True ENSG00000179520 ENSG00000179520 HGNC:20151 SLC18A2 gene SLC18A2 Expert Review;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Parkinsonism-dystonia, infantile, 2, MIM# 618049" 23363473;31240161;26497564 False 3 100;0;0 1.2304 True ENSG00000165646 ENSG00000165646 HGNC:10935 SLC18A3 gene SLC18A3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 21, presynaptic, MIM#617239 27590285;20123977;28188302;31059209 False 3 100;0;0 1.2304 True ENSG00000187714 ENSG00000187714 HGNC:10936 SLC19A2 gene SLC19A2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Thiamine-responsive megaloblastic anemia syndrome, MIM# 249270 10391221;10978358 False 3 100;0;0 1.2304 True ENSG00000117479 ENSG00000117479 HGNC:10938 SLC19A3 gene SLC19A3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Thiamine metabolism dysfunction syndrome 2 (biotin- or thiamine-responsive encephalopathy type 2), MIM# 607483 15871139;20065143;23482991;24878502;23589815;24166474;26975589;27896110 False 3 100;0;0 1.2304 True ENSG00000135917 ENSG00000135917 HGNC:16266 SLC1A2 gene SLC1A2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 41, MIM# 617105 27476654;28777935;30937933;23934111 False 3 100;0;0 1.2304 True Other ENSG00000110436 ENSG00000110436 HGNC:10940 SLC1A3 gene SLC1A3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic ataxia, type 6, MIM# 612656 19139306;16116111;29208948;27829685 False 3 100;0;0 1.2304 True ENSG00000079215 ENSG00000079215 HGNC:10941 SLC1A4 gene SLC1A4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic tetraplegia, thin corpus callosum, and progressive microcephaly, MIM# 616657;MONDO:0014725 25930971;26138499;26041762;27193218;29989513 False 3 100;0;0 1.2304 True ENSG00000115902 ENSG00000115902 HGNC:10942 SLC20A1 gene SLC20A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Bladder-Exstrophy-Epispadias Complex (BEEC), MONDO:0017919, SLC20A1-related 32850778;27013921 False 3 100;0;0 1.2304 True ENSG00000144136 ENSG00000144136 HGNC:10946 SLC20A2 gene SLC20A2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Basal ganglia calcification, idiopathic, 1, MIM# 213600;?hereditary multiple exostoses 22327515;23334463;24209445;23437308;32705272;27943094 False 3 100;0;0 1.2304 True ENSG00000168575 ENSG00000168575 HGNC:10947 SLC22A12 gene SLC22A12 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypouricemia, renal, MIM# 220150, MONDO:0020728 14655203;34412930;34756726;34829836;26821810 False 3 100;0;0 1.2304 True ENSG00000197891 ENSG00000197891 HGNC:17989 SLC22A5 gene SLC22A5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Carnitine deficiency, systemic primary, MIM# 212140, MONDO:0008919 9916797;10072434;10051646;10425211;10480371;10679939;9837751;23379544;31399326 False 3 100;0;0 1.2304 True ENSG00000197375 ENSG00000197375 HGNC:10969 SLC24A1 gene SLC24A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Night blindness, congenital stationary (complete), 1D, autosomal recessive, MIM#613830, MONDO:0013450 35486108;35446361;20850105;26822852 False 3 100;0;0 1.2304 True ENSG00000074621 ENSG00000074621 HGNC:10975 SLC24A4 gene SLC24A4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Amelogenesis imperfecta, type IIA5, MIM# 615887 23375655;24621671;25442250;24532815;26502894;27129268 False 3 100;0;0 1.2304 True ENSG00000140090 ENSG00000140090 HGNC:10978 SLC24A5 gene SLC24A5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Albinism, oculocutaneous, type VI, MIM# 113750 23364476;23985994;26491832 False 3 100;0;0 1.2304 True ENSG00000188467 ENSG00000188467 HGNC:20611 SLC25A1 gene SLC25A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined D-2- and L-2-hydroxyglutaric aciduria MIM#: 615182, MONDO:0014072;Myasthenic syndrome, congenital, 23, presynaptic, MIM#618197, MONDO:0032596 26870663;31527857;31808147;23561848;23393310 False 3 100;0;0 1.2304 True ENSG00000100075 ENSG00000100075 HGNC:10979 SLC25A12 gene SLC25A12 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 39, MIM# 612949 19641205;24515575;35008954;32700846;31766059;31514314 False 3 100;0;0 1.2304 True ENSG00000115840 ENSG00000115840 HGNC:10982 SLC25A13 gene SLC25A13 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Citrullinemia, type II, neonatal-onset, MIM# 605814;Citrullinemia, adult-onset type II, MIM# 603471 21424115;11343052 False 3 100;0;0 1.2304 True ENSG00000004864 ENSG00000004864 HGNC:10983 SLC25A15 gene SLC25A15 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hyperornithinaemia-hyperammonaemia-homocitrullinaemia syndrome , MIM#238970 10369256;19242930 False 3 100;0;0 1.2304 True ENSG00000102743 ENSG00000102743 HGNC:10985 SLC25A19 gene SLC25A19 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephaly, Amish type, MIM#607196;Thiamine metabolism dysfunction syndrome 4 (progressive polyneuropathy type), MIM#613710 31506564;31295743;12185364;19798730 False 3 100;0;0 1.2304 True ENSG00000125454 ENSG00000125454 HGNC:14409 SLC25A20 gene SLC25A20 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Carnitine-acylcarnitine translocase deficiency, MIM# 212138 15363639;15365988;24088670 False 3 100;0;0 1.2304 True ENSG00000178537 ENSG00000178537 HGNC:1421 SLC25A22 gene SLC25A22 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 3, MIM# 609304 15592994;19780765;24596948;33821742;33342683;31285529 False 3 100;0;0 1.2304 True ENSG00000177542 ENSG00000177542 HGNC:19954 SLC25A24 gene SLC25A24 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Fontaine progeroid syndrome, MIM#612289 29100093;29100094;29100094;31775791;32732226;32860237 False 3 100;0;0 1.2304 True ENSG00000085491 ENSG00000085491 HGNC:20662 SLC25A26 gene SLC25A26 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 28, MIM# 616794 26522469 False 3 100;0;0 1.2304 True ENSG00000144741 ENSG00000144741 HGNC:20661 SLC25A3 gene SLC25A3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial phosphate carrier deficiency, MIM# 610773 17273968;21763135;25681081 False 3 100;0;0 1.2304 True ENSG00000075415 ENSG00000075415 HGNC:10989 SLC25A32 gene SLC25A32 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Exercise intolerance, riboflavin-responsive, MIM# 616839 26933868;28443623 False 3 100;0;0 1.2304 True ENSG00000164933 ENSG00000164933 HGNC:29683 SLC25A36 gene SLC25A36 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Hyperinsulinemic hypoglycemia, familial, 8 - MIM#620211 34971397;34576089;31036718 False 3 100;0;0 1.2304 True ENSG00000114120 ENSG00000114120 HGNC:25554 SLC25A38 gene SLC25A38 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Anemia, sideroblastic, 2, pyridoxine-refractory, MIM# 205950 19412178 False 3 100;0;0 1.2304 True ENSG00000144659 ENSG00000144659 HGNC:26054 SLC25A4 gene SLC25A4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 12A (cardiomyopathic type) AD, MIM#617184;Mitochondrial DNA depletion syndrome 12B (cardiomyopathic type) AR, MIM#615418;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 2, MIM#609283 30046662;30013777;29654543;28823815 False 3 100;0;0 1.2304 True ENSG00000151729 ENSG00000151729 HGNC:10990 SLC25A42 gene SLC25A42 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Metabolic crises, recurrent, with variable encephalomyopathic features and neurologic regression , MIM#618416 26541337;29327420;29923093;34258143 False 3 100;0;0 1.2304 True ENSG00000181035 ENSG00000181035 HGNC:28380 SLC25A46 gene SLC25A46 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neuropathy, hereditary motor and sensory, type VIB, MIM# 616505;Pontocerebellar hypoplasia, type 1E, MIM# 619303 30178502;26168012;27543974;27430653;27390132;28934388;28558379 False 3 100;0;0 1.2304 True ENSG00000164209 ENSG00000164209 HGNC:25198 SLC26A2 gene SLC26A2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Achondrogenesis 1B, MIM#600972;Atelosteogenesis, type II, MIM#256050;Diastrophic dysplasia, MIM#222600;Epiphyseal dysplasia, multiple, 4, MIM#226900 20301483;20301689;11241838;31880411 False 3 100;0;0 1.2304 True ENSG00000155850 ENSG00000155850 HGNC:10994 SLC26A3 gene SLC26A3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Diarrhoea 1, secretory chloride, congenital, MIM# 214700 31325522;19861545;11524734 False 3 100;0;0 1.2304 True ENSG00000091138 ENSG00000091138 HGNC:3018 SLC26A4 gene SLC26A4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 4, with enlarged vestibular aqueduct 600791;Pendred syndrome 274600 24599119 False 3 100;0;0 1.2304 True ENSG00000091137 ENSG00000091137 HGNC:8818 SLC26A7 gene SLC26A7 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital hypothyroidism, MONDO:0018612, SLC26A7-related 34780050;32486989;31372509;30333321 False 3 100;0;0 1.2304 True ENSG00000147606 ENSG00000147606 HGNC:14467 SLC26A8 gene SLC26A8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal non-syndromic male infertility due to sperm motility disorder MONDO:0017173 34923715;23582645;22121115 False 3 100;0;0 1.2304 True ENSG00000112053 ENSG00000112053 HGNC:14468 SLC27A4 gene SLC27A4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ichthyosis prematurity syndrome, MIM#608649 21856041;19631310;31168818 False 3 100;0;0 1.2304 True ENSG00000167114 ENSG00000167114 HGNC:10998 SLC29A3 gene SLC29A3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Histiocytosis-lymphadenopathy plus syndrome, MIM# 602782 18940313;19336477;22238637 False 3 100;0;0 1.2304 True ENSG00000198246 ENSG00000198246 HGNC:23096 SLC2A1 gene SLC2A1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal GLUT1 deficiency syndrome 1, infantile onset, severe, MIM#606777;Dystonia 9, MIM#601042;Stomatin-deficient cryohydrocytosis with neurologic defects, MIM#608885;GLUT1 deficiency syndrome 2, childhood onset, MIM#612126;{Epilepsy, idiopathic generalized, susceptibility to, 12}, MIM#614847 18451999;20129935;10980529;20221955;31196579 False 3 100;0;0 1.2304 True ENSG00000117394 ENSG00000117394 HGNC:11005 SLC2A10 gene SLC2A10 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Arterial tortuosity syndrome, MIM# 208050 30071989;16550171;17935213 False 3 100;0;0 1.2304 True ENSG00000197496 ENSG00000197496 HGNC:13444 SLC2A2 gene SLC2A2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Fanconi-Bickel syndrome, MIM# 227810 30950137;22145468 False 3 100;0;0 1.2304 True ENSG00000163581 ENSG00000163581 HGNC:11006 SLC2A9 gene SLC2A9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Hypouricaemia, renal, 2, MIM# 612076 19026395;19926891;21810765;25966807;21256783 False 3 100;0;0 1.2304 True ENSG00000109667 ENSG00000109667 HGNC:13446 SLC30A10 gene SLC30A10 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypermanganesemia with dystonia 1, MIM# 613280 22341972;22341971;29193034 False 3 100;0;0 1.2304 True ENSG00000196660 ENSG00000196660 HGNC:25355 SLC30A2 gene SLC30A2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Zinc deficiency, transient neonatal , MIM#608118 17065149;22733820;32278324;30450693;28665435 False 3 100;0;0 1.2304 True ENSG00000158014 ENSG00000158014 HGNC:11013 SLC30A9 gene SLC30A9 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "Birk-Landau-Perez syndrome (MIM#617595)" 37041080 False 3 100;0;0 1.2304 True ENSG00000014824 ENSG00000014824 HGNC:1329 SLC32A1 gene SLC32A1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Generalized epilepsy with febrile seizures plus, type 12, MIM# 620755;Developmental and epileptic encephalopathy 114, MIM# 620774 34038384;36073542 False 3 100;0;0 1.2304 True ENSG00000101438 ENSG00000101438 HGNC:11018 SLC33A1 gene SLC33A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital cataracts, hearing loss, and neurodegeneration, MIM# 614482;Spastic paraplegia 42, autosomal dominant, MIM# 612539 31194315;19061983;20461110 False 3 100;0;0 1.2304 True ENSG00000169359 ENSG00000169359 HGNC:95 SLC34A1 gene SLC34A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hypercalcaemia, infantile, 2 MIM#616963;Nephrolithiasis/osteoporosis, hypophosphatemic, 1 612286 26047794;33516786;33099630;32866123;31188746;30943683;12324554;32216560;30778725 False 3 100;0;0 1.2304 True ENSG00000131183 ENSG00000131183 HGNC:11019 SLC34A2 gene SLC34A2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pulmonary alveolar microlithiasis, MIM# 265100 16960801;34581165;33884208;32328294;31941744 False 3 100;0;0 1.2304 True ENSG00000157765 ENSG00000157765 HGNC:11020 SLC34A3 gene SLC34A3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypophosphatemic rickets with hypercalciuria, (MIM#241530) 32524022 False 3 100;0;0 1.2304 True ENSG00000198569 ENSG00000198569 HGNC:20305 SLC35A1 gene SLC35A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IIf, MIM# 603585 28856833;23873973;11157507 False 3 100;0;0 1.2304 True ENSG00000164414 ENSG00000164414 HGNC:11021 SLC35A2 gene SLC35A2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Congenital disorder of glycosylation, type IIm (MIM #300896) 30817854;Mild malformation of cortical development with oligodendroglial hyperplasia in epilepsy (MOGHE) 23561849;24115232;27743886;25778940;33407896 False 3 100;0;0 1.2304 True ENSG00000102100 ENSG00000102100 HGNC:11022 SLC35A3 gene SLC35A3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Arthrogryposis, mental retardation, and seizures OMIM #615553;Skeletal dysplasia;Congenital disorder of glycosylation 28777481;28328131;24031089 False 3 100;0;0 1.2304 True ENSG00000117620 ENSG00000117620 HGNC:11023 SLC35C1 gene SLC35C1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IIc, MIM# 266265, MONDO:0009953 11326279;12116250;33098347;32313197;24403049 False 3 100;0;0 1.2304 True ENSG00000181830 ENSG00000181830 HGNC:20197 SLC35D1 gene SLC35D1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Schneckenbecken dysplasia, MIM 269250, MONDO:0010013;O-xylosyl/N-acetylgalactosaminylglycan synthesis deficiencies (Disorders of protein O-glycosylation) 31423530;19508970;17952091 False 3 100;0;0 1.2304 True ENSG00000116704 ENSG00000116704 HGNC:20800 SLC37A3 gene SLC37A3 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal retinitis pigmentosa, MONDO:0019200 28041643;35486108 False 3 100;0;0 1.2304 True ENSG00000157800 ENSG00000157800 HGNC:20651 SLC37A4 gene SLC37A4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Glycogen storage disease Ib 232220;Glycogen storage disease Ic 232240;Congenital disorder of glycosylation 33964207;9675154;9758626 False 3 100;0;0 1.2304 True ENSG00000137700 ENSG00000137700 HGNC:4061 SLC38A3 gene SLC38A3 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 102, MIM# 619881 34605855 False 3 100;0;0 1.2304 True ENSG00000188338 ENSG00000188338 HGNC:18044 SLC38A8 gene SLC38A8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Foveal hypoplasia 2, with or without optic nerve misrouting and/or anterior segment dysgenesis OMIM:609218;foveal hypoplasia - optic nerve decussation defect - anterior segment dysgenesis syndrome MONDO:0012216 32744312 False 3 100;0;0 1.2304 True ENSG00000166558 ENSG00000166558 HGNC:32434 SLC39A13 gene SLC39A13 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ehlers-Danlos syndrome, spondylodysplastic type, 3, MIM# 612350 18985159;18513683;28306229;28306225 False 3 100;0;0 1.2304 True ENSG00000165915 ENSG00000165915 HGNC:20859 SLC39A14 gene SLC39A14 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypermanganesemia with dystonia 2, MIM# 617013 27231142;29685658 False 3 100;0;0 1.2304 True ENSG00000104635 ENSG00000104635 HGNC:20858 SLC39A4 gene SLC39A4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Acrodermatitis enteropathica, MIM# 201100 19370757 False 3 100;0;0 1.2304 True ENSG00000147804 ENSG00000147804 HGNC:17129 SLC39A7 gene SLC39A7 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Agammaglobulinaemia 9, autosomal recessive, MIM# 619693;Antibody deficiency;early onset infections;blistering dermatosis;failure to thrive;thrombocytopaenia" 30718914 False 3 100;0;0 1.2304 True ENSG00000112473 ENSG00000112473 HGNC:4927 SLC39A8 gene SLC39A8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IIn , MIM#16721 26637978;26637979 False 3 100;0;0 1.2304 True ENSG00000138821 ENSG00000138821 HGNC:20862 SLC3A1 gene SLC3A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Cystinuria, MIM# 220100 25964309 False 3 100;0;0 1.2304 True ENSG00000138079 ENSG00000138079 HGNC:11025 SLC40A1 gene SLC40A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Haemochromatosis, type 4, MIM# 606069 11431687;11518736;15956209;16351644 False 3 100;0;0 1.2304 True ENSG00000138449 ENSG00000138449 HGNC:10909 SLC44A1 gene SLC44A1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal progressive ataxia;tremor;cognitive decline;dysphagia;optic atrophy;dysarthria 31855247 False 3 100;0;0 1.2304 True ENSG00000070214 ENSG00000070214 HGNC:18798 SLC45A1 gene SLC45A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Intellectual developmental disorder with neuropsychiatric features, MIM# 617532 28434495;39003656 False 3 100;0;0 1.2304 True ENSG00000162426 ENSG00000162426 HGNC:17939 SLC45A2 gene SLC45A2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Albinism, oculocutaneous, type IV, MIM# 606574;MONDO:0011683 11574907;14722913;14961451 False 3 100;0;0 1.2304 True ENSG00000164175 ENSG00000164175 HGNC:16472 SLC46A1 gene SLC46A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Folate malabsorption, hereditary, MIM# 229050 17446347;17129779;21333572 False 3 100;0;0 1.2304 True ENSG00000076351 ENSG00000076351 HGNC:30521 SLC4A1 gene SLC4A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Cryohydrocytosis MIM# 185020;Distal renal tubular acidosis 4 with haemolytic anaemia MIM# 611590;Ovalocytosis, SA type MIM# 166900;Spherocytosis, type 4 MIM# 612653;Distal renal tubular acidosis 1 MIM# 179800 16227998;15211439;7949112;8640229;16227998;8640229;16227998;33881640;32632909 False 3 100;0;0 1.2304 True ENSG00000004939 ENSG00000004939 HGNC:11027 SLC4A10 gene SLC4A10 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with hypotonia and characteristic brain abnormalities, MIM# 620746 PMID: 37459438 False 3 100;0;0 1.2304 True ENSG00000144290 ENSG00000144290 HGNC:13811 SLC4A11 gene SLC4A11 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Corneal dystrophy, Fuchs endothelial, 4, MIM# 613268;Corneal endothelial dystrophy and perceptive deafness, MIM# 217400;Corneal endothelial dystrophy, autosomal recessive, MIM# 217700 False 3 100;0;0 1.2304 True ENSG00000088836 ENSG00000088836 HGNC:16438 SLC4A3 gene SLC4A3 Expert Review;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Short QT syndrome 7, MIM#620231 29167417;34557911;36806574 False 3 50;50;0 1.2304 True ENSG00000114923 ENSG00000114923 HGNC:11029 SLC4A4 gene SLC4A4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Renal tubular acidosis, proximal, with ocular abnormalities, MIM# 604278;Hemiplegic migraine 10545938;11274232;35260236;33439394;29914390 False 3 100;0;0 1.2304 True ENSG00000080493 ENSG00000080493 HGNC:11030 SLC52A2 gene SLC52A2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Brown-Vialetto-Van Laere syndrome 2, MIM# 614707 False 3 100;0;0 1.2304 True ENSG00000185803 ENSG00000185803 HGNC:30224 SLC52A3 gene SLC52A3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Brown-Vialetto-Van Laere syndrome 1, MIM# 211530 False 3 100;0;0 1.2304 True ENSG00000101276 ENSG00000101276 HGNC:16187 SLC5A1 gene SLC5A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Glucose/galactose malabsorption, MIM# 606824 20486940;32946683 False 3 100;0;0 1.2304 True ENSG00000100170 ENSG00000100170 HGNC:11036 SLC5A2 gene SLC5A2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Renal glucosuria, MIM# 233100 False 3 100;0;0 1.2304 True ENSG00000140675 ENSG00000140675 HGNC:11037 SLC5A5 gene SLC5A5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Thyroid dyshormonogenesis 1, MIM# 274400;MONDO:0020716 9745458;9171822;33815280;32319661 False 3 100;0;0 1.2304 True ENSG00000105641 ENSG00000105641 HGNC:11040 SLC5A6 gene SLC5A6 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Peripheral motor neuropathy, childhood-onset, biotin-responsive, MIM# 619903;Neurodegeneration, infantile-onset, biotin-responsive, MIM# 618973 31754459;27904971;35013551 False 3 100;0;0 1.2304 True ENSG00000138074 ENSG00000138074 HGNC:11041 SLC5A7 gene SLC5A7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neuronopathy, distal hereditary motor, type VIIA, MIM# 158580;MONDO:0008024;Myasthenic syndrome, congenital, 20, presynaptic, MIM# 617143 23141292;15173594;29782645;29582019;27569547;29189923;30172469 False 3 100;0;0 1.2304 True ENSG00000115665 ENSG00000115665 HGNC:14025 SLC6A1 gene SLC6A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myoclonic-atonic epilepsy, MIM#616421 29315614 False 3 100;0;0 1.2304 True ENSG00000157103 ENSG00000157103 HGNC:11042 SLC6A19 gene SLC6A19 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hartnup disorder, MIM# 234500;Hyperglycinuria, MIM# 138500;Iminoglycinuria, MIM# 242600 False 3 100;0;0 1.2304 True ENSG00000174358 ENSG00000174358 HGNC:27960 SLC6A3 gene SLC6A3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Parkinsonism-dystonia, infantile, 1, MIM# 613135 21112253 False 3 100;0;0 1.2304 True ENSG00000142319 ENSG00000142319 HGNC:11049 SLC6A5 gene SLC6A5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hyperekplexia 3, MIM# 614618 31604777;30847549;29859229;16751771 False 3 100;0;0 1.2304 True Other ENSG00000165970 ENSG00000165970 HGNC:11051 SLC6A8 gene SLC6A8 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Cerebral creatine deficiency syndrome 1, MIM# 300352 27604308;16738945 False 3 100;0;0 1.2304 True ENSG00000130821 ENSG00000130821 HGNC:11055 SLC6A9 gene SLC6A9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Glycine encephalopathy with normal serum glycine, MIM# 617301 27481395;27773429;14622582;33269555 False 3 100;0;0 1.2304 True ENSG00000196517 ENSG00000196517 HGNC:11056 SLC7A7 gene SLC7A7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Lysinuric protein intolerance, MIM# 222700 10080182;18716612 False 3 100;0;0 1.2304 True ENSG00000155465 ENSG00000155465 HGNC:11065 SLC7A9 gene SLC7A9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Cystinuria, MIM# 220100 10471498 False 3 100;0;0 1.2304 True ENSG00000021488 ENSG00000021488 HGNC:11067 SLC9A3 gene SLC9A3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Diarrhoea 8, secretory sodium, congenital 616868 30633106;31276831;26358773 False 3 100;0;0 1.2304 True ENSG00000066230 ENSG00000066230 HGNC:11073 SLC9A6 gene SLC9A6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Mental retardation, X-linked syndromic, Christianson type, MIM# 300243;MONDO:0010278 18342287;19377476;25044251;33278113;32569089;31879735 False 3 100;0;0 1.2304 True ENSG00000198689 ENSG00000198689 HGNC:11079 SLCO1B1 gene SLCO1B1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome Other "Hyperbilirubinemia, Rotor type, digenic 237450" 30250148;24918167;33860121;36964102 False 3 50;0;50 1.2304 True ENSG00000134538 ENSG00000134538 HGNC:10959 SLCO1B3 gene SLCO1B3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome Other Hyperbilirubinemia, Rotor type, digenic, MIM# 237450 33860121;36964102 False 3 100;0;0 1.2304 True ENSG00000111700 ENSG00000111700 HGNC:10961 SLCO2A1 gene SLCO2A1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hypertrophic osteoarthropathy, primary, autosomal dominant, MIM# 167100;Hypertrophic osteoarthropathy, primary, autosomal recessive 2, MIM# 614441;Inflammatory bowel disease, MONDO:0005265, SLCO2A1-related 23509104;27134495;33852188;22331663;27134495;29313109 False 3 100;0;0 1.2304 True ENSG00000174640 ENSG00000174640 HGNC:10955 SLF2 gene SLF2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Atelis syndrome 1, MIM# 620184 36333305 False 3 100;0;0 1.2304 True ENSG00000119906 ENSG00000119906 HGNC:17814 SLFN14 gene SLFN14 Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Bleeding disorder, platelet-type, 20, MIM# 616913" 26280575;26769223 False 3 100;0;0 1.2304 True ENSG00000236320 ENSG00000236320 HGNC:32689 SLITRK2 gene SLITRK2 Expert Review Green;Literature Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Intellectual developmental disorder, X-linked 111, MIM# 301107 35840571 False 3 100;0;0 1.2304 True ENSG00000185985 ENSG00000185985 HGNC:13449 SLITRK6 gene SLITRK6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness and myopia, MIM#221200 29551497;23543054 False 3 100;0;0 1.2304 True ENSG00000184564 ENSG00000184564 HGNC:23503 SLURP1 gene SLURP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Meleda disease (MIM#248300) 14674887;32157724;12483299;14756676 False 3 100;0;0 1.2304 True ENSG00000126233 ENSG00000126233 HGNC:18746 SLX4 gene SLX4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Fanconi anaemia, complementation group P, MIM# 613951;MONDO:0013499 21240275;21240277 False 3 100;0;0 1.2304 True ENSG00000188827 ENSG00000188827 HGNC:23845 SMAD2 gene SMAD2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Loeys-Dietz syndrome 6, MIM# 619656;Congenital heart defects, multiple types, 8, with or without heterotaxy, MIM# 619657 29967133;30157302;23665959 False 3 100;0;0 1.2304 True ENSG00000175387 ENSG00000175387 HGNC:6768 SMAD4 gene SMAD4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Juvenile polyposis/hereditary haemorrhagic telangiectasia syndrome, MIM# 175050;Polyposis, juvenile intestinal, MIM# 174900;Myhre syndrome, MIM# 139210 30809044;15235019;16613914;20101697;22158539;22243968 False 3 100;0;0 1.2304 True ENSG00000141646 ENSG00000141646 HGNC:6770 SMAD6 gene SMAD6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Radioulnar synostosis, nonsyndromic} 179300;{Craniosynostosis 7, susceptibility to} 617439;Aortic valve disease 2 MIM# 614823 31138930;32499606;27606499;22275001;28659821;30963242;30848080;30796334 False 3 100;0;0 1.2304 True ENSG00000137834 ENSG00000137834 HGNC:6772 SMAD9 gene SMAD9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Pulmonary hypertension, primary, 2 MIM#615342 29844917;21920918;19211612;21898662 False 3 100;0;0 1.2304 True ENSG00000120693 ENSG00000120693 HGNC:6774 SMARCA2 gene SMARCA2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Nicolaides-Baraitser syndrome, MIM #601358;Blepharophimosis-intellectual disability syndrome, MIM#619293 26468571;32694869 False 3 100;0;0 1.2304 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000080503 ENSG00000080503 HGNC:11098 SMARCA4 gene SMARCA4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Coffin-Siris syndrome 4, MIM# 614609;Otosclerosis MONDO:0005349, SMARCA4-related 22426308;37399313 False 3 67;33;0 1.2304 True ENSG00000127616 ENSG00000127616 HGNC:11100 SMARCA5 gene SMARCA5 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder;microcephaly;dysmorphic features 33980485 False 3 100;0;0 1.2304 True ENSG00000153147 ENSG00000153147 HGNC:11101 SMARCAD1 gene SMARCAD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Huriez syndrome, OMIM #181600;Basan syndrome, MIM# 129200;Adermatoglyphia, MIM# 136000 29409814 False 3 100;0;0 1.2304 True ENSG00000163104 ENSG00000163104 HGNC:18398 SMARCAL1 gene SMARCAL1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Schimke immune-osseous dysplasia MIM# 242900;T cell deficiency;Short stature;spondyloepiphyseal dysplasia;renal dysfunction;lymphocytopaenia;nephropathy;bacterial/viral/fungal infections;may present as SCID;bone marrow failure 20301550;17089404;20036229 False 3 100;0;0 1.2304 True ENSG00000138375 ENSG00000138375 HGNC:11102 SMARCB1 gene SMARCB1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Coffin-Siris syndrome 3, MIM# 614608 34205270;31530938;25168959 False 3 50;50;0 1.2304 True ENSG00000099956 ENSG00000099956 HGNC:11103 SMARCC1 gene SMARCC1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Congenital hydrocephalus 33077954;24170322 False 3 100;0;0 1.2304 True ENSG00000173473 ENSG00000173473 HGNC:11104 SMARCC2 gene SMARCC2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Coffin-Siris syndrome 8;OMIM #618362 30580808 False 3 100;0;0 1.2304 True ENSG00000139613 ENSG00000139613 HGNC:11105 SMARCD1 gene SMARCD1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability;dysmorphic features 30879640 False 3 100;0;0 1.2304 True ENSG00000066117 ENSG00000066117 HGNC:11106 SMARCD2 gene SMARCD2 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Specific granule deficiency 2, MIM# 617475;Neutropaenia;Neurodevelopmental abnormalities in some;Myelodysplasia" 28369036;28369034 False 3 100;0;0 1.2304 True ENSG00000108604 ENSG00000108604 HGNC:11107 SMARCE1 gene SMARCE1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Coffin-Siris syndrome 5, MIM# 616938;{Meningioma, familial, susceptibility to} 607174" 23377182;22426308;23906836;23929686;32732226;32436246;32410215;34205270 False 3 100;0;0 1.2304 True ENSG00000073584 ENSG00000073584 HGNC:11109 SMC1A gene SMC1A Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Cornelia de Lange syndrome 2, MIM# 300590;Epileptic encephalopathy, early infantile, 85, with or without midline brain defects, MIM# 301044 17273969;22106055;19701948;26752331;28166369;29023665;31409060;31334757 False 3 100;0;0 1.2304 True ENSG00000072501 ENSG00000072501 HGNC:11111 SMC3 gene SMC3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cornelia de Lange syndrome 3, MIM#610759 18996922;25655089;31334757;38297832 False 3 100;0;0 1.2304 True ENSG00000108055 ENSG00000108055 HGNC:2468 SMC5 gene SMC5 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Atelis syndrome 2, MIM# 620185 36333305 False 3 100;0;0 1.2304 True ENSG00000198887 ENSG00000198887 HGNC:20465 SMCHD1 gene SMCHD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Bosma arhinia microphthalmia syndrome, MIM 603457;Arhinia, choanal atresia, microphthalmia MONDO:0011323;Fascioscapulohumeral muscular dystrophy 2, digenic 31600781;28067909 False 3 100;0;0 1.2304 True Other ENSG00000101596 ENSG00000101596 HGNC:29090 SMG8 gene SMG8 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Alzahrani-Kuwahara syndrome, MIM# 619268;Intellectual disability 31130284;34761517;33242396 False 3 75;25;0 1.2304 True ENSG00000167447 ENSG00000167447 HGNC:25551 SMG9 gene SMG9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Heart and brain malformation syndrome, MIM# 616920;Neurodevelopmental disorder with intention tremor, pyramidal signs, dyspraxia, and ocular anomalies, MIM# 619995 27018474;31390136;35087184 False 3 100;0;0 1.2304 True ENSG00000105771 ENSG00000105771 HGNC:25763 SMN1 gene SMN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spinal muscular atrophy-1, MIM# 253300 32644125;32644120;7813012 False 3 100;0;0 1.2304 True ENSG00000172062 ENSG00000172062 HGNC:11117 SMO gene SMO Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Microcephaly, congenital heart disease, polydactyly, aganglionosis, Pallister-Hall-like syndrome, MIM# 241800;Curry-Jones syndrome, somatic mosaic 601707" 32413283;27236920 False 3 100;0;0 1.2304 True ENSG00000128602 ENSG00000128602 HGNC:11119 SMOC1 gene SMOC1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microphthalmia with limb anomalies, MIM# 206920 21194678;21194680;30445150 False 3 100;0;0 1.2304 True ENSG00000198732 ENSG00000198732 HGNC:20318 SMOC2 gene SMOC2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Dentin dysplasia, type I, with microdontia and misshapen teeth, MIM# 125400 22152679;23317772;32908163 False 3 100;0;0 1.2304 True ENSG00000112562 ENSG00000112562 HGNC:20323 SMPD1 gene SMPD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Niemann-Pick disease, type A, MIM# 257200;MONDO:0009756;Niemann-Pick disease, type B, MIM# 607616;MONDO:0011871 32292456;32280632;28164782 False 3 100;0;0 1.2304 True ENSG00000166311 ENSG00000166311 HGNC:11120 SMPD4 gene SMPD4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Severe neurodevelopmental delay, microcephaly, arthrogryposis 31495489 False 3 100;0;0 1.2304 True ENSG00000136699 ENSG00000136699 HGNC:32949 SMPX gene SMPX Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Deafness, X-linked 4, MIM# 300066;Myopathy, distal, 7, adult-onset, X-linked, MIM# 301075 21549342;21549336;21893181;22911656;28542515;33974137 False 3 100;0;0 1.2304 True ENSG00000091482 ENSG00000091482 HGNC:11122 SMS gene SMS Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Intellectual developmental disorder, X-linked syndromic, Snyder-Robinson type, MIM# 309583;Syndromic X-linked intellectual disability Snyder type, MONDO:0010664 30237987;34177437;32838743;23805436 False 3 100;0;0 1.2304 True ENSG00000102172 ENSG00000102172 HGNC:11123 SNAP25 gene SNAP25 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, SNAP25-related;Myasthenic syndrome, congenital, 18, MIM# 616330 25003006;29100083;28135719;17283335;29491473;25381298 False 3 100;0;0 1.2304 True ENSG00000132639 ENSG00000132639 HGNC:11132 SNAP29 gene SNAP29 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome, MIM#609528 29051910;21073448;30793783 False 3 100;0;0 1.2304 True ENSG00000099940 ENSG00000099940 HGNC:11133 SNAPC4 gene SNAPC4 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "Neurodevelopmental disorder with motor regression, progressive spastic paraplegia, and oromotor dysfunction, MIM# 620515" 36965478 False 3 100;0;0 1.2304 True ENSG00000165684 ENSG00000165684 HGNC:11137 SNF8 gene SNF8 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 115, MIM#620783;Neurodevelopmental disorder plus optic atrophy, MIM# 620784 38423010 False 3 100;0;0 1.2304 True ENSG00000159210 ENSG00000159210 HGNC:17028 SNORA31 gene SNORA31 Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Encephalopathy, acute, infection-induced (herpes-specific), susceptibility to, 1}, MIM# 619396 31806906 False 3 100;0;0 1.2304 True ENSG00000199477 ENSG00000199477 HGNC:32621 SNORD118 gene SNORD118 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy, brain calcifications, and cysts, MIM#614561 27571260 False 3 100;0;0 1.2304 True ENSG00000200463 ENSG00000200463 HGNC:32952 SNRNP200 gene SNRNP200 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Retinitis pigmentosa 33 (MIM# 610359) 31260034;29320387;23847139;27735924 False 3 100;0;0 1.2304 True ENSG00000144028 ENSG00000144028 HGNC:30859 SNRPB gene SNRPB Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cerebrocostomandibular syndrome, MIM# 117650 25047197;25504470;26971886 False 3 100;0;0 1.2304 True ENSG00000125835 ENSG00000125835 HGNC:11153 SNRPE gene SNRPE Expert Review Amber;Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) Hypotrichosis 11;OMIM #615059 31671093;23246290 False 3 50;50;0 1.2304 True ENSG00000182004 ENSG00000182004 HGNC:11161 SNUPN gene SNUPN Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 29, MIM# 620793 PMID: 38413582;PMID: 38366623 False 3 100;0;0 1.2304 True ENSG00000169371 ENSG00000169371 HGNC:14245 SNX10 gene SNX10 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Osteopetrosis, autosomal recessive 8, MIM# 615085 22499339;23123320;33678645;32278070;30977576;30898715 False 3 100;0;0 1.2304 True ENSG00000086300 ENSG00000086300 HGNC:14974 SNX14 gene SNX14 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 20 (MIM#616354) 25439728;25848753;27913285 False 3 100;0;0 1.2304 True ENSG00000135317 ENSG00000135317 HGNC:14977 SNX27 gene SNX27 Expert Review;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal intellectual disability;seizures 25894286;31721175;21300787;23524343 False 3 100;0;0 1.2304 True ENSG00000143376 ENSG00000143376 HGNC:20073 SOCS1 gene SOCS1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Autoinflammatory syndrome, familial, with or without immunodeficiency, MIM# 619375;Common variable immunodeficiency;Early-onset autoimmunity 32499645;10490099;10490100;33087723 False 3 100;0;0 1.2304 True ENSG00000185338 ENSG00000185338 HGNC:19383 SOHLH1 gene SOHLH1 Expert list;Expert Review Green Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Ovarian dysgenesis 5 MIM#617690;Spermatogenic failure 32 MIM#618115 25774885;16690745;31042289;20506135;28718531 False 3 100;0;0 1.2304 True ENSG00000165643 ENSG00000165643 HGNC:27845 SON gene SON Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ZTTK syndrome, MIM# 617140 27545680;27545676;31005274 False 3 100;0;0 1.2304 True ENSG00000159140 ENSG00000159140 HGNC:11183 SORD gene SORD Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal isolated hereditary neuropathy;Sorbitol dehydrogenase deficiency with peripheral neuropathy (SORDDPN), MIM#618912 32367058 False 3 100;0;0 1.2304 True ENSG00000140263 ENSG00000140263 HGNC:11184 SOS1 gene SOS1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ?Fibromatosis, gingival, 1, 135300;Noonan syndrome 4, 610733 25062969;17143285;17143282;28884940;17586837 False 3 100;0;0 1.2304 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000115904 ENSG00000115904 HGNC:11187 SOS2 gene SOS2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Noonan syndrome 9, MIM#616559, AD 26173643;25795793;32788663 False 3 100;0;0 1.2304 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000100485 ENSG00000100485 HGNC:11188 SOST gene SOST Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Sclerosteosis 1, OMIM#269500;Craniodiaphyseal dysplasia, OMIM#122860 20301406;35160258;21221996;17853455 False 3 100;0;0 1.2304 True ENSG00000167941 ENSG00000167941 HGNC:13771 SOX10 gene SOX10 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Kallman syndrome;PCWH syndrome (MIM#609136);Waardenburg syndrome, type 2E, with or without neurologic involvement (MIM#611584);Waardenburg syndrome, type 4C (MIM#613266) 23643381;24845202 False 3 100;0;0 1.2304 True ENSG00000100146 ENSG00000100146 HGNC:11190 SOX11 gene SOX11 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder with microcephaly and with or without ocular malformations or hypogonadotropic hypogonadism, MIM# 615866;Congenital abnormalities of the kidneys and urinary tract 29459093;24886874;33086258;33785884;35642566;35341651 False 3 100;0;0 1.2304 True ENSG00000176887 ENSG00000176887 HGNC:11191 SOX17 gene SOX17 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Vesicoureteral reflux 3 MIM#613674;Pulmonary arterial hypertension, MONDO:0015924 29650961;31406341;20960469 False 3 100;0;0 1.2304 True ENSG00000164736 ENSG00000164736 HGNC:18122 SOX18 gene SOX18 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hypotrichosis-lymphedema-telangiectasia syndrome, MIM# 607823;Hypotrichosis-lymphedema-telangiectasia-renal defect syndrome, MIM# 137940 12740761;24697860;2484451;26148450;33851505 False 3 100;0;0 1.2304 True ENSG00000203883 ENSG00000203883 HGNC:11194 SOX2 gene SOX2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Microphthalmia, syndromic 3, MIM# 206900;Optic nerve hypoplasia and abnormalities of the central nervous system, MIM# 206900 30450772;28121235;25542770;24498598;24211324;24033328;21326281 False 3 100;0;0 1.2304 True ENSG00000181449 ENSG00000181449 HGNC:11195 SOX4 gene SOX4 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Coffin-Siris syndrome 10;OMIM #618506 30661772 False 3 100;0;0 1.2304 True ENSG00000124766 ENSG00000124766 HGNC:11200 SOX5 gene SOX5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Lamb-Shaffer syndrome, MIM# 616803 22290657;23220431 False 3 100;0;0 1.2304 True ENSG00000134532 ENSG00000134532 HGNC:11201 SOX6 gene SOX6 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ADHD;Craniosynostosis;Osteochondromas;Tolchin-Le Caignec syndrome, MIM#618971 32442410 False 3 100;0;0 1.2304 True ENSG00000110693 ENSG00000110693 HGNC:16421 SOX9 gene SOX9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Campomelic dysplasia, MIM# 114290;Campomelic dysplasia, MONDO:0007251 20301724 False 3 100;0;0 1.2304 True ENSG00000125398 ENSG00000125398 HGNC:11204 SP110 gene SP110 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hepatic veno-occlusive disease with immunodeficiency MIM#235550;Hepatic veno-occlusive disease;susceptibility to Pneumocystis jirovecii pneumonia;cytomegalovirus;thrombocytopaenia;hepatosplenomegaly;cerebrospinal leukodystrophy;memory T/B cell deficiency;low Ig levels;absent tissue plasma cells;absent lymph node germinal centers;hypogammaglobulinaemia 20301448;31721003 False 3 100;0;0 1.2304 True ENSG00000135899 ENSG00000135899 HGNC:5401 SP6 gene SP6 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amelogenesis imperfecta, type IK, MIM# 620104 32167558;18156176;18297738;22676574;33652941 False 3 50;50;0 1.2304 True ENSG00000189120 ENSG00000189120 HGNC:14530 SP7 gene SP7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Osteogenesis imperfecta type 12, MONDO:0013460;Osteogenesis imperfecta, type XII, OMIM:613849 20579626;29382611;35367406;34091789;32413570 False 3 100;0;0 1.2304 True ENSG00000170374 ENSG00000170374 HGNC:17321 SP9 gene SP9 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted neurodevelopmental disorder MONDO:0700092, SP9-related PMID: 38288683 False 3 100;0;0 1.2304 True ENSG00000217236 ENSG00000217236 HGNC:30690 SPAG1 gene SPAG1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 28 (MIM#615505) 32622824;32502479;24055112 False 3 100;0;0 1.2304 True ENSG00000104450 ENSG00000104450 HGNC:11212 SPARC gene SPARC Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Osteogenesis imperfecta, type XVII, MIM# 616507 26027498;34462290 False 3 100;0;0 1.2304 True ENSG00000113140 ENSG00000113140 HGNC:11219 SPAST gene SPAST Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 4, autosomal dominant (MIM#182601), AD 30476002;30006150 False 3 100;0;0 1.2304 True ENSG00000021574 ENSG00000021574 HGNC:11233 SPATA5 gene SPATA5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with hearing loss, seizures, and brain abnormalities, MIM# 616577 30009132;29343804 False 3 100;0;0 1.2304 True ENSG00000145375 ENSG00000145375 HGNC:18119 SPATA5L1 gene SPATA5L1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with hearing loss and spasticity, MIM# 619616;Deafness, autosomal recessive 119, MIM# 619615 34626583 False 3 100;0;0 1.2304 True ENSG00000171763 ENSG00000171763 HGNC:28762 SPATA7 gene SPATA7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Leber congenital amaurosis 3, MIM#604232;Autosomal recessive juvenile retinitis pigmentosa, MIM#604232 31908400;32799588 False 3 100;0;0 1.2304 True ENSG00000042317 ENSG00000042317 HGNC:20423 SPECC1L gene SPECC1L Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypertelorism, Teebi type, MIM# 145420;Opitz GBBB syndrome, type II, MIM#145410 25412741;26111080;21703590 False 3 100;0;0 1.2304 True ENSG00000100014 ENSG00000100014 HGNC:29022 SPEF2 gene SPEF2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Spermatogenic failure 43, MIM#618751;Spermatogenic failure 43, MIM#618751;Primary ciliary dyskinesia-like phenotype 31151990;31278745;31048344;31942643 False 3 100;0;0 1.2304 True ENSG00000152582 ENSG00000152582 HGNC:26293 SPEG gene SPEG Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Centronuclear myopathy 5, MIM# 615959;Dilated cardiomyopathy 25087613;31625632;30412272;30157964;29614691;29474540;28624463;26578207;25087613;32925938;33794647 False 3 100;0;0 1.2304 True ENSG00000072195 ENSG00000072195 HGNC:16901 SPEN gene SPEN Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Radio-Tartaglia syndrome, MIM# 619312;Intellectual disability;autism;congenital anomalies 33057194;33596411 False 3 67;33;0 1.2304 True ENSG00000065526 ENSG00000065526 HGNC:17575 SPG21 gene SPG21 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mast syndrome, MIM# 248900 14564668;24451228;28752238;26978163 False 3 100;0;0 1.2304 True ENSG00000090487 ENSG00000090487 HGNC:20373 SPG7 gene SPG7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 7, autosomal recessive, MIM# 607259;Autosomal dominant optic atrophy, MONDO:0020250 9635427;9635427;16534102;18799786;22571692;34500365;33598982 False 3 100;0;0 1.2304 True ENSG00000197912 ENSG00000197912 HGNC:11237 SPI1 gene SPI1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Agammaglobulinaemia 10, autosomal dominant, MIM# 619707 33951726 False 3 100;0;0 1.2304 True ENSG00000066336 ENSG00000066336 HGNC:11241 SPINK1 gene SPINK1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Tropical calcific pancreatitis, MIM# 608189;Pancreatitis, hereditary, MIM# 167800 10835640;11355022;11938439;16823394;17274009;27535533 False 3 100;0;0 1.2304 True ENSG00000164266 ENSG00000164266 HGNC:11244 SPINK5 gene SPINK5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Netherton syndrome MIM# 256500 33534181;20657595 False 3 100;0;0 1.2304 True ENSG00000133710 ENSG00000133710 HGNC:15464 SPINT2 gene SPINT2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Diarrhoea 3, secretory sodium, congenital, syndromic 270420;MONDO:0010036 19185281;20009592;24142340;30445423 False 3 100;0;0 1.2304 True ENSG00000167642 ENSG00000167642 HGNC:11247 SPOP gene SPOP Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability;dysmorphism;microcephaly;macrocephaly 32109420 False 3 100;0;0 1.2304 True Other ENSG00000121067 ENSG00000121067 HGNC:11254 SPR gene SPR Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Dystonia, dopa-responsive, due to sepiapterin reductase deficiency, MIM# 612716 22522443;16650784;21431957;28189489 False 3 100;0;0 1.2304 True ENSG00000116096 ENSG00000116096 HGNC:11257 SPRED1 gene SPRED1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Legius syndrome, MIM# 611431 17704776;19366998;21548021 False 3 100;0;0 1.2304 True ENSG00000166068 ENSG00000166068 HGNC:20249 SPRED2 gene SPRED2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Noonan syndrome 14, MIM# 619745 PMID: 34626534 False 3 100;0;0 1.2304 True ENSG00000198369 ENSG00000198369 HGNC:17722 SPRTN gene SPRTN Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ruijs-Aalfs syndrome, MIM# 616200;MONDO:0014527 25261934 False 3 100;0;0 1.2304 True ENSG00000010072 ENSG00000010072 HGNC:25356 SPTA1 gene SPTA1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Elliptocytosis-2 MIM# 130600;Pyropoikilocytosis MIM# 266140;Spherocytosis, type 3 MIM# 270970 9075575;8018926;29484404;27667160;31333484;8941647;3785322 False 3 100;0;0 1.2304 True ENSG00000163554 ENSG00000163554 HGNC:11272 SPTAN1 gene SPTAN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 5, MIM# 613477;Hereditary spastic paraplegia MONDO:0019064, SPTAN1-related;Neuronopathy, distal hereditary motor, 11, autosomal dominant, MIM# 620528;Autosomal dominant spastic paraplegia-91, with or without cerebellar ataxia (SPG91), MIM#620538 20493457;22258530;32811770;33578420;31332438;36331550 False 3 100;0;0 1.2304 True ENSG00000197694 ENSG00000197694 HGNC:11273 SPTB gene SPTB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spherocytosis, type 2 MIM# 616649;Elliptocytosis-3 MIM# 617948;Anaemia, neonatal haemolytic, fatal or near-fatal MIM# 617948 19538529;8102379;9075575;7883966;9005995;32256302 False 3 100;0;0 1.2304 True ENSG00000070182 ENSG00000070182 HGNC:11274 SPTBN1 gene SPTBN1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Developmental delay, impaired speech, and behavioural abnormalities, MIM# 619475;Neurodevelopmental Syndrome;Intellectual disability;Seizures PMID: 34211179;PMID: 33847457 False 3 100;0;0 1.2304 True ENSG00000115306 ENSG00000115306 HGNC:11275 SPTBN2 gene SPTBN2 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 14, MIM# 615386;Spinocerebellar ataxia 5, MIM# 600224 23236289;23838597;22781464;31617442;31066025 False 3 100;0;0 1.2304 True ENSG00000173898 ENSG00000173898 HGNC:11276 SPTBN4 gene SPTBN4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with hypotonia, neuropathy, and deafness (NEDHND, OMIM #617519) 33772159 False 3 100;0;0 1.2304 True ENSG00000160460 ENSG00000160460 HGNC:14896 SPTLC1 gene SPTLC1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Juvenile amyotrophic lateral sclerosis-27, MIM#620285;Neuropathy, hereditary sensory and autonomic, type IA, MIM# 162400;Serine palmitoyl transferase deficiency (Disorders of complex lipid synthesis) 27604308;20097765;21618344;20097765;30420926 False 3 100;0;0 1.2304 True ENSG00000090054 ENSG00000090054 HGNC:11277 SPTLC2 gene SPTLC2 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuropathy, hereditary sensory and autonomic, type IC, 613640;MONDO:0013337;Serine palmitoyl transferase deficiency (Disorders of complex lipid synthesis) 20920666;23658386;31509666;30866134;27604308 False 3 100;0;0 1.2304 True ENSG00000100596 ENSG00000100596 HGNC:11278 SQSTM1 gene SQSTM1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodegeneration with ataxia, dystonia, and gaze palsy, childhood-onset, MIM# 617145 27545679 False 3 100;0;0 1.2304 True ENSG00000161011 ENSG00000161011 HGNC:11280 SRC gene SRC Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Thrombocytopaenia 6, MIM# 616937" 31204551;26936507 False 3 100;0;0 1.2304 True ENSG00000197122 ENSG00000197122 HGNC:11283 SRCAP gene SRCAP Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Floating-Harbor syndrome MIM#136140;Developmental delay, hypotonia, musculoskeletal defects, and behavioral abnormalities, MIM# 619595" 33909990 False 3 100;0;0 1.2304 True ENSG00000080603 ENSG00000080603 HGNC:16974 SRD5A2 gene SRD5A2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pseudovaginal perineoscrotal hypospadias, MIM# 264600 1944596;12843198;35331321;35154247;35135181 False 3 100;0;0 1.2304 True ENSG00000049319 ENSG00000277893 HGNC:11285 SRD5A3 gene SRD5A3 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Iq, MIM#612379;Kahrizi syndrome, MIM# 612713 32424323 False 3 100;0;0 1.2304 True ENSG00000128039 ENSG00000128039 HGNC:25812 SREBF1 gene SREBF1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown IFAP (ichthyosis follicularis, atrichia, and photophobia) syndrome 2, MIM619016;Mucoepithelial dysplasia, hereditary, MIM#158310 32497488;31790666;32902915 False 3 100;0;0 1.2304 True ENSG00000072310 ENSG00000072310 HGNC:11289 SRP54 gene SRP54 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neutropaenia, severe congenital, 8, autosomal dominant, MIM# 618752 29914977;28972538 False 3 100;0;0 1.2304 True ENSG00000100883 ENSG00000100883 HGNC:11301 SRPK3 gene SRPK3 Expert Review Green;Literature Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Myopathy, MONDO:0005336, digenic SRPK3- and TTN-related;Intellectual developmental disorder, X-linked, 114, MIM#301134 38429495;39073169 False 3 100;0;0 1.2304 True ENSG00000184343 ENSG00000184343 HGNC:11402 SRRM2 gene SRRM2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Intellectual developmental disorder, autosomal dominant 72, MIM# 620439" 33057194 False 3 50;50;0 1.2304 True ENSG00000167978 ENSG00000167978 HGNC:16639 SRSF1 gene SRSF1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder with dysmorphic facies and behavioral abnormalities, MIM# 620489 37071997 False 3 100;0;0 1.2304 True ENSG00000136450 ENSG00000136450 HGNC:10780 SRY gene SRY Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) 46XX sex reversal 1, MIM# 400045;46XY sex reversal 1 , MIM#400044 9143916;15863672 False 3 100;0;0 1.2304 True ENSG00000184895 ENSG00000184895 HGNC:11311 SSBP1 gene SSBP1 Expert Review Green;NHS GMS Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Optic atrophy with or without extraocular phenotypes;Optic atrophy-13 with retinal and foveal abnormalities, MIM#165510 31298765;31479473;31550237;31550240 False 3 100;0;0 1.2304 True ENSG00000106028 ENSG00000106028 HGNC:11317 SSR4 gene SSR4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Congenital disorder of glycosylation, type Iy, MIM# 300934 24218363;26264460;33300232 False 3 100;0;0 1.2304 True ENSG00000180879 ENSG00000180879 HGNC:11326 ST14 gene ST14 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ichthyosis, congenital, autosomal recessive 11, MIM# MIM#602400 18843291;29611532;17273967 False 3 100;0;0 1.2304 True ENSG00000149418 ENSG00000149418 HGNC:11344 ST3GAL3 gene ST3GAL3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mental retardation, autosomal recessive 12 MIM# 611090 23252400;21907012;31584066 False 3 100;0;0 1.2304 True ENSG00000126091 ENSG00000126091 HGNC:10866 ST3GAL5 gene ST3GAL5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Salt and pepper developmental regression syndrome 609056;GM3 synthase deficiency, MONDO:0018274;Lactosylceramide alpha-2,3-sialyltransferase deficiency (Disorders of glycosphingolipid and glycosylphosphatidylinositol anchor glycosylation) 23436467;22990144;15502825;27232954;30691927;30688114;30576498 False 3 100;0;0 1.2304 True ENSG00000115525 ENSG00000115525 HGNC:10872 STAB1 gene STAB1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Hyperferritinemia, MIM# 620729 37490907;28052375 False 3 100;0;0 1.2304 True ENSG00000010327 ENSG00000010327 HGNC:18628 STAC3 gene STAC3 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Myopathy, congenital, Baily-Bloch, MIM# 255995 23736855;28411587;28777491;30168660;32898259 False 3 100;0;0 1.2304 True ENSG00000185482 ENSG00000185482 HGNC:28423 STAG1 gene STAG1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 47, MIM# 617635 28119487;34440290 False 3 100;0;0 1.2304 True ENSG00000118007 ENSG00000118007 HGNC:11354 STAG2 gene STAG2 Expert Review Green;Other Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Mullegama-Klein-Martinez syndrome, MIM#301022 30765867;28296084;30447054;29263825;30158690 False 3 100;0;0 1.2304 True ENSG00000101972 ENSG00000101972 HGNC:11355 STAG3 gene STAG3 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Premature ovarian failure 8 MIM#615723;Spermatogenic failure 61, MIM# 619672 24597867;26059840;31803224;31363903;31125047;31682730;32634216 False 3 100;0;0 1.2304 True ENSG00000066923 ENSG00000066923 HGNC:11356 STAMBP gene STAMBP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephaly-capillary malformation syndrome, MIM# 614261;MONDO:0013659 23542699;31638258;29907875;27531570;25692795;25266620 False 3 100;0;0 1.2304 True ENSG00000124356 ENSG00000124356 HGNC:16950 STAR gene STAR Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Lipoid adrenal hyperplasia (MIM#201710) 7892608;8634702 False 3 100;0;0 1.2304 True ENSG00000147465 ENSG00000147465 HGNC:11359 STAT1 gene STAT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Immunodeficiency 31A, mycobacteriosis, autosomal dominant, MIM# 614892;Immunodeficiency 31B, mycobacterial and viral infections, autosomal recessive, MIM# 613796;Immunodeficiency 31C, chronic mucocutaneous candidiasis, autosomal dominant, MIM# 614162 16934001;22573496;26513235;12590259;16585605;20841510;21714643;21727188 False 3 100;0;0 1.2304 True ENSG00000115415 ENSG00000115415 HGNC:11362 STAT2 gene STAT2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 44, MIM# 616636;Pseudo-TORCH syndrome 3, MIM# 618886 23391734;26122121;31836668;32092142 False 3 100;0;0 1.2304 True ENSG00000170581 ENSG00000170581 HGNC:11363 STAT3 gene STAT3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hyper-IgE recurrent infection syndrome MIM# 147060;Autoimmune disease, multisystem, infantile-onset, 1 MIM# 615952 17881745;14566054;25349174;25038750;25359994 False 3 100;0;0 1.2304 True ENSG00000168610 ENSG00000168610 HGNC:11364 STAT4 gene STAT4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Disabling pansclerotic morphea of childhood MIM#620443" 37256972 False 3 50;0;50 1.2304 True ENSG00000138378 ENSG00000138378 HGNC:11365 STAT5B gene STAT5B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Growth hormone insensitivity with immunodeficiency, MIM# 245590 29844444 False 3 100;0;0 1.2304 True Other ENSG00000173757 ENSG00000173757 HGNC:11367 STAT6 gene STAT6 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hyper-IgE syndrome 6, autosomal dominant, with atopy and allergies, MIM# 620532 36216080;36758835 False 3 100;0;0 1.2304 True ENSG00000166888 ENSG00000166888 HGNC:11368 STIL gene STIL Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephaly 7, primary, autosomal recessive, MIM# 612703;MONDO:0012989 19215732;22989186;25218063;33132204;32677750;29230157 False 3 100;0;0 1.2304 True ENSG00000123473 ENSG00000123473 HGNC:10879 STIM1 gene STIM1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Immunodeficiency 10 612783;Myopathy, tubular aggregate, 1 160565;Stormorken syndrome 185070" 31448844 False 3 100;0;0 1.2304 True Other ENSG00000167323 ENSG00000167323 HGNC:11386 STK4 gene STK4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal T-cell immunodeficiency, recurrent infections, autoimmunity, and cardiac malformations MIM# 614868;CD4/CD8 lymphopaenia;cardiac malformations;reduced na ve T cells;increased TEM and TEMRA cells;poor T cell Proliferation;Reduced memory B cells;Reduced IgM, increased IgG, IgA, IgE;impaired antibody responses;intermittent neutropaenia;bacterial/ viral/ fungal infections;autoimmune cytopaenias;mucocutaneous candidiasis;cutaneous warts 22294732;26117625;22174160;22952854 False 3 100;0;0 1.2304 True ENSG00000101109 ENSG00000101109 HGNC:11408 STN1 gene STN1 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Cerebroretinal microangiopathy with calcification and cysts 2, MIM#617341 27432940;32627942 False 3 100;0;0 1.2304 True ENSG00000107960 ENSG00000107960 HGNC:26200 STRA6 gene STRA6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microphthalmia, isolated, with coloboma 8, MIM# 601186;Microphthalmia, syndromic 9, MIM# 601186 17273977;17503335;19213032;26373900;30880327;26373900;25457163 False 3 100;0;0 1.2304 True ENSG00000137868 ENSG00000137868 HGNC:30650 STRADA gene STRADA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Polyhydramnios, megalencephaly, and symptomatic epilepsy, OMIM:611087;Polyhydramnios, megalencephaly, and symptomatic epilepsy, MONDO:0012611 17522105;27170158;28688840 False 3 100;0;0 1.2304 True ENSG00000266173 ENSG00000266173 HGNC:30172 STRC gene STRC Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 16, MIM# 603720 11687802;26011646;26746617;20301780 False 3 100;0;0 1.2304 True ENSG00000242866 ENSG00000242866 HGNC:16035 STS gene STS Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Ichthyosis, X-linked 308100;Sterol metabolism disorder False 3 100;0;0 1.2304 True ENSG00000101846 ENSG00000101846 HGNC:11425 STT3A gene STT3A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Iw, AR, OMIM #615596;Congenital disorder of glycosylation, type Iw, autosomal dominant, MIM# 619714 34653363;23842455;30701557;28424003 False 3 100;0;0 1.2304 True ENSG00000134910 ENSG00000134910 HGNC:6172 STUB1 gene STUB1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 16, MIM# 615768;Spinocerebellar ataxia 48, MIM#618093 25258038;24742043;32337344;30381368;31126790 False 3 100;0;0 1.2304 True ENSG00000103266 ENSG00000103266 HGNC:11427 STX11 gene STX11 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Haemophagocytic lymphohistiocytosis, familial, 4 , MIM#603552 15703195;16278825;16582076;24459464 False 3 100;0;0 1.2304 True ENSG00000135604 ENSG00000135604 HGNC:11429 STX16 gene STX16 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed) Pseudohypoparathyroidism type 1b MIM#: 603233 1456170;15579741;15800843;33320452;32337648;33247854;29959430 False 3 100;0;0 1.2304 True ENSG00000124222 ENSG00000124222 HGNC:11431 STX1A gene STX1A Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal neurodevelopmental disorder MONDO#0700092, STX1A-related False 3 100;0;0 1.2304 True ENSG00000106089 ENSG00000106089 HGNC:11433 STX1B gene STX1B Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Generalized epilepsy with febrile seizures plus, type 9, MIM# 616172 25362483;33677401 False 3 100;0;0 1.2304 True ENSG00000099365 ENSG00000099365 HGNC:18539 STX3 gene STX3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microvillus inclusion disease, MIM#619445;Retinal dystrophy and microvillus inclusion disease, MIM#619446 24726755;29266534;25358429;29282386;30909251;29282386 False 3 100;0;0 1.2304 True ENSG00000166900 ENSG00000166900 HGNC:11438 STXBP1 gene STXBP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 4, MIM# 612164;Rett syndrome;Rett-like phenotypes 30842224 False 3 100;0;0 1.2304 True ENSG00000136854 ENSG00000136854 HGNC:11444 STXBP2 gene STXBP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Haemophagocytic lymphohistiocytosis, familial, 5, with or without microvillus inclusion disease 613101 19804848 False 3 100;0;0 1.2304 True ENSG00000076944 ENSG00000076944 HGNC:11445 STXBP3 gene STXBP3 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Very Early Onset Inflammatory Bowel Disease;Bilateral Sensorineural Hearing Loss;Immune Dysregulation 33891011 False 3 100;0;0 1.2304 True ENSG00000116266 ENSG00000116266 HGNC:11446 SUCLA2 gene SUCLA2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 5 (encephalomyopathic with or without methylmalonic aciduria), MIM# 612073, MONDO:0012791 15877282;17287286;17301081;23759946;33231368;33230181;28243576;27913098;27651038 False 3 100;0;0 1.2304 True ENSG00000136143 ENSG00000136143 HGNC:11448 SUCLG1 gene SUCLG1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 9 (encephalomyopathic type with methylmalonic aciduria) MIM#245400 33230783;28358460 False 3 100;0;0 1.2304 True ENSG00000163541 ENSG00000163541 HGNC:11449 SUFU gene SUFU Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Joubert syndrome 32, MIM#617757;SUFU-related neurodevelopmental syndrome;Basal cell nevus syndrome, MIM# 109400 28965847;19533801;31485359;33024317 False 3 100;0;0 1.2304 True ENSG00000107882 ENSG00000107882 HGNC:16466 SULT2B1 gene SULT2B1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ichthyosis, congenital, autosomal recessive 14, MIM# 617571 28575648 False 3 100;0;0 1.2304 True ENSG00000088002 ENSG00000088002 HGNC:11459 SUMF1 gene SUMF1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Multiple sulfatase deficiency (MIM#272200) 17360554;25885655;28566233 False 3 100;0;0 1.2304 True ENSG00000144455 ENSG00000144455 HGNC:20376 SUOX gene SUOX Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Sulfite oxidase deficiency, MIM# 272300 9428520;15952210;31127934 False 3 100;0;0 1.2304 True ENSG00000139531 ENSG00000139531 HGNC:11460 SUPT16H gene SUPT16H Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with dysmorphic facies and thin corpus callosum, MIM# 619480;Intellectual disability;Abnormality of the corpus callosum 31924697 False 3 100;0;0 1.2304 True ENSG00000092201 ENSG00000092201 HGNC:11465 SURF1 gene SURF1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, type 4K MIM#616684;Mitochondrial complex IV deficiency, nuclear type 1 MIM#220110 9843204;9837813;24027061 False 3 100;0;0 1.2304 True ENSG00000148290 ENSG00000148290 HGNC:11474 SUZ12 gene SUZ12 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Imagawa-Matsumoto syndrome, MIM# 618786 31736240;28229514 False 3 100;0;0 1.2304 True ENSG00000178691 ENSG00000178691 HGNC:17101 SVBP gene SVBP Expert list;Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly;OMIM #618569 31363758;30607023 False 3 100;0;0 1.2304 True ENSG00000177868 ENSG00000177868 HGNC:29204 SYCE1 gene SYCE1 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Premature ovarian failure 12, MIM# 616947;Spermatogenic failure 15 ,MIM#616950" 25062452;32917591;32741963;32402064;31925770;31916078 False 3 100;0;0 1.2304 True ENSG00000171772 ENSG00000171772 HGNC:28852 SYCP2 gene SYCP2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Male infertility 32092049;31866047 False 3 100;0;0 1.2304 True ENSG00000196074 ENSG00000196074 HGNC:11490 SYCP2L gene SYCP2L Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "Premature ovarian failure 24, MIM# 620840" 32303603;38521400 False 3 50;50;0 1.2304 True ENSG00000153157 ENSG00000153157 HGNC:21537 SYK gene SYK Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Immunodeficiency-82 with systemic inflammation (IMD82) , MIM#619381 33782605 False 3 100;0;0 1.2304 True Other ENSG00000165025 ENSG00000165025 HGNC:11491 SYN1 gene SYN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Epilepsy, X-linked, with variable learning disabilities and behaviour disorders, MIM# 300491;Intellectual developmental disorder, X-linked 50, MIM# 300115 14985377;21441247;28973667;21441247;34243774 False 3 100;0;0 1.2304 True ENSG00000008056 ENSG00000008056 HGNC:11494 SYNCRIP gene SYNCRIP Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Global developmental delay;Intellectual disability;Autism;Myoclonic atonic seizures;Abnormality of nervous system morphology 34157790;30504930;27479843;23020937 False 3 100;0;0 1.2304 True ENSG00000135316 ENSG00000135316 HGNC:16918 SYNE1 gene SYNE1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Arthrogryposis multiplex congenita, myogenic type, MIM# 618484;Emery-Dreifuss muscular dystrophy 4, autosomal dominant, MIM# 612998;Spinocerebellar ataxia, autosomal recessive 8, MIM# 610743 23352163;27782104;30573412 False 3 100;0;0 1.2304 True ENSG00000131018 ENSG00000131018 HGNC:17089 SYNE4 gene SYNE4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 76, MIM# 615540 23348741;28958982 False 3 100;0;0 1.2304 True ENSG00000181392 ENSG00000181392 HGNC:26703 SYNGAP1 gene SYNGAP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability, autosomal dominant 5 (MIM # 612621) 26989088;23161826;21237447;19196676 False 3 100;0;0 1.2304 True ENSG00000197283 ENSG00000197283 HGNC:11497 SYNJ1 gene SYNJ1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 53, MIM# 617389;Parkinson disease 20, early-onset, MIM# 615530 32435303;27435091;23804563;23804577;27496670;33841314 False 3 100;0;0 1.2304 True ENSG00000159082 ENSG00000159082 HGNC:11503 SYP gene SYP Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Mental retardation, X-linked 96 MIM#300802 23966691;19377476 False 3 100;0;0 1.2304 True ENSG00000102003 ENSG00000102003 HGNC:11506 SYT1 gene SYT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Baker-Gordon syndrome, MIM# 618218;MONDO:0033864 30107533 False 3 100;0;0 1.2304 True ENSG00000067715 ENSG00000067715 HGNC:11509 SYT2 gene SYT2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 7, presynaptic, MIM# 616040;Myasthenic syndrome, congenital, 7B, presynaptic, autosomal recessive MIM#619461 25192047;32776697;32250532;30533528 False 3 100;0;0 1.2304 True ENSG00000143858 ENSG00000143858 HGNC:11510 SZT2 gene SZT2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 18, OMIM #615476 23932106;30560016;30359774;28556953;32402703 False 3 100;0;0 1.2304 True ENSG00000198198 ENSG00000198198 HGNC:29040 TAB2 gene TAB2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mitral valve disease, cardiomyopathy, short stature and hypermobility, Noonan syndrome-like;Congenital heart defects, nonsyndromic, 2 (MIM#614980) 34456334 False 3 50;50;0 1.2304 True ENSG00000055208 ENSG00000055208 HGNC:17075 TAC3 gene TAC3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypogonadotropic hypogonadism 10 with or without anosmia, MIM# 614839 19079066;20332248;23329188;22031817 False 3 100;0;0 1.2304 True ENSG00000166863 ENSG00000166863 HGNC:11521 TACO1 gene TACO1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 8, MIM# 619052 19503089;20727754;25044680;27319982 False 3 100;0;0 1.2304 True ENSG00000136463 ENSG00000136463 HGNC:24316 TACR3 gene TACR3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypogonadotropic hypogonadism 11 with or without anosmia, MIM# 614840 20332248;19079066 False 3 100;0;0 1.2304 True ENSG00000169836 ENSG00000169836 HGNC:11528 TACSTD2 gene TACSTD2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Corneal dystrophy, gelatinous drop-like, MIM# 204870 10192395;12107443;12614764;31666974;31534795 False 3 100;0;0 1.2304 True ENSG00000184292 ENSG00000184292 HGNC:11530 TAF1 gene TAF1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Dystonia-Parkinsonism, X-linked, MIM# 314250;Mental retardation, X-linked, syndromic 33, MIM# 300966 17273961;31646703 False 3 100;0;0 1.2304 True ENSG00000147133 ENSG00000147133 HGNC:11535 TAF2 gene TAF2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mental retardation, autosomal recessive 40, MIM# 615599 21937992;22633631;26350204;24084144;34474177 False 3 100;0;0 1.2304 True ENSG00000064313 ENSG00000064313 HGNC:11536 TAF4 gene TAF4 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder, autosomal dominant 73, MIM# 620450 33875846;28191890;35904126 False 3 100;0;0 1.2304 True ENSG00000130699 ENSG00000130699 HGNC:11537 TAF6 gene TAF6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Alazami-Yuan syndrome, MIM# 617126 25558065;25574841;32030742 False 3 100;0;0 1.2304 True ENSG00000106290 ENSG00000106290 HGNC:11540 TAF8 gene TAF8 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with severe motor impairment, absent language, cerebral hypomyelination, and brain atrophy, MIM# 619972 29648665;35759269 False 3 100;0;0 1.2304 True ENSG00000137413 ENSG00000137413 HGNC:17300 TALDO1 gene TALDO1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Transaldolase deficiency , MIM#606003 35186000;26238251 False 3 100;0;0 1.2304 True ENSG00000177156 ENSG00000177156 HGNC:11559 TAMM41 gene TAMM41 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency-56 (COXPD56), MIM#620139;hypotonia;developmental delay;myopathy;ptosis 35321494;29253589 False 3 100;0;0 1.2304 True ENSG00000144559 ENSG00000144559 HGNC:25187 TANC2 gene TANC2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Intellectual disability;autism;epilepsy;dysmorphism;Intellectual developmental disorder with autistic features and language delay, with or without seizures, MIM# 618906" 31616000 False 3 100;0;0 1.2304 True ENSG00000170921 ENSG00000170921 HGNC:30212 TANGO2 gene TANGO2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Metabolic encephalomyopathic crises, recurrent, with rhabdomyolysis, cardiac arrhythmias, and neurodegeneration, MIM# 616878 26805782;30245509 False 3 100;0;0 1.2304 True ENSG00000183597 ENSG00000183597 HGNC:25439 TAOK1 gene TAOK1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental delay with or without intellectual impairment or behavioural abnormalities, MIM#619575;TAOK1-related neurodevelopmental disorder 31230721 False 3 100;0;0 1.2304 True ENSG00000160551 ENSG00000160551 HGNC:29259 TAOK2 gene TAOK2 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal neurodevelopmental disorder, MONDO:0700092, TAOK2-related;Generalized verrucosis;abnormal T cell activation;autism 28385331;29467497;39737487 False 3 50;50;0 1.2304 True ENSG00000149930 ENSG00000149930 HGNC:16835 TAP1 gene TAP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bare lymphocyte syndrome, type I MIM#604571;Low CD8;absent MHC I on lymphocytes;vasculitis;pyoderma gangrenosum;skin lesions;recurrent respiratory tract infections;bronchiectasis 28161407;10074494;1473153 False 3 100;0;0 1.2304 True ENSG00000168394 ENSG00000168394 HGNC:43 TAP2 gene TAP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal "MHC class I deficiency 2, MIM# 620813;Bare lymphocyte syndrome, type I, due to TAP2 deficiency MIM# 604571;Low CD8;absent MHC I on lymphocytes;Vasculitis;pyoderma gangrenosum;recurrent bacterial/viral respiratory infections;bronchiectasis" 7517574;9232449;10560675;27861817 False 3 100;0;0 1.2304 True ENSG00000204267 ENSG00000204267 HGNC:44 TARS2 gene TARS2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 21, MIM# 615918 24827421;26811336;33153448;34508595 False 3 50;50;0 1.2304 True ENSG00000143374 ENSG00000143374 HGNC:30740 TASP1 gene TASP1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Developmental delay;microcephaly;dysmorphic features;congenital abnormalities;Suleiman-El-Hattab syndrome, MIM#618950 31209944;31350873 False 3 100;0;0 1.2304 True ENSG00000089123 ENSG00000089123 HGNC:15859 TAT gene TAT Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Tyrosinaemia, type II, MIM# 276600 False 3 100;0;0 1.2304 True ENSG00000198650 ENSG00000198650 HGNC:11573 TAZ gene TAZ Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Barth syndrome, MIM# 302060 False 3 100;0;0 1.2304 True ENSG00000102125 ENSG00000102125 HGNC:11577 TBC1D1 gene TBC1D1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted CAKUT;Non-syndromic renal or urinary tract malformation, MONDO:0019720 26572137 False 3 100;0;0 1.2304 True ENSG00000065882 ENSG00000065882 HGNC:11578 TBC1D20 gene TBC1D20 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Warburg micro syndrome 4, MIM# 615663;Martsolf syndrome 24239381;32740904;32162791 False 3 100;0;0 1.2304 True ENSG00000125875 ENSG00000125875 HGNC:16133 TBC1D23 gene TBC1D23 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 11, MIM# 617695 28823707;28823706 False 3 100;0;0 1.2304 True ENSG00000036054 ENSG00000036054 HGNC:25622 TBC1D24 gene TBC1D24 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Deafness, autosomal dominant 65 MIM#616044;Deafness, autosomal recessive 86 MIM#614617;Developmental and epileptic encephalopathy 16 MIM#615338;DOORS syndrome MIM#220500;Epilepsy, rolandic, with proxysmal exercise-induce dystonia and writer's cramp MIM#608105;Myoclonic epilepsy, infantile, familial MIM#605021 25719194 False 3 100;0;0 1.2304 True ENSG00000162065 ENSG00000162065 HGNC:29203 TBC1D2B gene TBC1D2B Expert Review;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with seizures and gingival overgrowth (NEDSGO), MIM#619323;Global developmental delay;Intellectual disability;Seizures;Gingival overgrowth;Behavioral abnormality;Abnormality of the mandible;Abnormality of brain morphology;Abnormality of the eye;Hearing abnormality 32623794 False 3 100;0;0 1.2304 True ENSG00000167202 ENSG00000167202 HGNC:29183 TBC1D32 gene TBC1D32 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Orofaciodigital syndrome type IX;syndromic hypopituitarism 24285566;32573025;32060556;31130284 False 3 50;50;0 1.2304 True ENSG00000146350 ENSG00000146350 HGNC:21485 TBC1D7 gene TBC1D7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Macrocephaly/megalencephaly syndrome, autosomal recessive, MIM# 248000 24515783;23687350;36669495 False 3 100;0;0 1.2304 True ENSG00000145979 ENSG00000145979 HGNC:21066 TBC1D8B gene TBC1D8B Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Nephrotic syndrome, type 20, MIM# 301028 30661770 False 3 100;0;0 1.2304 True ENSG00000133138 ENSG00000133138 HGNC:24715 TBCD gene TBCD Expert Review;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Encephalopathy, progressive, early-onset, with brain atrophy and thin corpus callosum, MIM#617193 27666370;27666374 False 3 100;0;0 1.2304 True ENSG00000141556 ENSG00000141556 HGNC:11581 TBCE gene TBCE Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Encephalopathy, progressive, with amyotrophy and optic atrophy;Hypoparathyroidism-retardation-dysmorphism syndrome;Kenny-Caffey syndrome, type 1 27666369 False 3 100;0;0 1.2304 True ENSG00000116957 ENSG00000116957 HGNC:11582 TBCK gene TBCK Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypotonia, infantile, with psychomotor retardation and characteristic facies 3, MIM# 616900 27040692;30103036;27040691 False 3 100;0;0 1.2304 True ENSG00000145348 ENSG00000145348 HGNC:28261 TBL1X gene TBL1X Expert Review Green;Literature Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Hypothyroidism, congenital, nongoitrous, 8 MIM#301033 PMID: 27603907 False 3 100;0;0 1.2304 True ENSG00000101849 ENSG00000101849 HGNC:11585 TBL1XR1 gene TBL1XR1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 41, MIM# 616944;Pierpont syndrome, MIM# 602342 26769062;30365874;25425123;9450851;23160955;28687524;23176139;16007632 False 3 50;50;0 1.2304 True ENSG00000177565 ENSG00000177565 HGNC:29529 TBR1 gene TBR1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder with autism and speech delay, MIM# 606053 25232744;30250039 False 3 100;0;0 1.2304 True ENSG00000136535 ENSG00000136535 HGNC:11590 TBX1 gene TBX1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted DiGeorge syndrome MIM# 188400;Velocardiofacial syndrome MIM# 192430;Decreased T cells;Hypoparathyroidism;Conotruncal cardiac malformation;velopalatal insufficiency;abnormal facies (cleft palate, prominent tubular nose etc);intellectual disability;Immunodeficiency;thymic hypoplasia or aplasia with resultant T cell dysfunction;renal anomalies;autoimmunity 20301696;31830774;16684884 False 3 100;0;0 1.2304 True ENSG00000184058 ENSG00000184058 HGNC:11592 TBX15 gene TBX15 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cousin syndrome, MIM# 260660 19068278;24039145 False 3 100;0;0 1.2304 True ENSG00000092607 ENSG00000092607 HGNC:11594 TBX18 gene TBX18 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Congenital anomalies of kidney and urinary tract 2, MIM# 143400 26235987 False 3 100;0;0 1.2304 True ENSG00000112837 ENSG00000112837 HGNC:11595 TBX19 gene TBX19 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Adrenocorticotropic hormone deficiency, 201400 15613420;15613420 False 3 100;0;0 1.2304 True ENSG00000143178 ENSG00000143178 HGNC:11596 TBX20 gene TBX20 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Atrial septal defect 4, MIM# 611363 17668378;19762328;33585493;29089047 False 3 100;0;0 1.2304 True ENSG00000164532 ENSG00000164532 HGNC:11598 TBX22 gene TBX22 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Cleft palate with ankyloglossia, MIM# 303400;Abruzzo-Erickson syndrome, MIM# 302905 11559848;12374769;14729838;17868388;22784330;22784330 False 3 100;0;0 1.2304 True ENSG00000122145 ENSG00000122145 HGNC:11600 TBX3 gene TBX3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ulnar-mammary syndrome, MIM# 181450;MONDO:0008411 9207801;19938096;28145909 False 3 100;0;0 1.2304 True ENSG00000135111 ENSG00000135111 HGNC:11602 TBX4 gene TBX4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Amelia, posterior, with pelvic and pulmonary hypoplasia syndrome, MIM# 601360;Ischiocoxopodopatellar syndrome with or without pulmonary arterial hypertension, MIM# 147891 31761294 False 3 100;0;0 1.2304 True ENSG00000121075 ENSG00000121075 HGNC:11603 TBX5 gene TBX5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Holt-Oram syndrome, MIM# 142900 31373354;10077612 False 3 100;0;0 1.2304 True ENSG00000089225 ENSG00000089225 HGNC:11604 TBX6 gene TBX6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spondylocostal dysostosis 5, 122600;Mayer-Rokitansky-K ster-Hauser syndrome, MONDO:0017771, TBX6-related 8954725;20503311;23335591;25564734;31015262;30307510 False 3 100;0;0 1.2304 True ENSG00000149922 ENSG00000149922 HGNC:11605 TBXAS1 gene TBXAS1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ghosal hematodiaphyseal syndrome, MIM# 231095 False 3 100;0;0 1.2304 True ENSG00000059377 ENSG00000059377 HGNC:11609 TCAP gene TCAP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 7, MIM# 601954 False 3 100;0;0 1.2304 True ENSG00000173991 ENSG00000173991 HGNC:11610 TCEAL1 gene TCEAL1 Expert Review Green;Literature Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Neurodevelopmental disorder with gait disturbance, dysmorphic facies and behavioral abnormalities, X-linked, MIM# 301094 PMID: 36368327 False 3 100;0;0 1.2304 True ENSG00000172465 ENSG00000172465 HGNC:11616 TCF12 gene TCF12 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Craniosynostosis 3, MIM# 615314;Hypogonadotropic hypogonadism 26 with or without anosmia, MIM# 619718;Kallman syndrome 23354436;32620954 False 3 50;50;0 1.2304 True ENSG00000140262 ENSG00000140262 HGNC:11623 TCF20 gene TCF20 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental delay with variable intellectual impairment and behavioral abnormalities, AD, MIM#618430 30739909;30819258;25228304;34904221 False 3 100;0;0 1.2304 True ENSG00000100207 ENSG00000100207 HGNC:11631 TCF3 gene TCF3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Agammaglobulinaemia 8, autosomal dominant, MIM# 616941;Agammaglobulinaemia 8B, autosomal recessive, MIM# 619824 24216514;28532655;30063982;8001124;8001125 False 3 100;0;0 1.2304 True ENSG00000071564 ENSG00000071564 HGNC:11633 TCF4 gene TCF4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Pitt-Hopkins syndrome, MIM# 610954 18728071;22934316 False 3 100;0;0 1.2304 True ENSG00000196628 ENSG00000196628 HGNC:11634 TCF7L2 gene TCF7L2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Global developmental delay;Intellectual disability;Autism;Attention deficit hyperactivity disorder;Myopia;Abnormality of skeletal system 33057194;34003604 False 3 50;50;0 1.2304 True ENSG00000148737 ENSG00000148737 HGNC:11641 TCIRG1 gene TCIRG1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Osteopetrosis, autosomal recessive 1, MIM# 259700 34624559;34210262;30084437;28816234 False 3 100;0;0 1.2304 True ENSG00000110719 ENSG00000110719 HGNC:11647 TCN2 gene TCN2 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Transcobalamin II deficiency, 275350 19373259;32841161;33023511;30124850 False 3 100;0;0 1.2304 True ENSG00000185339 ENSG00000185339 HGNC:11653 TCOF1 gene TCOF1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Treacher Collins syndrome 1, MIM# 154500 12444270;15150774;21951868 False 3 100;0;0 1.2304 True ENSG00000070814 ENSG00000070814 HGNC:11654 TCP1 gene TCP1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder with polymicrogyria and seizures, MIM# 621021 39480921 False 3 100;0;0 1.2304 True ENSG00000120438 ENSG00000120438 HGNC:11655 TCTEX1D2 gene TCTEX1D2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Short-rib thoracic dysplasia 17 with or without polydactyly, MIM# 617405 26044572;25830415 False 3 100;0;0 1.2304 True ENSG00000213123 ENSG00000213123 HGNC:28482 TCTN1 gene TCTN1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 13, MIM# 614173;MONDO:0013608 31302911;28631893;21725307;26477546 False 3 100;0;0 1.2304 True ENSG00000204852 ENSG00000204852 HGNC:26113 TCTN2 gene TCTN2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 24, MIM# 616654;MONDO:0014724;Meckel syndrome 8, MIM# 613885;MONDO:0013482 21462283;21565611;25118024;21725307;32139166;25118024;32655147;33590725 False 3 100;0;0 1.2304 True ENSG00000168778 ENSG00000168778 HGNC:25774 TCTN3 gene TCTN3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 18, MIM# 614815;MONDO:0013896;Orofaciodigital syndrome IV, MIM# 258860;Mohr-Majewski syndrome;Meckel-Gruber syndrome 22883145;32139166;25118024;34096792 False 3 100;0;0 1.2304 True ENSG00000119977 ENSG00000119977 HGNC:24519 TDP2 gene TDP2 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 23;OMIM #616949 31410782;30109272;24658003 False 3 100;0;0 1.2304 True ENSG00000111802 ENSG00000111802 HGNC:17768 TDRD7 gene TDRD7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal "Cataract 36, 613887;glaucoma;nonobstructive azoospermia;arrested spermatogenesis" 28837160;21436445;32420594 False 3 100;0;0 1.2304 True ENSG00000196116 ENSG00000196116 HGNC:30831 TECPR2 gene TECPR2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 49, autosomal recessive, MIM# 615031;Autonomic-sensory neuropathy 23176824;26542466 False 3 100;0;0 1.2304 True ENSG00000196663 ENSG00000196663 HGNC:19957 TECRL gene TECRL Expert Review;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Ventricular tachycardia, catecholaminergic polymorphic, 3, MIM# 614021" 17666061;27861123;30790670;33367594 False 3 100;0;0 1.2304 True ENSG00000205678 ENSG00000205678 HGNC:27365 TECTA gene TECTA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Deafness, autosomal recessive 21 603629;Deafness, autosomal dominant 8/12 601543 22718023;17136632;31554319;21520338 False 3 100;0;0 1.2304 True Other ENSG00000109927 ENSG00000109927 HGNC:11720 TEFM gene TEFM Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "Combined oxidative phosphorylation deficiency 58, MIM# 620451" 36823193 False 3 100;0;0 1.2304 True ENSG00000172171 ENSG00000172171 HGNC:26223 TEK gene TEK Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Glaucoma 3, primary congenital, E, MIM# 617272;Venous malformations, multiple cutaneous and mucosal, MIM# 600195 27270174;19888299 False 3 100;0;0 1.2304 True ENSG00000120156 ENSG00000120156 HGNC:11724 TELO2 gene TELO2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal You-Hoover-Fong syndrome, MIM#616954;Syndromic intellectual disability 27132593;28944240 False 3 100;0;0 1.2304 True ENSG00000100726 ENSG00000100726 HGNC:29099 TENM3 gene TENM3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microphthalmia, syndromic 15, MIM#615145;coloboma 30513139;22766609;27103084;29753094 False 3 100;0;0 1.2304 True ENSG00000218336 ENSG00000218336 HGNC:29944 TERC gene TERC Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dyskeratosis congenita, autosomal dominant 1, MIM# 127550 11574891 False 3 100;0;0 1.2304 True ENSG00000270141 ENSG00000270141 HGNC:11727 TERT gene TERT Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Dyskeratosis congenita, MIM# 613989;Pulmonary fibrosis and/or bone marrow failure, telomere-related, 1, MIM# 614742 16247010;15814878 False 3 100;0;0 1.2304 True ENSG00000164362 ENSG00000164362 HGNC:11730 TET2 gene TET2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Dementia;Lymphoma/myeloid malignancy;Immunodeficiency-75 (IMD75), MIM#619126;Pulmonary arterial hypertension MONDO:0015924, TET2-related 30890702;31827242;32330418;32518946;32192357 False 3 100;0;0 1.2304 True ENSG00000168769 ENSG00000168769 HGNC:25941 TET3 gene TET3 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Beck-Fahrner syndrome MIM#618798 31928709 False 3 100;0;0 1.2304 True ENSG00000187605 ENSG00000187605 HGNC:28313 TF gene TF Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Atransferrinaemia MIM# 209300;iron overload;hypochromic anaemia;low serum transferrin;Hemosiderosis of the heart and/or liver;Congestive heart failure 11110675;3472216 False 3 100;0;0 1.2304 True ENSG00000091513 ENSG00000091513 HGNC:11740 TFAM gene TFAM Expert Review Green;NHS GMS Mendeliome BIALLELIC, autosomal or pseudoautosomal "Mitochondrial DNA depletion syndrome 15 (hepatocerebral type) MIM#617156;Perrault syndrome" 27448789;29021295;9500544;32399598;34647195;34647195 False 3 100;0;0 1.2304 True ENSG00000108064 ENSG00000108064 HGNC:11741 TFAP2A gene TFAP2A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Branchiooculofacial syndrome, MIM 113620 23578821;21204207;21728810;21539471 False 3 100;0;0 1.2304 True Other ENSG00000137203 ENSG00000137203 HGNC:11742 TFAP2B gene TFAP2B Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Char syndrome, MIM# 169100;Patent ductus arteriosus 2, MIM# 617035;Syndromic craniosynostosis" 31292255;11505339;15684060;18752453;21643846 False 3 100;0;0 1.2304 True ENSG00000008196 ENSG00000008196 HGNC:11743 TFE3 gene TFE3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Intellectual developmental disorder, X-linked, syndromic, with pigmentary mosaicism and coarse facies, MIM# 301066;Intellectual disability;Epilepsy;Coarse facial features 30595499;31833172;33057194;32409512 False 3 100;0;0 1.2304 True ENSG00000068323 ENSG00000068323 HGNC:11752 TFG gene TFG Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hereditary motor and sensory neuropathy, Okinawa type, MIM# 604484;Spastic paraplegia 57, autosomal recessive, MIM# 615658 False 3 100;0;0 1.2304 True ENSG00000114354 ENSG00000114354 HGNC:11758 TFR2 gene TFR2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Haemochromatosis, type 3 (MIM#604250) 24847265;29743178 False 3 100;0;0 1.2304 True ENSG00000106327 ENSG00000106327 HGNC:11762 TG gene TG Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Thyroid dyshormonogenesis 3, MIM# 274700 33832185;19169491;28620499;18631008;12915634 False 3 100;0;0 1.2304 True ENSG00000042832 ENSG00000042832 HGNC:11764 TGDS gene TGDS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Catel-Manzke syndrome, MIM# 616145 25480037 False 3 100;0;0 1.2304 True ENSG00000088451 ENSG00000088451 HGNC:20324 TGFB1 gene TGFB1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Inflammatory bowel disease, immunodeficiency, and encephalopathy MIM# 618213;Camurati-Engelmann disease, MIM# 131300 29483653;10973241;35315241;30721323 False 3 100;0;0 1.2304 True ENSG00000105329 ENSG00000105329 HGNC:11766 TGFB2 gene TGFB2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Loeys-Dietz syndrome 4, MIM# 614816 False 3 100;0;0 1.2304 True ENSG00000092969 ENSG00000092969 HGNC:11768 TGFB3 gene TGFB3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Loeys-Dietz syndrome 5, MIM# 615582 30071989;25835445;15639475 False 3 100;0;0 1.2304 True ENSG00000119699 ENSG00000119699 HGNC:11769 TGFBI gene TGFBI Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Corneal dystrophy, multiple types, MONDO:0000764 9054935 False 3 100;0;0 1.2304 True ENSG00000120708 ENSG00000120708 HGNC:11771 TGIF1 gene TGIF1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Holoprosencephaly 4, MIM# 142946;MONDO:0007734 10835638;16323008 False 3 100;0;0 1.2304 True ENSG00000177426 ENSG00000177426 HGNC:11776 TGM1 gene TGM1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ichthyosis, congenital, autosomal recessive 1, MIM#242300 19890349;24261627;30302839 False 3 100;0;0 1.2304 True ENSG00000092295 ENSG00000092295 HGNC:11777 TGM5 gene TGM5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal "Peeling skin syndrome 2, MIM# 609796" 16380904 False 3 100;0;0 1.2304 True ENSG00000104055 ENSG00000104055 HGNC:11781 THAP1 gene THAP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Dystonia 6, torsion, 602629;MONDO:0011264 21793105;22377579;36205328;21425335;20211909 False 3 100;0;0 1.2304 True ENSG00000131931 ENSG00000131931 HGNC:20856 THBD gene THBD Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Hemolytic uremic syndrome, atypical, susceptibility to, 6}, MIM# 612926;Bleeding disorder 29500241;19625716;25564403;32634856 False 3 50;50;0 1.2304 True ENSG00000178726 ENSG00000178726 HGNC:11784 THBS1 gene THBS1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Congenital glaucoma MONDO:0020366, THBS1-related 36453543 False 3 100;0;0 1.2304 True ENSG00000137801 ENSG00000137801 HGNC:11785 THG1L gene THG1L Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "Spinocerebellar ataxia, autosomal recessive 28, MIM# 618800" 27307223;31168944;30214071 False 3 100;0;0 1.2304 True ENSG00000113272 ENSG00000113272 HGNC:26053 THOC2 gene THOC2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Mental retardation, X-linked 12/35 MIM#300957 26166480;32116545;29851191;32960281 False 3 100;0;0 1.2304 True ENSG00000125676 ENSG00000125676 HGNC:19073 THOC6 gene THOC6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Beaulieu-Boycott-Innes syndrome, MIM# 613680 23621916;26739162;27102954;30238602;30476144 False 3 100;0;0 1.2304 True ENSG00000131652 ENSG00000131652 HGNC:28369 THPO gene THPO Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Thrombocythemia 1, MIM# 187950;Thrombocytopenia 9, MIM# 620478 9425899;10583217;32150607;28466964 False 3 100;0;0 1.2304 True ENSG00000090534 ENSG00000090534 HGNC:11795 THRA gene THRA Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypothyroidism, congenital, nongoitrous, 6, MIM# 614450 25135573;27381958;24847459;27144938 False 3 100;0;0 1.2304 True ENSG00000126351 ENSG00000126351 HGNC:11796 THRB gene THRB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Thyroid hormone resistance, MIM# 188570;Thyroid hormone resistance, autosomal recessive, MIM# 274300;Thyroid hormone resistance, selective pituitary, MIM# 145650 25135573;31590893 False 3 50;50;0 1.2304 True ENSG00000151090 ENSG00000151090 HGNC:11799 THSD1 gene THSD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Aneurysm, intracranial berry, 12 , MIM# 618734;Lymphatic malformation 13, MIM# 620244 27895300;33569873 False 3 50;50;0 1.2304 True ENSG00000136114 ENSG00000136114 HGNC:17754 THUMPD1 gene THUMPD1 Expert Review Green;Other Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with speech delay and variable ocular anomalies, MIM# 619989 False 3 100;0;0 1.2304 True ENSG00000066654 ENSG00000066654 HGNC:23807 TIAM1 gene TIAM1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "Neurodevelopmental disorder with language delay and seizures, MIM# 619908" https://doi.org/10.1016/j.ajhg.2022.01.020 False 3 100;0;0 1.2304 True ENSG00000156299 ENSG00000156299 HGNC:11805 TICAM1 gene TICAM1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal {Encephalopathy, acute, infection-induced (herpes-specific), susceptibility to, 6}, MIM# 614850 22105173;26513235 False 3 100;0;0 1.2304 True ENSG00000127666 ENSG00000127666 HGNC:18348 TIE1 gene TIE1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Lymphatic malformation 11, MIM# 619401 32947856;24764452;38820174 False 3 50;50;0 1.2304 True ENSG00000066056 ENSG00000066056 HGNC:11809 TIMM50 gene TIMM50 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria, type IX, MIM# 617698 27573165;32369862;30190335;31058414 False 3 100;0;0 1.2304 True ENSG00000105197 ENSG00000105197 HGNC:23656 TIMM8A gene TIMM8A Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Mohr-Tranebjaerg syndrome, MIM# 304700 11803487;11405816;32820032 False 3 100;0;0 1.2304 True ENSG00000126953 ENSG00000126953 HGNC:11817 TIMMDC1 gene TIMMDC1 Expert Review Green;NHS GMS Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 31 MIM#618251 28604674;30981218 False 3 50;50;0 1.2304 True ENSG00000113845 ENSG00000113845 HGNC:1321 TIMP3 gene TIMP3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Sorsby fundus dystrophy, MIM# 136900 7894485;10854443;32715858;32666594;31757977;31369189;30668888 False 3 100;0;0 1.2304 True ENSG00000100234 ENSG00000100234 HGNC:11822 TINF2 gene TINF2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dyskeratosis congenita, autosomal dominant 3, MIM# 613990;Revesz syndrome, MIM# 268130 18252230;21477109;18979121;18669893;21199492;33097095 False 3 50;50;0 1.2304 True ENSG00000092330 ENSG00000092330 HGNC:11824 TJP2 gene TJP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cholestasis, progressive familial intrahepatic 4, MIM# 615878;Hypercholanemia, familial 1, MIM# 607748 24614073;25921221;31696999;12704386 False 3 100;0;0 1.2304 True ENSG00000119139 ENSG00000119139 HGNC:11828 TK2 gene TK2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 2 (myopathic type), MIM# 609560;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 3;MIM# 617069 11687801;12391347;12873860;35286480;35280287;35094997 False 3 100;0;0 1.2304 True ENSG00000166548 ENSG00000166548 HGNC:11831 TLE6 gene TLE6 Expert Review;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Preimplantation embryonic lethality, MIM# 616814" 26537248;31897846 False 3 100;0;0 1.2304 True ENSG00000104953 ENSG00000104953 HGNC:30788 TLK2 gene TLK2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Intellectual disability, MIM 618050;Neurodevelopmental disease 29861108;29942082;27479843;23911319;30559488;29942082;31558842 False 3 100;0;0 1.2304 True ENSG00000146872 ENSG00000146872 HGNC:11842 TLL1 gene TLL1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Atrial septal defect 6, MIM# 613087 18830233;30538173;27418595;31570783 False 3 100;0;0 1.2304 True ENSG00000038295 ENSG00000038295 HGNC:11843 TLR3 gene TLR3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Immunodeficiency 83, susceptibility to viral infections, MIM# 613002 17872438;21911422;25339207;26513235;28368532;31217193;32936395 False 3 100;0;0 1.2304 True ENSG00000164342 ENSG00000164342 HGNC:11849 TLR7 gene TLR7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Immunodeficiency 74, COVID19-related, X-linked, MIM# 301051;Systemic lupus erythematosus 17, MIM# 301080 32706371;35477763 False 3 100;0;0 1.2304 True ENSG00000196664 ENSG00000196664 HGNC:15631 TLR8 gene TLR8 Expert Review Green;Literature Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Immunodeficiency 98 with autoinflammation, X-linked, MIM# 301078 33512449;34981838 False 3 100;0;0 1.2304 True Other ENSG00000101916 ENSG00000101916 HGNC:15632 TMC1 gene TMC1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Deafness, autosomal dominant 36, MIM# 606705;Deafness, autosomal recessive 7, MIM# 600974 11850618;17250663;18616530;24827932;11850623;22105175 False 3 100;0;0 1.2304 True ENSG00000165091 ENSG00000165091 HGNC:16513 TMC6 gene TMC6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Epidermodysplasia verruciformis, MIM# 226400 12426567;15042430 False 3 100;0;0 1.2304 True ENSG00000141524 ENSG00000141524 HGNC:18021 TMC8 gene TMC8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Epidermodysplasia verruciformis 2, MIM# 618231 34459021;28646613;12426567 False 3 100;0;0 1.2304 True ENSG00000167895 ENSG00000167895 HGNC:20474 TMCO1 gene TMCO1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Craniofacial dysmorphism, skeletal anomalies, and mental retardation syndrome, MIM# 213980 20018682;23320496;17351359;30556256;31102500 False 3 100;0;0 1.2304 True ENSG00000143183 ENSG00000143183 HGNC:18188 TMEFF1 gene TMEFF1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Hereditary susceptibility to infections, MONDO:0015979, TMEFF1-related;HSV encephalitis 39048830 False 3 100;0;0 1.2304 True ENSG00000241697 ENSG00000241697 HGNC:11866 TMEM106B gene TMEM106B Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Leukodystrophy, hypomyelinating, 16, MIM# 617964 29186371;29444210 False 3 100;0;0 1.2304 True ENSG00000106460 ENSG00000106460 HGNC:22407 TMEM107 gene TMEM107 Expert Review;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Meckel syndrome 13 (MIM#617562);Orofaciodigital syndrome XVI (MIM#617563);Joubert syndrome 29, MIM# 617562 26518474;26595381;26123494 False 3 50;50;0 1.2304 True ENSG00000179029 ENSG00000179029 HGNC:28128 TMEM126A gene TMEM126A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Optic atrophy 7, MIM# 612989;MONDO:0013069;Syndromic auditory neuropathy spectrum disorder 19327736;20405026;22815638;33879611;31119195;30961538 False 3 100;0;0 1.2304 True ENSG00000171202 ENSG00000171202 HGNC:25382 TMEM126B gene TMEM126B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 29, MIM# 618250 27374774;27374773 False 3 100;0;0 1.2304 True ENSG00000171204 ENSG00000171204 HGNC:30883 TMEM127 gene TMEM127 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Pheochromocytoma, susceptibility to} 171300 False 3 100;0;0 1.2304 True ENSG00000135956 ENSG00000135956 HGNC:26038 TMEM138 gene TMEM138 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 16, MIM# 614465;MONDO:0013764 22282472;28102635;27434533 False 3 100;0;0 1.2304 True ENSG00000149483 ENSG00000149483 HGNC:26944 TMEM147 gene TMEM147 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with facial dysmorphism, absent language, and pseudo-Pelger-Huet anomaly, MIM# 620075 PMID: 36044892 False 3 100;0;0 1.2304 True ENSG00000105677 ENSG00000105677 HGNC:30414 TMEM151A gene TMEM151A Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted episodic kinesigenic dyskinesia MONDO:0044202 34820915;34518509 False 3 100;0;0 1.2304 True ENSG00000179292 ENSG00000179292 HGNC:28497 TMEM163 gene TMEM163 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Hypomyelinating leukodystrophy, MONDO:0019046 PMID: 35953447 False 3 100;0;0 1.2304 True ENSG00000152128 ENSG00000152128 HGNC:25380 TMEM165 gene TMEM165 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IIk, MIM# 614727;TMEM165-CDG, MONDO:0013870 22683087;28323990;27401145;27008884;26238249;25609749 False 3 100;0;0 1.2304 True ENSG00000134851 ENSG00000134851 HGNC:30760 TMEM173 gene TMEM173 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal STING-associated vasculopathy, infantile-onset, MIM# 615934 25401470;25029335;32673614;36275728 False 3 100;0;0 1.2304 True ENSG00000184584 ENSG00000184584 HGNC:27962 TMEM199 gene TMEM199 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IIp MIM# 616829 26833330;29321044 False 3 100;0;0 1.2304 True ENSG00000244045 ENSG00000244045 HGNC:18085 TMEM216 gene TMEM216 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 2, MIM# 608091;MONDO:0011963;Meckel syndrome 2, MIM# 603194;MONDO:0011296;Retinitis pigmentosa, MONDO:0019200, TMEM216-related 20036350;20512146;39191256 False 3 100;0;0 1.2304 True ENSG00000187049 ENSG00000187049 HGNC:25018 TMEM218 gene TMEM218 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 39, MIM#619562;retinal dystrophy;polycystic kidneys;occipital encephalocele 33791682;25161209 False 3 100;0;0 1.2304 True ENSG00000150433 ENSG00000150433 HGNC:27344 TMEM222 gene TMEM222 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with motor and speech delay and behavioural abnormalities, MIM# 619470;Intellectual disability;Epilepsy;Microcephaly 33824500 False 3 100;0;0 1.2304 True ENSG00000186501 ENSG00000186501 HGNC:25363 TMEM231 gene TMEM231 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 20, MIM# 614970;MONDO:0013994;Meckel syndrome 11, MIM# 615397;MONDO:0014164 23012439;23349226;22179047;30617574;27449316;31663672;25869670 False 3 100;0;0 1.2304 True ENSG00000205084 ENSG00000205084 HGNC:37234 TMEM237 gene TMEM237 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 14, MIM# 614424 False 3 100;0;0 1.2304 True ENSG00000155755 ENSG00000155755 HGNC:14432 TMEM240 gene TMEM240 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 21, MIM# 607454 25070513 False 3 100;0;0 1.2304 True ENSG00000205090 ENSG00000205090 HGNC:25186 TMEM260 gene TMEM260 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Structural heart defects and renal anomalies syndrome, MIM# 617478 28318500 False 3 100;0;0 1.2304 True ENSG00000070269 ENSG00000070269 HGNC:20185 TMEM38B gene TMEM38B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Osteogenesis imperfecta, type XIV, MIM# 615066 23054245 False 3 100;0;0 1.2304 True ENSG00000095209 ENSG00000095209 HGNC:25535 TMEM5 gene TMEM5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041 23217329;23519211 False 3 100;0;0 1.2304 True ENSG00000118600 ENSG00000118600 HGNC:13530 TMEM53 gene TMEM53 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Primary bone dysplasia MONDO:0018230, TMEM53-related;Sclerosing bone disorder, macrocephaly, impaired vision, short stature PMID: 33824347 False 3 100;0;0 1.2304 True ENSG00000126106 ENSG00000126106 HGNC:26186 TMEM63A gene TMEM63A Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Leukodystrophy, hypomyelinating, 19, transient infantile, MIM# 618688" 31587869 False 3 100;0;0 1.2304 True ENSG00000196187 ENSG00000196187 HGNC:29118 TMEM63B gene TMEM63B Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted developmental and epileptic encephalopathy, MONDO:0100062, TMEM63B-related 37421948 False 3 100;0;0 1.2304 True ENSG00000137216 ENSG00000137216 HGNC:17735 TMEM63C gene TMEM63C Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 87, autosomal recessive, MIM# 619966 PMID: 35718349 False 3 100;0;0 1.2304 True ENSG00000165548 ENSG00000165548 HGNC:23787 TMEM67 gene TMEM67 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 6, MIM# 610688;Meckel syndrome 3, MIM# 607361;Nephronophthisis 11, MIM# 613550;COACH syndrome 1, MIM# 216360 16415887;17377820;17160906;19508969 False 3 100;0;0 1.2304 True ENSG00000164953 ENSG00000164953 HGNC:28396 TMEM70 gene TMEM70 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex V (ATP synthase) deficiency, nuclear type 2, MIM# 614052 18953340;21147908;30950220 False 3 100;0;0 1.2304 True ENSG00000175606 ENSG00000175606 HGNC:26050 TMEM94 gene TMEM94 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Intellectual developmental disorder with cardiac defects and dysmorphic facies, MIM#618316 30526868 False 3 100;0;0 1.2304 True ENSG00000177728 ENSG00000177728 HGNC:28983 TMEM98 gene TMEM98 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Nanophthalmos 4 MIM#615972 24852644;26392740 False 3 100;0;0 1.2304 True ENSG00000006042 ENSG00000006042 HGNC:24529 TMIE gene TMIE Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 6, MIM# 600971 12145746;19438934;24416283;25467981;25475183;19934034;12140191 False 3 100;0;0 1.2304 True ENSG00000181585 ENSG00000181585 HGNC:30800 TMPRSS15 gene TMPRSS15 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Enterokinase deficiency, MIM# 226200 11719902;33061943 False 3 100;0;0 1.2304 True ENSG00000154646 ENSG00000154646 HGNC:9490 TMPRSS3 gene TMPRSS3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 8/10, MIM#601072 21786053;17551081 False 3 100;0;0 1.2304 True ENSG00000160183 ENSG00000160183 HGNC:11877 TMPRSS6 gene TMPRSS6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Iron-refractory iron deficiency anaemia MIM# 206200;Iron malabsorption;hypochromic microcytic anaemia 18408718;8596229;18596229;19592582 False 3 100;0;0 1.2304 True ENSG00000187045 ENSG00000187045 HGNC:16517 TMTC3 gene TMTC3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Lissencephaly 8 (MIM#617255) 27773428;28973161 False 3 100;0;0 1.2304 True ENSG00000139324 ENSG00000139324 HGNC:26899 TMX2 gene TMX2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephaly;ID;brain malformations 31735293;31586943 False 3 100;0;0 1.2304 True ENSG00000213593 ENSG00000213593 HGNC:30739 TNFAIP3 gene TNFAIP3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Autoinflammatory syndrome, familial, Behcet-like, MIM# 616744;Inflammatory bowel disease 26642243;34030699;33446651;32521965;31299923 False 3 100;0;0 1.2304 True ENSG00000118503 ENSG00000118503 HGNC:11896 TNFRSF11A gene TNFRSF11A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Osteopetrosis, autosomal recessive 7 - MIM# 612301 18606301;32048120 False 3 100;0;0 1.2304 True ENSG00000141655 ENSG00000141655 HGNC:11908 TNFRSF11B gene TNFRSF11B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Paget disease of bone 5, juvenile-onset, MIM# 239000 14672344 False 3 100;0;0 1.2304 True ENSG00000164761 ENSG00000164761 HGNC:11909 TNFRSF13B gene TNFRSF13B Expert Review Green;Victorian Clinical Genetics Services Mendeliome Other Immunodeficiency, common variable, 2, MIM# 240500 17392798;16007086;18981294;16007087 False 3 100;0;0 1.2304 True ENSG00000240505 ENSG00000240505 HGNC:18153 TNFRSF1A gene TNFRSF1A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Periodic fever, familial, MIM# 142680 10199409 False 3 100;0;0 1.2304 True ENSG00000067182 ENSG00000067182 HGNC:11916 TNFRSF9 gene TNFRSF9 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 109 with lymphoproliferation, MIM# 620282;EBV lymphoproliferation;B-cell lymphoma;Chronic active EBV infection 30872117;31501153 False 3 100;0;0 1.2304 True ENSG00000049249 ENSG00000049249 HGNC:11924 TNFSF11 gene TNFSF11 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Osteopetrosis, autosomal recessive 2, MIM# 259710 17632511;32048120;10984520 False 3 100;0;0 1.2304 True ENSG00000120659 ENSG00000120659 HGNC:11926 TNNC1 gene TNNC1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cardiomyopathy, dilated, 1Z, MIM# 611879;Cardiomyopathy, hypertrophic, 13 (MIM# 613243) 33947203;31983221;17977476;19808376;11385718;8572189;21262074;22815480;26779504 False 3 100;0;0 1.2304 True ENSG00000114854 ENSG00000114854 HGNC:11943 TNNC2 gene TNNC2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myopathy, congenital, with neonatal respiratory insufficiency, MIM# 620161 33755597 False 3 100;0;0 1.2304 True ENSG00000101470 ENSG00000101470 HGNC:11944 TNNI2 gene TNNI2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Arthrogryposis, distal, type 2B1 (MIM#601680) 17194691;25340332 False 3 100;0;0 1.2304 True Other ENSG00000130598 ENSG00000130598 HGNC:11946 TNNI3K gene TNNI3K Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Cardiac conduction disease with or without dilated cardiomyopathy, MIM# 616117" 30010057;29355681 False 3 100;0;0 1.2304 True ENSG00000116783 ENSG00000116783 HGNC:19661 TNNT1 gene TNNT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Nemaline myopathy 5, Amish type, MIM# 605355;Nemaline myopathy-5B with rigid spine and respiratory insufficiency (NEM5B), MIM#620386;nemaline myopathy-5C (NEM5C), autosomal dominant, MIMD620389 10952871;32994279;32819427;31970803;31604653;29931346;29178646;35510366 False 3 50;50;0 1.2304 True ENSG00000105048 ENSG00000105048 HGNC:11948 TNNT3 gene TNNT3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Arthrogryposis, distal, type 2B2, MIM# 618435 12865991;19142688;21402185;25337069;17194691 False 3 100;0;0 1.2304 True Other ENSG00000130595 ENSG00000130595 HGNC:11950 TNPO2 gene TNPO2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Intellectual developmental disorder with hypotonia, impaired speech, and dysmorphic facies, MIM# 619556 PMID: 34314705 False 3 100;0;0 1.2304 True Other ENSG00000105576 ENSG00000105576 HGNC:19998 TNPO3 gene TNPO3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Muscular dystrophy, limb-girdle, autosomal dominant 2, MIM# 608423 23667635;23543484;31071488;31192305 False 3 100;0;0 1.2304 True ENSG00000064419 ENSG00000064419 HGNC:17103 TNR gene TNR Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, nonprogressive, with spasticity and transient opisthotonus, MIM# 619653;Spastic para- or tetraparesis;Axial muscular hypotonia;Intellectual disability;Transient opisthotonus 32099069 False 3 100;0;0 1.2304 True ENSG00000116147 ENSG00000116147 HGNC:11953 TNRC6B gene TNRC6B Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Global developmental delay with speech and behavioural abnormalities, MIM# 619243 32152250;28135719;25363768;27479843;28959963;25228304 False 3 100;0;0 1.2304 True ENSG00000100354 ENSG00000100354 HGNC:29190 TNS2 gene TNS2 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Nephrotic syndrome 29773874 False 3 100;0;0 1.2304 True ENSG00000111077 ENSG00000111077 HGNC:19737 TNXB gene TNXB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ehlers-Danlos syndrome, classic-like, 1 MIM# 606408 28306229;28306225;23620400 False 3 100;0;0 1.2304 True ENSG00000168477 ENSG00000168477 HGNC:11976 TOE1 gene TOE1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 7, MIM# 614969 28092684 False 3 100;0;0 1.2304 True ENSG00000132773 ENSG00000132773 HGNC:15954 TOGARAM1 gene TOGARAM1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 37, MIM# 619185 32747439;32453716 False 3 100;0;0 1.2304 True ENSG00000198718 ENSG00000198718 HGNC:19959 TONSL gene TONSL Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spondyloepimetaphyseal dysplasia, sponastrime type OMIM:271510;spondyloepimetaphyseal dysplasia, sponastrime type MONDO:0010068 30773277;30773278;32959051 False 3 100;0;0 1.2304 True ENSG00000160949 ENSG00000160949 HGNC:7801 TOP2B gene TOP2B Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Autosomal dominant deafness;B-cell immunodeficiency, distal limb anomalies, and urogenital malformations, MIM# 609296;Intellectual disability 28343847;31198993;31409799;12773624 False 3 100;0;0 1.2304 True ENSG00000077097 ENSG00000077097 HGNC:11990 TOP3A gene TOP3A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephaly, growth restriction, and increased sister chromatid exchange 2, MIM# 618097;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 5, MIM#618098 30057030;33631320;29290614 False 3 100;0;0 1.2304 True ENSG00000177302 ENSG00000177302 HGNC:11992 TOPORS gene TOPORS Expert Review;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Retinitis pigmentosa 31 (MIM#609923);Ciliopathy, MONDO:0005308, TOPORS-associated, AR 21159800;17924349;28453362;18509552;34132027 False 3 50;50;0 1.2304 True ENSG00000197579 ENSG00000197579 HGNC:21653 TOR1A gene TOR1A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Arthrogryposis multiplex congenita, MIM#618947;Dystonia-1, torsion, MIM#128100 30244176;9288096;19955557;18477710;32243914;31583275;31347572 False 3 100;0;0 1.2304 True ENSG00000136827 ENSG00000136827 HGNC:3098 TOR1AIP1 gene TOR1AIP1 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, autosomal recessive, with rigid spine and distal joint contractures MIM#617072;Congenital myasthenic syndrome 24856141;31299614;30723199;27342937;32055997;33215087 False 3 100;0;0 1.2304 True ENSG00000143337 ENSG00000143337 HGNC:29456 TP53RK gene TP53RK Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Galloway-Mowat syndrome 4, MIM# 617730 28805828;30053862 False 3 100;0;0 1.2304 True ENSG00000172315 ENSG00000172315 HGNC:16197 TP63 gene TP63 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ADULT syndrome, OMIM #103285;Ectrodactyly, ectodermal dysplasia, and cleft lip/palate syndrome 3, OMIM #604292;Hay-Wells syndrome, OMIM #106260;Limb-mammary syndrome, OMIM #603543;Orofacial cleft 8, OMIM #618149;Rapp-Hodgkin syndrome, OMIM #129400;Split-hand/foot malformation 4, OMIM #605289 20556892 False 3 100;0;0 1.2304 True ENSG00000073282 ENSG00000073282 HGNC:15979 TP73 gene TP73 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 47, and lissencephaly, MIM#619466;Cortical malformation;Lissencephaly 31130284;34077761 False 3 67;33;0 1.2304 True ENSG00000078900 ENSG00000078900 HGNC:12003 TPI1 gene TPI1 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Hemolytic anemia due to triosephosphate isomerase deficiency, MIM# 615512" False 3 100;0;0 1.2304 True ENSG00000111669 ENSG00000111669 HGNC:12009 TPK1 gene TPK1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Thiamine metabolism dysfunction syndrome 5 (episodic encephalopathy type), MIM# 614458 22152682;33626592;33231275;33086386 False 3 100;0;0 1.2304 True ENSG00000196511 ENSG00000196511 HGNC:17358 TPM2 gene TPM2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Arthrogryposis, distal, type 1A 108120;Arthrogryposis, distal, type 2B4 108120;CAP myopathy 2 609285;Nemaline myopathy 4, autosomal dominant 609285;Multiple pterygium syndrome 32092148;27726070;32092148;24692096 False 3 100;0;0 1.2304 True ENSG00000198467 ENSG00000198467 HGNC:12011 TPM3 gene TPM3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal CAP myopathy 1, MIM# 609284;Myopathy, congenital, with fiber-type disproportion, MIM# 255310;Nemaline myopathy 1, autosomal dominant or recessive, MIM# 609284;Congenital muscle stiffness 26418456;7704029;17376686;18382475;19487656 False 3 100;0;0 1.2304 True Other ENSG00000143549 ENSG00000143549 HGNC:12012 TPM4 gene TPM4 Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Bleeding disorder, platelet-type, 25, MIM# 620486 28134622;31249973;21153663 False 3 100;0;0 1.2304 True ENSG00000167460 ENSG00000167460 HGNC:12013 TPO gene TPO Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Thyroid dyshormonogenesis 2A, MIM# 274500 8027236;10084596 False 3 100;0;0 1.2304 True ENSG00000115705 ENSG00000115705 HGNC:12015 TPP1 gene TPP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 2, MIM# 204500;MONDO:0008769;Spinocerebellar ataxia, autosomal recessive 7, MIM# 609270;MONDO:0012235 9295267;18684116;23418007;26224725;31283065 False 3 100;0;0 1.2304 True ENSG00000166340 ENSG00000166340 HGNC:2073 TPP2 gene TPP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 78 with autoimmunity and developmental delay, MIM# 619220 25525876;25414442;33586135;18362329 False 3 100;0;0 1.2304 True ENSG00000134900 ENSG00000134900 HGNC:12016 TPRKB gene TPRKB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Galloway-Mowat syndrome 5, MIM# 617731 28805828;30053862 False 3 100;0;0 1.2304 True ENSG00000144034 ENSG00000144034 HGNC:24259 TPRN gene TPRN Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 79, MIM# 613307 19603065;20170898;20170899;23340767;25129962;20170899;20170899;27693694;24285636 False 3 100;0;0 1.2304 True ENSG00000176058 ENSG00000176058 HGNC:26894 TRA2B gene TRA2B Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder, TRA2B-related, MONDO# 0700092 PMID: 36549593 False 3 100;0;0 1.2304 True ENSG00000136527 ENSG00000136527 HGNC:10781 TRAF3 gene TRAF3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {?Encephalopathy, acute, infection-induced (herpes-specific), susceptibility to, 5}, MIM# 614849 20832341;35960817 False 3 100;0;0 1.2304 True ENSG00000131323 ENSG00000131323 HGNC:12033 TRAF3IP1 gene TRAF3IP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Senior-Loken syndrome 9, MIM# 616629;MONDO:0014712 26487268;18364699;21945076 False 3 100;0;0 1.2304 True ENSG00000204104 ENSG00000204104 HGNC:17861 TRAF7 gene TRAF7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cardiac, facial, and digital anomalies with developmental delay, MIM# 618164 32376980 False 3 100;0;0 1.2304 True ENSG00000131653 ENSG00000131653 HGNC:20456 TRAIP gene TRAIP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Seckel syndrome 9, MIM# 616777 26595769 False 3 100;0;0 1.2304 True ENSG00000183763 ENSG00000183763 HGNC:30764 TRAK1 gene TRAK1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 68, MIM# 618201 28940097;28364549;29846532;28924745 False 3 100;0;0 1.2304 True ENSG00000182606 ENSG00000182606 HGNC:29947 TRAP1 gene TRAP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal CAKUT;VACTERL 24152966 False 3 100;0;0 1.2304 True ENSG00000126602 ENSG00000126602 HGNC:16264 TRAPPC10 gene TRAPPC10 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly, short stature, and speech delay, MIM# 620027 PMID: 35298461;30167849 False 3 100;0;0 1.2304 True ENSG00000160218 ENSG00000160218 HGNC:11868 TRAPPC11 gene TRAPPC11 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 18, MIM# 615356 23830518;26322222;29855340;30105108 False 3 100;0;0 1.2304 True ENSG00000168538 ENSG00000168538 HGNC:25751 TRAPPC12 gene TRAPPC12 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Encephalopathy, progressive, early-onset, with brain atrophy and spasticity, MIM# 617669 32369837;28777934 False 3 100;0;0 1.2304 True ENSG00000171853 ENSG00000171853 HGNC:24284 TRAPPC2 gene TRAPPC2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Spondyloepiphyseal dysplasia tarda, MIM# 313400 10431248;14755465;33726005;20301324;32953644 False 3 100;0;0 1.2304 True ENSG00000196459 ENSG00000196459 HGNC:23068 TRAPPC4 gene TRAPPC4 Expert Review;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with epilepsy, spasticity, and brain atrophy, MIM# 618741 31794024 False 3 100;0;0 1.2304 True ENSG00000196655 ENSG00000196655 HGNC:19943 TRAPPC6B gene TRAPPC6B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy, MIM# 617862 28626029;28397838;31687267 False 3 100;0;0 1.2304 True ENSG00000182400 ENSG00000182400 HGNC:23066 TRAPPC9 gene TRAPPC9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mental retardation, autosomal recessive 13, MIM# 613192 22549410;20004765;20004763;30853973;29187737 False 3 100;0;0 1.2304 True ENSG00000167632 ENSG00000167632 HGNC:30832 TRDN gene TRDN Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cardiac arrhythmia syndrome, with or without skeletal muscle weakness, MIM# 615441 31983240;25922419;30649896;22422768 False 3 100;0;0 1.2304 True ENSG00000186439 ENSG00000186439 HGNC:12261 TREM2 gene TREM2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2, MIM# 618193;{Alzhieimer disease 17, susceptibility to}, MIM# 615080 12080485;15883308 False 3 100;0;0 1.2304 True ENSG00000095970 ENSG00000095970 HGNC:17761 TREX1 gene TREX1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 1, dominant and recessive;Chilblain lupus;{Systemic lupus erythematosus, susceptibility to};Vasculopathy, retinal, with cerebral leukodystrophy 21937424 False 3 100;0;0 1.2304 True Other ENSG00000213689 ENSG00000213689 HGNC:12269 TRHR gene TRHR Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypothyroidism, congenital, nongoitrous, 7, MIM# 618573 9141550;19213692;26735259;28419241;32319661 False 3 100;0;0 1.2304 True ENSG00000174417 ENSG00000174417 HGNC:12299 TRIM2 gene TRIM2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, type 2R, MIM# 615490;MONDO:0014208 23562820;25893792;18687884;32815244;32205255;25893792 False 3 100;0;0 1.2304 True ENSG00000109654 ENSG00000109654 HGNC:15974 TRIM22 gene TRIM22 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Inflammatory bowel disease 26836588 False 3 100;0;0 1.2304 True ENSG00000132274 ENSG00000132274 HGNC:16379 TRIM32 gene TRIM32 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 11, MIM# 615988;Muscular dystrophy, limb-girdle, autosomal recessive 8 MIM#254110 16606853;31309175;11822024 False 3 50;0;50 1.2304 True ENSG00000119401 ENSG00000119401 HGNC:16380 TRIM37 gene TRIM37 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mulibrey nanism, MIM# 253250 10888877;12754710;15108285;14757854;27044324 False 3 100;0;0 1.2304 True ENSG00000108395 ENSG00000108395 HGNC:7523 TRIM63 gene TRIM63 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypertrophic cardiomyopathy, MONDO:0005045 30681346;32451364 False 3 100;0;0 1.2304 True ENSG00000158022 ENSG00000158022 HGNC:16007 TRIM71 gene TRIM71 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Hydrocephalus, congenital communicating, 1 618667" PMID: 29983323;32168371;30975633 False 3 100;0;0 1.2304 True ENSG00000206557 ENSG00000206557 HGNC:32669 TRIM8 gene TRIM8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Focal segmental glomerulosclerosis and neurodevelopmental syndrome, MIM# 619428;Intellectual disability;Seizures 30244534;27346735;23934111 False 3 100;0;0 1.2304 True ENSG00000171206 ENSG00000171206 HGNC:15579 TRIO gene TRIO Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 44, MIM# 617061 26721934;32109419 False 3 100;0;0 1.2304 True ENSG00000038382 ENSG00000038382 HGNC:12303 TRIOBP gene TRIOBP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Deafness, autosomal recessive 28, MIM# 609823 16385458;16385457;23226338;27014650;24853665;27344577;20510926 False 3 100;0;0 1.2304 True ENSG00000100106 ENSG00000100106 HGNC:17009 TRIP11 gene TRIP11 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Osteochondrodysplasia, 184260;Achondrogenesis, type IA, 200600 31903676;30728324 False 3 100;0;0 1.2304 True ENSG00000100815 ENSG00000100815 HGNC:12305 TRIP12 gene TRIP12 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation autosomal dominant 49, Clark-Baraitser Syndrome, MIM#617752 27848077;28251352 False 3 100;0;0 1.2304 True ENSG00000153827 ENSG00000153827 HGNC:12306 TRIP13 gene TRIP13 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mosaic variegated aneuploidy syndrome 3, MIM# 617598;Oocyte maturation defect 9, MIM# 619011 28553959;32473092 False 3 100;0;0 1.2304 True ENSG00000071539 ENSG00000071539 HGNC:12307 TRIP4 gene TRIP4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spinal muscular atrophy with congenital bone fractures 1, MIM# 616866;Muscular dystrophy, congenital, Davignon-Chauveau type 617066 26924529;31794073 False 3 100;0;0 1.2304 True ENSG00000103671 ENSG00000103671 HGNC:12310 TRIT1 gene TRIT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 35, MIM#617873 32088416;24901367;28185376;30977854 False 3 100;0;0 1.2304 True ENSG00000043514 ENSG00000043514 HGNC:20286 TRMT1 gene TRMT1 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal "Intellectual developmental disorder, autosomal recessive 68 MIM#618302" 30289604;26308914;21937992 False 3 100;0;0 1.2304 True ENSG00000104907 ENSG00000104907 HGNC:25980 TRMT10A gene TRMT10A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephaly, short stature, and impaired glucose metabolism 1, MIM# 616033;MONDO:0000208 24204302;25053765;33448213;33067246;26535115;26526202;26297882 False 3 100;0;0 1.2304 True ENSG00000145331 ENSG00000145331 HGNC:28403 TRMT10C gene TRMT10C Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 30, MIM# 616974 27132592;33886802 False 3 100;0;0 1.2304 True ENSG00000174173 ENSG00000174173 HGNC:26022 TRMT5 gene TRMT5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 26, MIM# 616539 26189817;35342985;35109800;29021354 False 3 100;0;0 1.2304 True ENSG00000126814 ENSG00000126814 HGNC:23141 TRMU gene TRMU Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Liver failure, transient infantile, MIM# 613070 19732863 False 3 100;0;0 1.2304 True ENSG00000100416 ENSG00000100416 HGNC:25481 TRNT1 gene TRNT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Retinitis pigmentosa and erythrocytic microcytosis, MIM# 616959;Sideroblastic anemia with B-cell immunodeficiency, periodic fevers, and developmental delay, MIM# 616084 25193871;23553769;29170023;27389523;26494905 False 3 100;0;0 1.2304 True ENSG00000072756 ENSG00000072756 HGNC:17341 TRPC6 gene TRPC6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Glomerulosclerosis, focal segmental, 2, MIM# 603965 15879175;15924139;34387384;33918778;32509715 False 3 100;0;0 1.2304 True ENSG00000137672 ENSG00000137672 HGNC:12338 TRPM1 gene TRPM1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Night blindness, congenital stationary (complete), 1C, autosomal recessive, MIM# 613216 19878917;19896113;19896109 False 3 100;0;0 1.2304 True ENSG00000134160 ENSG00000134160 HGNC:7146 TRPM3 gene TRPM3 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with hypotonia, dysmorphic facies, and skeletal anomalies, with or without seizures, MIM# 620224;Cataract 50 with or without glaucoma, MIM#620253 31278393;25090642;33484482 False 3 100;0;0 1.2304 True ENSG00000083067 ENSG00000083067 HGNC:17992 TRPM6 gene TRPM6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypomagnesaemia 1, intestinal (MIM#602014) False 3 100;0;0 1.2304 True ENSG00000119121 ENSG00000119121 HGNC:17995 TRPM7 gene TRPM7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Amyotrophic lateral sclerosis-parkinsonism/dementia complex, susceptibility to}, MIM# 105500;Cardiac arrhythmia, stillbirth 32503408;31423533;29874177 False 3 50;50;0 1.2304 True ENSG00000092439 ENSG00000092439 HGNC:17994 TRPS1 gene TRPS1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Trichorhinophalangeal syndrome, type I, OMIM # 190350;Trichorhinophalangeal syndrome, type III, OMIM # 190351 11112658;10615131 False 3 100;0;0 1.2304 True ENSG00000104447 ENSG00000104447 HGNC:12340 TRPV3 gene TRPV3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Olmsted syndrome, MIM# 614594 25285920;22405088;24452206 False 3 100;0;0 1.2304 True ENSG00000167723 ENSG00000167723 HGNC:18084 TRPV4 gene TRPV4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary motor and sensory neuropathy, type IIc, MIM# 606071;Neuronopathy, distal hereditary motor, type VIII, MIM# 600175 False 3 100;0;0 1.2304 True ENSG00000111199 ENSG00000111199 HGNC:18083 TRPV6 gene TRPV6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hyperparathyroidism, transient neonatal, MIM# 618188;Early onset chronic pancreatitis susceptibility 32383311;31930989;29861107 False 3 100;0;0 1.2304 True ENSG00000165125 ENSG00000165125 HGNC:14006 TRRAP gene TRRAP Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental delay with or without dysmorphic facies and autism (MIM#618454) 30827496;31231791 False 3 100;0;0 1.2304 True ENSG00000196367 ENSG00000196367 HGNC:12347 TSEN15 gene TSEN15 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 2F, MIM # 617026, MONDO:0014874 25558065;27392077 False 3 100;0;0 1.2304 True ENSG00000198860 ENSG00000198860 HGNC:16791 TSEN2 gene TSEN2 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia type 2B, MIM# 612389 23562994;20952379 False 3 50;0;50 1.2304 True ENSG00000154743 ENSG00000154743 HGNC:28422 TSEN54 gene TSEN54 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Pontocerebellar hypoplasia type 2A 277470;Pontocerebellar hypoplasia type 4 225753;Ataxia 24938831 False 3 50;0;50 1.2304 True ENSG00000182173 ENSG00000182173 HGNC:27561 TSFM gene TSFM Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 3, MIM# 610505 25037205;22499341 False 3 100;0;0 1.2304 True ENSG00000123297 ENSG00000123297 HGNC:12367 TSHB gene TSHB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypothyroidism, congenital, nongoitrous 4, MIM# 275100 1971148;12364478;2792087;34780050;31166470;35102753;29546359 False 3 100;0;0 1.2304 True ENSG00000134200 ENSG00000134200 HGNC:12372 TSHR gene TSHR Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hyperthyroidism, familial gestational, MIM # 603373, MONDO:0011309;Hyperthyroidism, nonautoimmune, MIM# 609152;Hypothyroidism, congenital, nongoitrous, 1, MIM# 275200, MONDO:0000045 7920658;7800007;8964822;9329388;9185526;9100579 False 3 100;0;0 1.2304 True ENSG00000165409 ENSG00000165409 HGNC:12373 TSHZ1 gene TSHZ1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Aural atresia, congenital, MIM# 607842;Hyposmia 15834955;22152683;17586487;24487590 False 3 100;0;0 1.2304 True ENSG00000179981 ENSG00000179981 HGNC:10669 TSPAN12 gene TSPAN12 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Exudative vitreoretinopathy 5, MIM# 613310 20159111;20159112;21334594 False 3 100;0;0 1.2304 True ENSG00000106025 ENSG00000106025 HGNC:21641 TSPEAR gene TSPEAR Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ectodermal dysplasia 14, hair/tooth type with or without hypohidrosis, MIM#618180;Selective tooth agenesis-10 (STHAG10), MIM#620173 27736875;30046887;32112661;34042254 False 3 100;0;0 1.2304 True ENSG00000175894 ENSG00000175894 HGNC:1268 TSPOAP1 gene TSPOAP1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Dystonia 22, MIM# 620453 33539324 False 3 100;0;0 1.2304 True ENSG00000005379 ENSG00000005379 HGNC:16831 TSPYL1 gene TSPYL1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Sudden infant death with dysgenesis of the testes syndrome (MIM#608800);sudden infant death-dysgenesis of the testes syndrome MONDO:0012124 15273283;19463995;22137496;25449952;16418600;32885560;33075815 False 3 50;50;0 1.2304 True ENSG00000189241 ENSG00000189241 HGNC:12382 TTBK2 gene TTBK2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 11, MIM# 604432, MONDO:0011464 18037885;31485862;20667868;27165044;20301723 False 3 50;50;0 1.2304 True ENSG00000128881 ENSG00000128881 HGNC:19141 TTC12 gene TTC12 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia 31978331 False 3 100;0;0 1.2304 True ENSG00000149292 ENSG00000149292 HGNC:23700 TTC19 gene TTC19 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex III deficiency, nuclear type 2, MIM#615157 21278747;23532514;24368687;24397319 False 3 100;0;0 1.2304 True ENSG00000011295 ENSG00000011295 HGNC:26006 TTC21B gene TTC21B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Nephronophthisis 12, MIM# 613820;Short-rib thoracic dysplasia 4 with or without polydactyly, MIM# 613819;Joubert syndrome;Glomerular disorder MONDO:0019722, TTC21B-related 21258341;25492405;18327258;33875766 False 3 67;0;33 1.2304 True ENSG00000123607 ENSG00000123607 HGNC:25660 TTC25 gene TTC25 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 35 (MIM#617092) 27486780;31765523;33715250;33746037;34215651 False 3 50;50;0 1.2304 True ENSG00000204815 ENSG00000204815 HGNC:25280 TTC26 gene TTC26 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Biliary, renal, neurologic, and skeletal syndrome, MIM# 619534;Ciliopathy Syndrome with Biliary, Renal, Neurological, and Skeletal Manifestations 34177428;32617964;31595528;24596149;22718903 False 3 100;0;0 1.2304 True ENSG00000105948 ENSG00000105948 HGNC:21882 TTC37 gene TTC37 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Trichohepatoenteric syndrome 1, MIM# 222470 20176027;17318842 False 3 100;0;0 1.2304 True ENSG00000198677 ENSG00000198677 HGNC:23639 TTC5 gene TTC5 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with cerebral atrophy and variable facial dysmorphism , MIM#619244;Central hypotonia;Global developmental delay;Intellectual disability;Abnormality of nervous system morphology;Microcephaly;Abnormality of the face;Behavioral abnormality;Abnormality of the genitourinary system 29302074;32439809 False 3 100;0;0 1.2304 True ENSG00000136319 ENSG00000136319 HGNC:19274 TTC7A gene TTC7A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Gastrointestinal defects and immunodeficiency syndrome, 243150;Very Early Onset Inflammatory Bowel Disease (VEOIBD) 30553809;28936210;24417819;24292712;23830146;29174094;31743734 False 3 100;0;0 1.2304 True ENSG00000068724 ENSG00000068724 HGNC:19750 TTC8 gene TTC8 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 8, MIM# 615985 14520415;19797195 False 3 50;0;50 1.2304 True ENSG00000165533 ENSG00000165533 HGNC:20087 TTI1 gene TTI1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal "Neurodevelopmental disorder with microcephaly and movement abnormalities, MIM# 620445" 26539891;30315573 False 3 33;33;33 1.2304 True ENSG00000101407 ENSG00000101407 HGNC:29029 TTI2 gene TTI2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mental retardation, autosomal recessive 39, MIM#615541 32061250;23956177;31737043 False 3 100;0;0 1.2304 True ENSG00000129696 ENSG00000129696 HGNC:26262 TTLL5 gene TTLL5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cone-rod dystrophy 19, MIM# 615860, MONDO:0014372 24791901;34203883;28356705 False 3 100;0;0 1.2304 True ENSG00000119685 ENSG00000119685 HGNC:19963 TTPA gene TTPA Expert list;Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ataxia with isolated vitamin E deficiency, MIM# 277460 27604308;7719340 False 3 100;0;0 1.2304 True ENSG00000137561 ENSG00000137561 HGNC:12404 TTR gene TTR Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyloidosis, hereditary, transthyretin-related, MIM #105210;Carpal tunnel syndrome, familial, MIM# 115430 1570831;1626570;16115295;16194874;26537620 False 3 100;0;0 1.2304 True ENSG00000118271 ENSG00000118271 HGNC:12405 TUBA1A gene TUBA1A Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Lissencephaly 3, MIM# 611603;Congenital fibrosis of the extraocular muscles, AD 30677308;21403111 False 3 67;0;33 1.2304 True ENSG00000167552 ENSG00000167552 HGNC:20766 TUBA4A gene TUBA4A Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Congenital myopathy MONDO:0019952 PMID: 38413182 False 3 50;50;0 1.2304 True ENSG00000127824 ENSG00000127824 HGNC:12407 TUBB gene TUBB Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cortical dysplasia, complex, with other brain malformations 6, MIM# 615771 23246003;32085672 False 3 100;0;0 1.2304 True ENSG00000196230 ENSG00000196230 HGNC:20778 TUBB1 gene TUBB1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Macrothrombocytopenia, autosomal dominant, TUBB1-related, OMIM #613112;MONDO:0013141 32757236;31565851;29333906;18849486 False 3 100;0;0 1.2304 True ENSG00000101162 ENSG00000101162 HGNC:16257 TUBB2A gene TUBB2A Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cortical dysplasia, complex, with other brain malformations 5 MIM#615763 32571897;29547997;32203252 False 3 50;0;50 1.2304 True ENSG00000137267 ENSG00000137267 HGNC:12412 TUBB2B gene TUBB2B Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cortical dysplasia, complex, with other brain malformations 7, MIM# 610031 19465910;22333901;26732629;33082561 False 3 100;0;0 1.2304 True ENSG00000137285 ENSG00000137285 HGNC:30829 TUBB3 gene TUBB3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cortical dysplasia, complex, with other brain malformations 1, MIM# 614039;Fibrosis of extraocular muscles, congenital, 3A, MIM# 600638 20829227;25059107;33318778;20074521 False 3 100;0;0 1.2304 True ENSG00000258947 ENSG00000258947 HGNC:20772 TUBB4A gene TUBB4A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia 4, torsion, autosomal dominant, OMIM #128101;Leukodystrophy, hypomyelinating, 6, OMIM # 612438 24850488;23582646;23424103;23595291;33084096;32943487 False 3 100;0;0 1.2304 True ENSG00000104833 ENSG00000104833 HGNC:20774 TUBB4B gene TUBB4B Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Leber congenital amaurosis with early onset deafness, LCAEOD, OMIM #617879;MONDO:0060650;Primary ciliary dyskinesia, MONDO:0016575, TUBB4B-related 29198720;35240325 False 3 100;0;0 1.2304 True ENSG00000188229 ENSG00000188229 HGNC:20771 TUBB8 gene TUBB8 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Oocyte maturation defect 2, MIM# 616780 26789871;27273344 False 3 100;0;0 1.2304 True ENSG00000173876 ENSG00000261456 HGNC:20773 TUBG1 gene TUBG1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cortical dysplasia, complex, with other brain malformations 4, MIM# 615412 23603762;31086189 False 3 100;0;0 1.2304 True ENSG00000131462 ENSG00000131462 HGNC:12417 TUBGCP2 gene TUBGCP2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Pachygyria, microcephaly, developmental delay, and dysmorphic facies, with or without seizures, OMIM # 618737;Lissencephaly;pachygyria;subcortical band heterotopia;microcephaly;intellectual disability 31630790 False 3 100;0;0 1.2304 True ENSG00000130640 ENSG00000130640 HGNC:18599 TUBGCP4 gene TUBGCP4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephaly and chorioretinopathy, autosomal recessive, 3, MIM# 616335 25817018;32270730 False 3 100;0;0 1.2304 True ENSG00000137822 ENSG00000137822 HGNC:16691 TUBGCP6 gene TUBGCP6 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephaly and chorioretinopathy, autosomal recessive, 1, MIM#251270 25344692;22279524 False 3 100;0;0 1.2304 True ENSG00000128159 ENSG00000128159 HGNC:18127 TUFM gene TUFM Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 4, OMIM #610678;MONDO:0012534 28132884;26741492;17160893;30903008 False 3 50;0;50 1.2304 True ENSG00000178952 ENSG00000178952 HGNC:12420 TULP1 gene TULP1 Expert Review;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Retinitis pigmentosa 14 M(MIM#600132);Leber congenital amaurosis 15, MIM# 613843 17620573;27440997;21987678;15557452;15024725 False 3 100;0;0 1.2304 True ENSG00000112041 ENSG00000112041 HGNC:12423 TULP3 gene TULP3 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Hepatorenocardiac degenerative fibrosis, MIM# 619902 PMID: 35397207 False 3 100;0;0 1.2304 True ENSG00000078246 ENSG00000078246 HGNC:12425 TUSC3 gene TUSC3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mental retardation, autosomal recessive 7, MIM# 611093, MONDO:0012615;TUSC3-CDG (Disorders of protein N-glycosylation) 18452889;18455129;21739581;27148795;31606977 False 3 100;0;0 1.2304 True ENSG00000104723 ENSG00000104723 HGNC:30242 TWIST1 gene TWIST1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Craniosynostosis 1, MIM# 123100;Saethre-Chotzen syndrome with or without eyelid anomalies, MIM# 101400;Sweeny-Cox syndrome, MIM# 617746;Robinow-Sorauf syndrome, MIM# 180750 17343269;9585583;12116251;31299755;30040876 False 3 100;0;0 1.2304 True ENSG00000122691 ENSG00000122691 HGNC:12428 TWIST2 gene TWIST2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Ablepharon-macrostomia syndrome, MIM# 200110;Barber-Say syndrome, MIM# 209885;Focal facial dermal dysplasia 3, Setleis type, MIM# 227260 26119818;20691403;21931173;26119818 False 3 100;0;0 1.2304 True ENSG00000233608 ENSG00000233608 HGNC:20670 TWNK gene TWNK Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 7 (hepatocerebral type) 271245;Perrault syndrome 5 616138;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 609286 32234020;18593709 False 3 100;0;0 1.2304 True Other ENSG00000107815 ENSG00000107815 HGNC:1160 TXNDC15 gene TXNDC15 Expert Review;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Meckel syndrome 14, MIM# 619879 30851085;27894351 False 3 100;0;0 1.2304 True ENSG00000113621 ENSG00000113621 HGNC:20652 TXNL4A gene TXNL4A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Burn-McKeown syndrome, MIM# 608572;Choanal atresia - deafness - cardiac defects - dysmorphism syndrome, MONDO:0012064 25434003 False 3 100;0;0 1.2304 True ENSG00000141759 ENSG00000141759 HGNC:30551 TYK2 gene TYK2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 35, MIM# 611521 17088085;17521577;26304966 False 3 100;0;0 1.2304 True ENSG00000105397 ENSG00000105397 HGNC:12440 TYMP gene TYMP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 1 (MNGIE type), MIM# 603041;MNGIE: ptosis, ophthalmoplegia & ophthalmoparesis, hearing loss, neuropathy 9924029;14757860 False 3 100;0;0 1.2304 True ENSG00000025708 ENSG00000025708 HGNC:3148 TYR gene TYR Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Albinism, oculocutaneous, type IA, MIM# 203100;MONDO:0008745;Albinism, oculocutaneous, type IB, MIM# 606952 False 3 100;0;0 1.2304 True ENSG00000077498 ENSG00000077498 HGNC:12442 TYROBP gene TYROBP Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 1, MIM# 221770 10888890;12370476;27904822 False 3 100;0;0 1.2304 True ENSG00000011600 ENSG00000011600 HGNC:12449 TYRP1 gene TYRP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Albinism, oculocutaneous, type III, MIM# 203290;MONDO:0008747 9345097 False 3 100;0;0 1.2304 True ENSG00000107165 ENSG00000107165 HGNC:12450 U2AF2 gene U2AF2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Developmental delay, dysmorphic facies, and brain anomalies, MIM# 620535" 34112922;37092751;36747105;37134193 False 3 50;50;0 1.2304 True ENSG00000063244 ENSG00000063244 HGNC:23156 UBA1 gene UBA1 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Spinal muscular atrophy, X-linked 2, infantile, MIM# 301830;Autoinflammatory disease, adult onset: VEXAS syndrome (vacuoles, E1 enzyme, X-linked, autoinflammatory, somatic) #301054 33690815;18179898;32181232;31932168;29034082;27699224;26028276;23518311;33108101 False 3 100;0;0 1.2304 True ENSG00000130985 ENSG00000130985 HGNC:12469 UBA2 gene UBA2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown ACCES syndrome, MIM# 619959;Split-Hand/Foot Malformation;Aplasia Cutis Congenita;Ectrodactyly 31332306;31587267;34159400 False 3 67;33;0 1.2304 True ENSG00000126261 ENSG00000126261 HGNC:30661 UBA5 gene UBA5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 24, MIM# 617133;Epileptic encephalopathy, early infantile, 44 617132;Hypomyelinating neuropathy 26872069;27545681;27545674;32179706;26872069 False 3 100;0;0 1.2304 True ENSG00000081307 ENSG00000081307 HGNC:23230 UBAP1 gene UBAP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Childhood-onset hereditary spastic paraplegia;Spastic paraplegia 80, autosomal dominant 618418 31203368;31696996;32934340 False 3 100;0;0 1.2304 True ENSG00000165006 ENSG00000165006 HGNC:12461 UBAP1L gene UBAP1L Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Cone-rod dystrophy (MONDO:0015993), UBAP1L-related PMID: 38293907;38420906 False 3 100;0;0 1.2304 True ENSG00000246922 ENSG00000246922 HGNC:40028 UBAP2L gene UBAP2L Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with impaired language, behavioral abnormalities, and dysmorphic facies, MIM# 620494 35977029 False 3 100;0;0 1.2304 True ENSG00000143569 ENSG00000143569 HGNC:29877 UBE2A gene UBE2A Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Mental retardation, X-linked syndromic, Nascimento-type (MIM#300860) 24053514;16909393 False 3 100;0;0 1.2304 True ENSG00000077721 ENSG00000077721 HGNC:12472 UBE2T gene UBE2T Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Fanconi anemia, complementation group T, MIM# 616435 26046368 False 3 100;0;0 1.2304 True ENSG00000077152 ENSG00000077152 HGNC:25009 UBE3A gene UBE3A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed) Angelman syndrome, MIM#105830 False 3 50;50;0 1.2304 True ENSG00000114062 ENSG00000114062 HGNC:12496 UBE3B gene UBE3B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Kaufman oculocerebrofacial syndrome, MIM# 244450;MONDO:0009485 23200864;23200864;34012380;32949109 False 3 50;50;0 1.2304 True ENSG00000151148 ENSG00000151148 HGNC:13478 UBE3C gene UBE3C Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with absent speech and movement and behavioral abnormalities, MIM# 620270 PMID: 36401616 False 3 100;0;0 1.2304 True ENSG00000009335 ENSG00000009335 HGNC:16803 UBE4A gene UBE4A Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with hypotonia and gross motor and seech delay, MIM# 619639 33420346 False 3 100;0;0 1.2304 True ENSG00000110344 ENSG00000110344 HGNC:12499 UBIAD1 gene UBIAD1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Corneal dystrophy, Schnyder type, MIM# 121800 18176953;23169578;31323021;30785396;30223810 False 3 100;0;0 1.2304 True ENSG00000120942 ENSG00000120942 HGNC:30791 UBR1 gene UBR1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Johanson-Blizzard syndrome (MIM#243800) 24599544 False 3 100;0;0 1.2304 True ENSG00000159459 ENSG00000159459 HGNC:16808 UBR5 gene UBR5 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder MONDO:0700092, UBR5-related 39721588 False 3 100;0;0 1.2304 True ENSG00000104517 ENSG00000104517 HGNC:16806 UBR7 gene UBR7 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Li-Campeau syndrome, MIM# 619189;Intellectual disability;epilepsy;hypothyroidism;congenital anomalies;dysmorphic features 33340455 False 3 100;0;0 1.2304 True ENSG00000012963 ENSG00000012963 HGNC:20344 UBTF gene UBTF Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672;MONDO:0044701;Neurodevelopmental disorder, MONDO:0700092, UBTF-related 28777933;29300972;39366741 False 3 100;0;0 1.2304 True ENSG00000108312 ENSG00000108312 HGNC:12511 UCHL1 gene UCHL1 Expert Review Green;Other Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Spastic paraplegia 79A, autosomal dominant, MIM# 620221;Spastic paraplegia 79, autosomal recessive, 615491;MONDO:0014209;Neurodegenerative disease, MONDO:0005559, UCHL1-related 23359680;3340629;28007905;32656641;29735986;28007905;35986737;39030458 False 3 100;0;0 1.2304 True ENSG00000154277 ENSG00000154277 HGNC:12513 UFC1 gene UFC1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with spasticity and poor growth (MIM#618076) 29868776;30552426 False 3 100;0;0 1.2304 True ENSG00000143222 ENSG00000143222 HGNC:26941 UFM1 gene UFM1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 14, MIM# 617899 28931644;29868776 False 3 100;0;0 1.2304 True ENSG00000120686 ENSG00000120686 HGNC:20597 UFSP2 gene UFSP2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Developmental and epileptic encephalopathy 106, MIM# 620028;Hip dysplasia, Beukes type, MIM#142669;Spondyloepimetaphyseal dysplasia, Di Rocco type, MIM# 617974" 33473208;26428751;28892125;32755715;37214758 False 3 100;0;0 1.2304 True ENSG00000109775 ENSG00000109775 HGNC:25640 UGDH gene UGDH Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Epileptic encephalopathy, early infantile, 84 - MIM #618792 32001716 False 3 100;0;0 1.2304 True ENSG00000109814 ENSG00000109814 HGNC:12525 UGP2 gene UGP2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Epileptic encephalopathy;intellectual disability;microcephaly 31820119 False 3 100;0;0 1.2304 True ENSG00000169764 ENSG00000169764 HGNC:12527 UGT1A1 gene UGT1A1 Expert Review;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bilirubin UDP-glucuronosyltransferase 1 deficiency (Disorders of bile acid metabolism and transport);Crigler-Najjar syndrome, type I 218800;Crigler-Najjar syndrome, type II 606785 False 3 100;0;0 1.2304 True ENSG00000241635 ENSG00000241635 HGNC:12530 UMOD gene UMOD Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Glomerulocystic kidney disease with hyperuricemia and isosthenuria 609886;Hyperuricemic nephropathy, familial juvenile 1 162000;Medullary cystic kidney disease 2 603860 False 3 67;0;33 1.2304 True ENSG00000169344 ENSG00000169344 HGNC:12559 UMPS gene UMPS Expert Review;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Orotic aciduria, MIM# 258900 9042911;33489760 False 3 100;0;0 1.2304 True ENSG00000114491 ENSG00000114491 HGNC:12563 UNC13A gene UNC13A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Congenital myasthenia;dyskinesia;autism;developmental delay;neurodevelopmental disorder MONDO#0700092, UNC13A-related 27648472;28192369 False 3 50;0;50 1.2304 True ENSG00000130477 ENSG00000130477 HGNC:23150 UNC13D gene UNC13D Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Haemophagocytic lymphohistiocytosis, familial, 3 MIM#608898 14622600;16825436;17993578 False 3 100;0;0 1.2304 True ENSG00000092929 ENSG00000092929 HGNC:23147 UNC45A gene UNC45A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Osteootohepatoenteric syndrome, MIM# 619377;Cholestasis;Diarrhoea;Bone fragility;Impaired hearing 29429573 False 3 100;0;0 1.2304 True ENSG00000140553 ENSG00000140553 HGNC:30594 UNC45B gene UNC45B Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Myofibrillar myopathy 11, MIM# 619178;Progressive Myopathy with Eccentric Cores 33217308 False 3 100;0;0 1.2304 True ENSG00000141161 ENSG00000141161 HGNC:14304 UNC79 gene UNC79 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder (MONDO:0700092), UNC79-related PMID:37183800 False 3 0;100;0 1.2304 True ENSG00000133958 ENSG00000133958 HGNC:19966 UNC80 gene UNC80 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Hypotonia, infantile, with psychomotor retardation and characteristic facies 2, MIM# 616801;MONDO:0014777 26708751;26708753;26545877;32620897;30167850;30167850 False 3 100;0;0 1.2304 True ENSG00000144406 ENSG00000144406 HGNC:26582 UNC93B1 gene UNC93B1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Encephalopathy, acute, infection-induced (herpes-specific), susceptibility to, 1, MIM#610551;Autoinflammatory syndrome, MONDO:0019751, UNC93B1-related 16973841;29768176;38869500 False 3 50;0;50 1.2304 True ENSG00000110057 ENSG00000110057 HGNC:13481 UNG gene UNG Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency with hyper IgM, type 5, MIM#608106 12958596 False 3 100;0;0 1.2304 True ENSG00000076248 ENSG00000076248 HGNC:12572 UPB1 gene UPB1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Beta-ureidopropionase deficiency, MIM# 613161 27604308;24526388;25638458;22525402;15385443;17964839 False 3 100;0;0 1.2304 True ENSG00000100024 ENSG00000100024 HGNC:16297 UPF3B gene UPF3B Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Mental retardation, X-linked, syndromic 14, MIM# 300676 19377476;17704778;31737052;28948974;32667670 False 3 100;0;0 1.2304 True ENSG00000125351 ENSG00000125351 HGNC:20439 UQCC2 gene UQCC2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex III deficiency, nuclear type 7 - MIM#615824 24385928;28804536 False 3 100;0;0 1.2304 True ENSG00000137288 ENSG00000137288 HGNC:21237 UQCRB gene UQCRB Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex III deficiency, nuclear type 3, MIM# 615158 23281071;28275242;12709789;25446085;23454382 False 3 100;0;0 1.2304 True ENSG00000156467 ENSG00000156467 HGNC:12582 UQCRC2 gene UQCRC2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex III deficiency, nuclear type 5, MIM# 615160 28275242;23281071;33865955 False 3 100;0;0 1.2304 True ENSG00000140740 ENSG00000140740 HGNC:12586 UQCRFS1 gene UQCRFS1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Mitochondrial Complex III deficiency;lactic acidosis;fetal bradycardia;hypertrophic cardiomyopathy;alopecia totalis 31883641 False 3 100;0;0 1.2304 True ENSG00000169021 ENSG00000169021 HGNC:12587 UROD gene UROD Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Porphyria cutanea tarda;Porphyria, hepatoerythropoietic (MIM#176100) 23545314;30514647;9792863 False 3 100;0;0 1.2304 True ENSG00000126088 ENSG00000126088 HGNC:12591 UROS gene UROS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Porphyria, congenital erythropoietic (MIM#263700) 28334762;27512208;34187847;34828434;15065102 False 3 100;0;0 1.2304 True ENSG00000188690 ENSG00000188690 HGNC:12592 USB1 gene USB1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Poikiloderma with neutropaenia, MIM# 604173;MONDO:0011405 25044170;27612988;20004881;20503306;34004352;33624217;33111394;32936385;32620997;31522452 False 3 100;0;0 1.2304 True ENSG00000103005 ENSG00000103005 HGNC:25792 USH1C gene USH1C Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Usher syndrome, type 1C, MIM# 276904;Deafness, autosomal recessive 18A, MIM# 602092 31858762;10973247;10973248;11239869;21203349;12107438 False 3 100;0;0 1.2304 True ENSG00000006611 ENSG00000006611 HGNC:12597 USH1G gene USH1G Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Usher syndrome, type 1G, MIM# 606943 12588794;21044053 False 3 100;0;0 1.2304 True ENSG00000182040 ENSG00000182040 HGNC:16356 USH2A gene USH2A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Usher syndrome, type 2A, MIM# 276901;Retinitis pigmentosa 39, MIM#613809 12427073;20507924;17296898;19881469;18273898 False 3 100;0;0 1.2304 True ENSG00000042781 ENSG00000042781 HGNC:12601 USP14 gene USP14 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Syndromic disease MONDO:0002254, USP14-related 38469793;35066879 False 3 100;0;0 1.2304 True ENSG00000101557 ENSG00000101557 HGNC:12612 USP18 gene USP18 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pseudo-TORCH syndrome 2 MIM#617397 31940699, 12833411, 27325888 False 3 100;0;0 1.2304 True ENSG00000184979 ENSG00000184979 HGNC:12616 USP25 gene USP25 Expert Review Green;Other Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Epilepsy, idiopathic generalized, susceptibility to, 19} MIM#621064 38875478 False 3 100;0;0 1.2304 True Other ENSG00000155313 ENSG00000155313 HGNC:12624 USP27X gene USP27X Expert list;Expert Review Green Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Intellectual disability, X-linked 105, MIM#300984 25644381;38182161 False 3 100;0;0 1.2304 True ENSG00000242013 ENSG00000273820 HGNC:13486 USP45 gene USP45 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Leber congenital amaurosis;retinal dystrophy 30573563 False 3 100;0;0 1.2304 True ENSG00000123552 ENSG00000123552 HGNC:20080 USP48 gene USP48 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Deafness, autosomal dominant 85, MIM# 620227 34059922 False 3 100;0;0 1.2304 True ENSG00000090686 ENSG00000090686 HGNC:18533 USP53 gene USP53 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "Cholestasis, progressive familial intrahepatic, 7, with or without hearing loss, MIM# 619658" 30250217;32124521;33075013 False 3 50;0;50 1.2304 True ENSG00000145390 ENSG00000145390 HGNC:29255 USP7 gene USP7 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hao-Fountain syndrome, MIM# 616863;MONDO:0014805;Intellectual disability;Autism 26365382;30679821 False 3 100;0;0 1.2304 True ENSG00000187555 ENSG00000187555 HGNC:12630 USP8 gene USP8 Expert list;Expert Review Green Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Pituitary adenoma 4, ACTH-secreting, somatic MIM#219090;hereditary spastic paraplegia 25675982;24482476;25485838;25942478 False 3 100;0;0 1.2304 True ENSG00000138592 ENSG00000138592 HGNC:12631 USP9X gene USP9X Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Intellectual developmental disorder 99 MIM#300919;syndromic, female-restricted Intellectual developmental disorder 99 MIM#300968 31443933;26833328 False 3 100;0;0 1.2304 True ENSG00000124486 ENSG00000124486 HGNC:12632 UVSSA gene UVSSA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal UV-sensitive syndrome 3 (MIM#614640) 31421932 False 3 100;0;0 1.2304 True ENSG00000163945 ENSG00000163945 HGNC:29304 VAC14 gene VAC14 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Striatonigral degeneration, childhood-onset, MIM#617054 27292112;31392254;31591492;31387860;31876398 False 3 100;0;0 1.2304 True ENSG00000103043 ENSG00000103043 HGNC:25507 VAMP1 gene VAMP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 25, MIM# 618323;Spastic ataxia 1, autosomal dominant, MIM# 108600 28168212;28253535;28600779;17102983;22958904 False 3 100;0;0 1.2304 True ENSG00000139190 ENSG00000139190 HGNC:12642 VAMP2 gene VAMP2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Neurodevelopmental disorder with hypotonia and autistic features with or without hyperkinetic movements 618760;Intellectual disability;Autism" 30929742 False 3 100;0;0 1.2304 True ENSG00000220205 ENSG00000220205 HGNC:12643 VARS gene VARS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly, seizures, and cortical atrophy;OMIM #617802 30755616;30755602;26539891;29691655;30275004 False 3 100;0;0 1.2304 True ENSG00000204394 ENSG00000204394 HGNC:12651 VARS2 gene VARS2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 20;OMIM #615917 24827421;25058219;29137650;29314548;31064326;31623496 False 3 100;0;0 1.2304 True ENSG00000137411 ENSG00000137411 HGNC:21642 VCAN gene VCAN Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Wagner syndrome 1, MIM# 143200 16877430;22739342;16636652;16043844;32854301;30657523;30055036;29071374;27667122 False 3 100;0;0 1.2304 True ENSG00000038427 ENSG00000038427 HGNC:2464 VCL gene VCL Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cardiomyopathy, dilated, 1W, MIM# 611407 31983221;32516855;26406308;26458567;24062880;11815424;17785437;17097056 False 3 100;0;0 1.2304 True ENSG00000035403 ENSG00000035403 HGNC:12665 VDR gene VDR Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Rickets, vitamin D-resistant, type IIA, MIM# 277440 2849209;9005998;17970811 False 3 100;0;0 1.2304 True ENSG00000111424 ENSG00000111424 HGNC:12679 VEGFC gene VEGFC Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Lymphatic malformation 4, MIM#615907 23410910;24744435;30071673 False 3 100;0;0 1.2304 True ENSG00000150630 ENSG00000150630 HGNC:12682 VGLL2 gene VGLL2 Expert Review Green;Other Mendeliome BIALLELIC, autosomal or pseudoautosomal Syngnathia, MONDO:0015409, VGLL2-related False 3 100;0;0 1.2304 True ENSG00000170162 ENSG00000170162 HGNC:20232 VIM gene VIM Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cataract 30, pulverulent 116300;frontonasal dysostosis and premature aging 19126778;26694549;28450710;32066935 False 3 50;0;50 1.2304 True ENSG00000026025 ENSG00000026025 HGNC:12692 VIPAS39 gene VIPAS39 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Arthrogryposis, renal dysfunction, and cholestasis 2, MIM#613404 20190753;35151346 False 3 100;0;0 1.2304 True ENSG00000151445 ENSG00000151445 HGNC:20347 VKORC1 gene VKORC1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Vitamin K-dependent clotting factors, combined deficiency of, 2, MIM# 607473;Warfarin resistance, MIM# 122700 14765194;21900891;28198005 False 3 100;0;0 1.2304 True ENSG00000167397 ENSG00000167397 HGNC:23663 VLDLR gene VLDLR Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cerebellar hypoplasia and mental retardation with or without quadrupedal locomotion 1, MIM# 224050 16080122;18326629;10380922 False 3 100;0;0 1.2304 True ENSG00000147852 ENSG00000147852 HGNC:12698 VMA21 gene VMA21 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Myopathy, X-linked, with excessive autophagy, MIM# 310440 27916343;25809233;23315026 False 3 100;0;0 1.2304 True ENSG00000160131 ENSG00000160131 HGNC:22082 VPS11 gene VPS11 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 12, MIM# 616683 27120463;26307567;27473128 False 3 100;0;0 1.2304 True ENSG00000160695 ENSG00000160695 HGNC:14583 VPS13B gene VPS13B Expert Review;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cohen syndrome, MIM# 216550 False 3 50;50;0 1.2304 True ENSG00000132549 ENSG00000132549 HGNC:2183 VPS13C gene VPS13C Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Early-onset Parkinson disease-23, MIM# 616840 26942284;30452786;28862745 False 3 100;0;0 1.2304 True ENSG00000129003 ENSG00000129003 HGNC:23594 VPS13D gene VPS13D Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 4, MIM# 607317 29604224;29518281 False 3 100;0;0 1.2304 True ENSG00000048707 ENSG00000048707 HGNC:23595 VPS16 gene VPS16 Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Dystonia 30, MIM#619291;mucopolysaccharidosis-like disorder, VPS16-related MONDO#0100365 32808683;33938619;34013567;34901436 False 3 100;0;0 1.2304 True ENSG00000215305 ENSG00000215305 HGNC:14584 VPS33A gene VPS33A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mucopolysaccharidosis-plus syndrome (MIM#617303) 28013294;27547915;31936524;36153662 False 3 50;50;0 1.2304 True ENSG00000139719 ENSG00000139719 HGNC:18179 VPS33B gene VPS33B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Arthrogryposis, renal dysfunction, and cholestasis 1 (MIM#208085) 31240160;31777725;24415890;15052268 False 3 100;0;0 1.2304 True ENSG00000184056 ENSG00000184056 HGNC:12712 VPS35 gene VPS35 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Parkinson disease 17, MIM# 614203 21763482;21763483;22801713;34704029 False 3 100;0;0 1.2304 True ENSG00000069329 ENSG00000069329 HGNC:13487 VPS41 gene VPS41 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia-29 (SCAR29), MIM#619389;Progressive neurodevelopmental disorder with ataxia, hypotonia, dystonia, intellectual disability and speech delay 32808683;33764426 False 3 50;0;50 1.2304 True ENSG00000006715 ENSG00000006715 HGNC:12713 VPS45 gene VPS45 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neutropaenia, severe congenital, 5, autosomal recessive, MIM# 615285 23738510;23599270;33623350;32037586;30294941 False 3 100;0;0 1.2304 True ENSG00000136631 ENSG00000136631 HGNC:14579 VPS4A gene VPS4A Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted CIMDAG syndrome MIM# 619273 PMID: 33186543;33186545 False 3 100;0;0 1.2304 True Other ENSG00000132612 ENSG00000132612 HGNC:13488 VPS50 gene VPS50 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly, seizures, and neonatal cholestasis , MIM#619685;Neonatal cholestatic liver disease;Failure to thrive;Profound global developmental delay;Postnatal microcephaly;Seizures;Abnormality of the corpus callosum 34037727 False 3 50;50;0 1.2304 True ENSG00000004766 ENSG00000004766 HGNC:25956 VPS53 gene VPS53 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 2E, OMIM #615851 24577744;12920088 False 3 100;0;0 1.2304 True ENSG00000141252 ENSG00000141252 HGNC:25608 VRK1 gene VRK1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia type 1A, MIM# 607596;Adult-onset spinal muscular atrophy without pontocerebellar hypoplasia;Neuronopathy, distal hereditary motor, autosomal recessive 10, MIM# 620542 19646678;21937992;25609612;24126608;27281532;34169149;26583493 False 3 100;0;0 1.2304 True ENSG00000100749 ENSG00000100749 HGNC:12718 VSX2 gene VSX2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microphthalmia with coloboma 3, MIM# 610092;Microphthalmia, isolated 2, MIM# 610093 15257456;17661825;31884615;28121235;27301076;24033328 False 3 100;0;0 1.2304 True ENSG00000119614 ENSG00000119614 HGNC:1975 VWA1 gene VWA1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Hereditary motor neuropathy 33459760;33693694;33559681 False 3 100;0;0 1.2304 True ENSG00000179403 ENSG00000179403 HGNC:30910 VWF gene VWF Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal von Willebrand disease, type 1, MIM# 193400;von Willebrand disease, type 3 , MIM#277480;von Willebrand disease, types 2A, 2B, 2M, and 2N, MIM# 613554 False 3 100;0;0 1.2304 True ENSG00000110799 ENSG00000110799 HGNC:12726 WAC gene WAC Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Desanto-Shinawi syndrome, MIM# 616708 26264232;25356899;35266333 False 3 100;0;0 1.2304 True ENSG00000095787 ENSG00000095787 HGNC:17327 WARS gene WARS Expert Review Green;Literature Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Neuronopathy, distal hereditary motor, type IX (OMIM:617721);juvenile to adult onset (15-23 years);Neurodevelopmental disorder withmicrocephaly and speech delay, with or without brain abnormalities, MIM# 620317" 28369220;31321409;31069783;35815345;35790048 False 3 100;0;0 1.2304 True ENSG00000140105 ENSG00000140105 HGNC:12729 WARS2 gene WARS2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Parkinsonism-dystonia 3, childhood-onset, MIM# 619738;Neurodevelopmental disorder, mitochondrial, with abnormal movements and lactic acidosis, with or without seizures, MIM# 617710 29120065;31970218;34890876;28236339;28650581;28905505;30920170 False 3 100;0;0 1.2304 True ENSG00000116874 ENSG00000116874 HGNC:12730 WAS gene WAS Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Wiskott-Aldrich syndrome, MIM# 301000;Thrombocytopaenia, X-linked, MIM# 313900;Neutropenia, severe congenital, X-linked , MIM#300299 30969660;34307257;20301357 False 3 100;0;0 1.2304 True ENSG00000015285 ENSG00000015285 HGNC:12731 WASF1 gene WASF1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with absent language and variable seizures , MIM#618707 29961568;34845217;34478686;34356165 False 3 100;0;0 1.2304 True ENSG00000112290 ENSG00000112290 HGNC:12732 WASHC4 gene WASHC4 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "Intellectual developmental disorder, autosomal recessive 43 MIM#615817" 31953988;21498477 False 3 100;0;0 1.2304 True ENSG00000136051 ENSG00000136051 HGNC:29174 WASHC5 gene WASHC5 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ritscher-Schinzel syndrome 1, MIM# 220210;Spastic paraplegia 8, autosomal dominant, MIM# 603563 17160902;23455931;30778698;24065355;33456446 False 3 100;0;0 1.2304 True ENSG00000164961 ENSG00000164961 HGNC:28984 WBP11 gene WBP11 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Vertebral, cardiac, tracheoesophageal, renal, and limb defects, MIM# 619227;malformation syndrome affecting the cardiac, skeletal, gastrointestinal and renal systems 33276377 False 3 100;0;0 1.2304 True ENSG00000084463 ENSG00000084463 HGNC:16461 WBP4 gene WBP4 Expert Review Green;Other Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092, WBP4-related 37963460 False 3 100;0;0 1.2304 True ENSG00000120688 ENSG00000120688 HGNC:12739 WDFY3 gene WDFY3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Microcephaly 18, primary, autosomal dominant, MIM#617520;Neurodevelopmental disorder with macrocephaly 31327001;27008544 False 3 100;0;0 1.2304 True ENSG00000163625 ENSG00000163625 HGNC:20751 WDPCP gene WDPCP Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 15, MIM# 615992;OFD;Congenital heart defects, hamartomas of tongue, and polysyndactyly, 217085 20671153;25427950;32055034;29588463;28289185 False 3 50;0;50 1.2304 True ENSG00000143951 ENSG00000143951 HGNC:28027 WDR1 gene WDR1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Periodic fever, immunodeficiency, and thrombocytopenia syndrome, MIM#150550;Neutropaenia;Poor wound healing;Severe stomatitis;Neutrophil nuclei herniate;Autoinflammatory periodic fever;Thrombocytopaenia 27994071;27557945;29751004 False 3 100;0;0 1.2304 True ENSG00000071127 ENSG00000071127 HGNC:12754 WDR11 gene WDR11 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Intellectual developmental disorder, autosomal recessive 78, MIM# 620237;Hypogonadotropic hypogonadism 14 with or without anosmia MIM #614858" 34413497 False 3 100;0;0 1.2304 True ENSG00000120008 ENSG00000120008 HGNC:13831 WDR19 gene WDR19 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Nephronophthisis 13, MIM# 614377;Senior-Loken syndrome 8, MIM# 616307;Short-rib thoracic dysplasia 5 with or without polydactyly, MIM# 614376;Cranioectodermal dysplasia 4, MIM# 614378 33946315;33875766;33606107;22019273;23559409;23683095;32055034 False 3 100;0;0 1.2304 True ENSG00000157796 ENSG00000157796 HGNC:18340 WDR26 gene WDR26 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Skraban-Deardorff syndrome, MIM#617616 28686853;33506510;33675273 False 3 100;0;0 1.2304 True ENSG00000162923 ENSG00000162923 HGNC:21208 WDR34 gene WDR34 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Short-rib thoracic dysplasia 11 with or without polydactyly, MIM# 615633;Retinitis pigmentosa 24183449;24183451;33124039;30649997;29241935;28379358 False 3 100;0;0 1.2304 True ENSG00000119333 ENSG00000119333 HGNC:28296 WDR35 gene WDR35 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cranioectodermal dysplasia 2, MIM#613610;MONDO:0013323;Short-rib thoracic dysplasia 7 with or without polydactyly, MIM#614091;MONDO:0013569 False 3 100;0;0 1.2304 True ENSG00000118965 ENSG00000118965 HGNC:29250 WDR37 gene WDR37 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurooculocardiogenitourinary syndrome, MIM# 618652 31327508;31327508 False 3 100;0;0 1.2304 True ENSG00000047056 ENSG00000047056 HGNC:31406 WDR4 gene WDR4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Galloway-Mowat syndrome 6, OMIM #618347;Microcephaly, growth deficiency, seizures, and brain malformations, OMIM #618346 26416026;30079490;29597095;28617965 False 3 100;0;0 1.2304 True ENSG00000160193 ENSG00000160193 HGNC:12756 WDR44 gene WDR44 Expert Review Green;Literature Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Ciliopathy, MONDO:0005308, WDR44-related PMID: 38191484 False 3 100;0;0 1.2304 True ENSG00000131725 ENSG00000131725 HGNC:30512 WDR45 gene WDR45 Expert list;Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Neurodegeneration with brain iron accumulation 5 300894;Rett syndrome;Rett-like phenotypes" 30842224 False 3 100;0;0 1.2304 True ENSG00000196998 ENSG00000196998 HGNC:28912 WDR45B gene WDR45B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with spastic quadriplegia and brain abnormalities with or without seizures, MIM# 617977 21937992;28503735;27431290 False 3 100;0;0 1.2304 True ENSG00000141580 ENSG00000141580 HGNC:25072 WDR47 gene WDR47 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Complex neurodevelopmental disorder MONDO:0100038, WDR47-related;Congenital heart disease MONDO:0005453 39609633;35474353 False 3 100;0;0 1.2304 True ENSG00000085433 ENSG00000085433 HGNC:29141 WDR5 gene WDR5 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder MONDO:0700092, WDR5-related 36408368 False 3 100;0;0 1.2304 True Other ENSG00000196363 ENSG00000196363 HGNC:12757 WDR60 gene WDR60 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Short-rib thoracic dysplasia 8 with or without polydactyly, MIM# 615503;Retinitis pigmentosa 23910462;29271569;26874042 False 3 100;0;0 1.2304 True ENSG00000126870 ENSG00000126870 HGNC:21862 WDR62 gene WDR62 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephaly 2, primary, autosomal recessive, with or without cortical malformations, MIM# 604317;MONDO:0011435 20890279;20729831;20890278;21496009;21834044;22775483;32677750;31788460 False 3 100;0;0 1.2304 True ENSG00000075702 ENSG00000075702 HGNC:24502 WDR72 gene WDR72 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Amelogenesis imperfecta, type IIA3, MIM# 613211 21196691;27259663;20938048;26502894;23293580;25008349;19853237 False 3 100;0;0 1.2304 True ENSG00000166415 ENSG00000166415 HGNC:26790 WDR73 gene WDR73 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Galloway-Mowat syndrome 1, MIM#251300 25466283;26123727;25873735;26070982;30315938 False 3 100;0;0 1.2304 True ENSG00000177082 ENSG00000177082 HGNC:25928 WDR81 gene WDR81 Expert list;Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, mental retardation, and dysequilibrium syndrome 2, 610185;Hydrocephalus, congenital, 3, with brain anomalies, 617967 21885617;28556411;28969387 False 3 33;0;67 1.2304 True ENSG00000167716 ENSG00000167716 HGNC:26600 WDR83OS gene WDR83OS Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "Neurodevelopmental disorder with variable familial hypercholanemia, MIM# 621016" 39471804;30250217 False 3 50;0;50 1.2304 True ENSG00000105583 ENSG00000105583 HGNC:30203 WEE2 gene WEE2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Oocyte maturation defect 5, MIM# 617996 29606300;30628060 False 3 100;0;0 1.2304 True ENSG00000214102 ENSG00000214102 HGNC:19684 WFDC2 gene WFDC2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Bronchiectasis and nasal polyposis, MIM# 620984 38626355 False 3 100;0;0 1.2304 True ENSG00000101443 ENSG00000101443 HGNC:15939 WFS1 gene WFS1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal ?Cataract 41;Deafness, autosomal dominant 6/14/38;Wolfram syndrome, autosomal recessive 1;Wolfram-like syndrome, autosomal dominant;{Diabetes mellitus, noninsulin-dependent, association with} 25211237;33693650 False 3 100;0;0 1.2304 True ENSG00000109501 ENSG00000109501 HGNC:12762 WHRN gene WHRN Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Usher syndrome, type 2D, MIM# 611383;Deafness, autosomal recessive 31, MIM# 607084 17171570;21738389;22147658;26338283;12833159;20502675;28254438;27117407;12833159;29270100;15841483 False 3 100;0;0 1.2304 True ENSG00000095397 ENSG00000095397 HGNC:16361 WIPF1 gene WIPF1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Wiskott-Aldrich syndrome 2 MIM# 614493;Reduced T cells;defective lymphocyte responses to anti-CD3;high IgE;Thrombocytopenia with or without small platelets;recurrent bacterial and viral Infections;eczema;bloody diarrhoea;gastrointestinal bleeding;WAS protein absent 22231303;27742395;11869681;14757742 False 3 100;0;0 1.2304 True ENSG00000115935 ENSG00000115935 HGNC:12736 WIPI2 gene WIPI2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "Intellectual developmental disorder with short stature and variable skeletal anomalies 618453" 30968111;34557665 False 3 50;0;50 1.2304 True ENSG00000157954 ENSG00000157954 HGNC:32225 WISP3 gene WISP3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Arthropathy, progressive pseudorheumatoid, of childhood, MIM# 208230;Spondyloepiphyseal dysplasia tarda with progressive arthropathy, MIM# 208230 10471507 False 3 100;0;0 1.2304 True ENSG00000112761 ENSG00000112761 HGNC:12771 WLS gene WLS Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Zaki syndrome, MIM#619648 PMID: 34587386 False 3 100;0;0 1.2304 True ENSG00000116729 ENSG00000116729 HGNC:30238 WNK1 gene WNK1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neuropathy, hereditary sensory and autonomic, type II, MIM# 201300;MONDO:0024309;Pseudohypoaldosteronism, type IIC, MIM# 614492 15060842;15911806;15455397;16534117 False 3 100;0;0 1.2304 True ENSG00000060237 ENSG00000060237 HGNC:14540 WNK3 gene WNK3 Expert Review Green;Literature Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Prieto syndrome, MIM# 309610 35678782 False 3 100;0;0 1.2304 True ENSG00000196632 ENSG00000196632 HGNC:14543 WNK4 gene WNK4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Pseudohypoaldosteronism, type IIB, MIM# 614491 22266938;31044551 False 3 100;0;0 1.2304 True ENSG00000126562 ENSG00000126562 HGNC:14544 WNT1 gene WNT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Osteogenesis imperfecta, type XV, MIM# 615220 23499309;23499310;23656646;26671912 False 3 100;0;0 1.2304 True ENSG00000125084 ENSG00000125084 HGNC:12774 WNT10A gene WNT10A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Odontoonychodermal dysplasia;Schopf-Schulz-Passarge syndrome;Tooth agenesis, selective, 4 19559398;30426266 False 3 100;0;0 1.2304 True ENSG00000135925 ENSG00000135925 HGNC:13829 WNT10B gene WNT10B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Split-hand/foot malformation 6, OMIM #601906;Tooth agenesis, selective, 8, OMIM #617073 20635353;24211389;27321946 False 3 100;0;0 1.2304 True ENSG00000169884 ENSG00000169884 HGNC:12775 WNT11 gene WNT11 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown osteoporosis, MONDO:0005298;osteoarthritis, MONDO:0005178;recurrent fractures 34875064 False 3 100;0;0 1.2304 True ENSG00000085741 ENSG00000085741 HGNC:12776 WNT2B gene WNT2B Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Diarrhoea 9, MIM# 618168 29909964 False 3 100;0;0 1.2304 True ENSG00000134245 ENSG00000134245 HGNC:12781 WNT5A gene WNT5A Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Robinow syndrome, autosomal dominant 1, MIM#180700 19918918;24716670;27092434;29276006;31032853;16602827;12839624;10021340 False 3 100;0;0 1.2304 True ENSG00000114251 ENSG00000114251 HGNC:12784 WNT7A gene WNT7A Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Fuhrmann syndrome, MIM# 228930;Ulna and fibula, absence of, with severe limb deficiency, MIM# 276820;Santos syndrome, MIM# 613005 21344627;20949531;16826533;19012338 False 3 100;0;0 1.2304 True ENSG00000154764 ENSG00000154764 HGNC:12786 WNT7B gene WNT7B Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Pulmonary hypoplasia, Diaphragmatic anomalies, Anophthalmia/microphthalmia and Cardiac defects syndrome;Multiple congenital anomalies/dysmorphic features syndrome MONDO:0043005, WNT7B-related 35790350 False 3 100;0;0 1.2304 True ENSG00000188064 ENSG00000188064 HGNC:12787 WRAP53 gene WRAP53 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Dyskeratosis congenita, autosomal recessive 3, MIM# 613988 21205863;32303682;29514627 False 3 100;0;0 1.2304 True ENSG00000141499 ENSG00000141499 HGNC:25522 WRN gene WRN Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Werner syndrome, MIM# 277700;MONDO:0010196 28476236;8602509;8968742;9012406 False 3 100;0;0 1.2304 True ENSG00000165392 ENSG00000165392 HGNC:12791 WWOX gene WWOX Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 12, MIM# 614322;Developmental and epileptic encephalopathy 28, MIM# 616211 24456803;25411445;32051108;32037574;24369382;34831305;33916893 False 3 100;0;0 1.2304 True ENSG00000186153 ENSG00000186153 HGNC:12799 XDH gene XDH Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Xanthinuria, type I (MIM#278300) 32071838 False 3 100;0;0 1.2304 True ENSG00000158125 ENSG00000158125 HGNC:12805 XIAP gene XIAP Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Lymphoproliferative syndrome, X-linked, 2, MIM# 300635 22228567;25943627 False 3 100;0;0 1.2304 True ENSG00000101966 ENSG00000101966 HGNC:592 XIST gene XIST Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females X-inactivation, familial skewed, MIM# 300087 False 3 100;0;0 1.2304 True ENSG00000229807 ENSG00000229807 HGNC:12810 XPA gene XPA Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Xeroderma pigmentosum, group A , MIM#278700;MONDO:0010210 2234061;1372102 False 3 100;0;0 1.2304 True ENSG00000136936 ENSG00000136936 HGNC:12814 XPC gene XPC Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Xeroderma pigmentosum, group C, MIM# 278720;MONDO:0010211 10447254 False 3 100;0;0 1.2304 True ENSG00000154767 ENSG00000154767 HGNC:12816 XPNPEP3 gene XPNPEP3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Nephronophthisis-like nephropathy 1, OMIM #613159 20179356 False 3 100;0;0 1.2304 True ENSG00000196236 ENSG00000196236 HGNC:28052 XPR1 gene XPR1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Basal ganglia calcification, idiopathic, 6, MIM# 616413 25938945 False 3 100;0;0 1.2304 True ENSG00000143324 ENSG00000143324 HGNC:12827 XRCC1 gene XRCC1 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 26 MIM#617633 28002403;29472272 False 3 100;0;0 1.2304 True ENSG00000073050 ENSG00000073050 HGNC:12828 XRCC4 gene XRCC4 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Short stature, microcephaly, and endocrine dysfunction, MIM# 616541;MONDO:0014686 25839420;25728776 False 3 100;0;0 1.2304 True ENSG00000152422 ENSG00000152422 HGNC:12831 XYLT1 gene XYLT1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal 30554721;24581741;23982343;22711505 False 3 100;0;0 1.2304 True ENSG00000103489 ENSG00000103489 HGNC:15516 XYLT2 gene XYLT2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spondyloocular syndrome MIM# 605822 26027496;26987875;30891060;28484880 False 3 100;0;0 1.2304 True ENSG00000015532 ENSG00000015532 HGNC:15517 YAP1 gene YAP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Coloboma, ocular, with or without hearing impairment, cleft lip/palate, and/or mental retardation, MIM#120433 24462371;27267789;28801591 False 3 100;0;0 1.2304 True ENSG00000137693 ENSG00000137693 HGNC:16262 YARS gene YARS Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, dominant intermediate C, MIM# 608323;MONDO:0012012;Infantile-onset multisystem neurologic, endocrine, and pancreatic disease 2, MIM# 619418 30304524;29232904;27633801;19561293 False 3 100;0;0 1.2304 True ENSG00000134684 ENSG00000134684 HGNC:12840 YARS2 gene YARS2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561;sideroblastic anaemia;muscle atrophy;myopathy;lactic acidosis;Hypertrophic cardiomyopathy;Hepatomegaly;Decreased cytochrome C oxidase activity 24430573;24344687 False 3 100;0;0 1.2304 True ENSG00000139131 ENSG00000139131 HGNC:24249 YIF1B gene YIF1B Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal "Kaya-Barakat-Masson syndrome, MIM# 619125;Central hypotonia;Failure to thrive;Microcephaly;Global developmental delay;Intellectual disability;Seizures;Spasticity;Abnormality of movement" 32006098;26077767 False 3 100;0;0 1.2304 True ENSG00000167645 ENSG00000167645 HGNC:30511 YIPF5 gene YIPF5 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephaly, epilepsy, and diabetes syndrome 2 , MIM#619278 33164986 False 3 100;0;0 1.2304 True ENSG00000145817 ENSG00000145817 HGNC:24877 YRDC gene YRDC Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Galloway-Mowat syndrome 31481669 False 3 100;0;0 1.2304 True ENSG00000196449 ENSG00000196449 HGNC:28905 YWHAE gene YWHAE Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092 36999555 False 3 100;0;0 1.2304 True ENSG00000108953 ENSG00000108953 HGNC:12851 YWHAG gene YWHAG Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 56, (MIMI#617665) 33393734;33590706;31926053;33767733 False 3 100;0;0 1.2304 True ENSG00000170027 ENSG00000170027 HGNC:12852 YY1 gene YY1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Gabriele-de Vries syndrome, OMIM #617557 28575647 False 3 100;0;0 1.2304 True ENSG00000100811 ENSG00000100811 HGNC:12856 YY1AP1 gene YY1AP1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Grange syndrome, MIM# 602531;stenosis/occlusion of multiple arteries 31633303;30356112;31270375;22987684;16691574;27939641;30556293 False 3 100;0;0 1.2304 True ENSG00000163374 ENSG00000163374 HGNC:30935 ZAP70 gene ZAP70 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 48, MIM# 269840;Autoimmune disease, multisystem, infantile-onset, 2, MIM# 617006 8124727;8202712;11412303;26783323;33628209;33531381 False 3 100;0;0 1.2304 True Other ENSG00000115085 ENSG00000115085 HGNC:12858 ZBTB11 gene ZBTB11 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Intellectual developmental disorder, autosomal recessive 69, OMIM #618383 29893856 False 3 50;50;0 1.2304 True ENSG00000066422 ENSG00000066422 HGNC:16740 ZBTB18 gene ZBTB18 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 22, MIM# 612337 27598823;29573576 False 3 100;0;0 1.2304 True Other ENSG00000179456 ENSG00000179456 HGNC:13030 ZBTB20 gene ZBTB20 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Primrose syndrome, MIM# 259050 25017102;27061120;30256248 False 3 100;0;0 1.2304 True ENSG00000181722 ENSG00000181722 HGNC:13503 ZBTB24 gene ZBTB24 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency-centromeric instability-facial anomalies syndrome 2, MIM# 614069;MONDO:0013553 21596365;21906047;23486536 False 3 100;0;0 1.2304 True ENSG00000112365 ENSG00000112365 HGNC:21143 ZBTB47 gene ZBTB47 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder (MONDO#0700092), ZBTB47-related 37743782 False 3 100;0;0 1.2304 True ENSG00000114853 ENSG00000114853 HGNC:26955 ZBTB7A gene ZBTB7A Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Macrocephaly, neurodevelopmental delay, lymphoid hyperplasia, and persistent fetal hemoglobin (MIM#619769) 34515416;31645653 False 3 100;0;0 1.2304 True ENSG00000178951 ENSG00000178951 HGNC:18078 ZC4H2 gene ZC4H2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Wieacker-Wolff syndrome, MIM# 314580 23623388;34322088;33949289;31885220;31206972 False 3 100;0;0 1.2304 True ENSG00000126970 ENSG00000126970 HGNC:24931 ZCCHC8 gene ZCCHC8 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted pulmonary fibrosis and/or bone marrow failure, telomere-related MONDO:0000148 31488579 False 3 67;33;0 1.2304 True ENSG00000033030 ENSG00000033030 HGNC:25265 ZDHHC9 gene ZDHHC9 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Mental retardation, X-linked syndromic, Raymond type MIM# 300799 26000327;29681091 False 3 100;0;0 1.2304 True ENSG00000188706 ENSG00000188706 HGNC:18475 ZEB1 gene ZEB1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Corneal dystrophy, Fuchs endothelial, 6, MIM# 613270;Corneal dystrophy, posterior polymorphous, 3, MIM# 609141 16252232;20036349;26622166 False 3 100;0;0 1.2304 True ENSG00000148516 ENSG00000148516 HGNC:11642 ZEB2 gene ZEB2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mowat-Wilson syndrome, MIM# 235730;MONDO:0009341 29300384 False 3 100;0;0 1.2304 True ENSG00000169554 ENSG00000169554 HGNC:14881 ZFHX3 gene ZFHX3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, ZFHX3-related 38412861;37292950 False 3 100;0;0 1.2304 True ENSG00000140836 ENSG00000140836 HGNC:777 ZFHX4 gene ZFHX4 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted neurodevelopmental disorder, ZFHX4-related (MONDO:0700092) 33057194;24038936 False 3 50;50;0 1.2304 True ENSG00000091656 ENSG00000091656 HGNC:30939 ZFP57 gene ZFP57 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal IUGR;Diabetes mellitus, transient neonatal 1 OMIM:601410;Multi Locus Imprinting Disturbance;diabetes mellitus, transient neonatal, 1, MONDO:0011073 18622393;27075368;23150280;30315371;31399135;33053156 False 3 100;0;0 1.2304 True ENSG00000204644 ENSG00000204644 HGNC:18791 ZFPM2 gene ZFPM2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Diaphragmatic hernia 3, MIM# 610187;46XY sex reversal 9 (MIM#616067);Tetralogy of Fallot, MIM# 187500 16103912;17568391;24702427;24549039;27899157;31962012;12223418;20807224;21919901;24469719;26959486 False 3 100;0;0 1.2304 True ENSG00000169946 ENSG00000169946 HGNC:16700 ZFX gene ZFX Expert Review Green;Literature Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Intellectual developmental disorder, X-linked syndromic 37, MIM# 301118 26350204;26740508;38325380 False 3 100;0;0 1.2304 True ENSG00000005889 ENSG00000005889 HGNC:12869 ZFYVE19 gene ZFYVE19 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Cholestasis 32737136 False 3 100;0;0 1.2304 True ENSG00000166140 ENSG00000166140 HGNC:20758 ZFYVE26 gene ZFYVE26 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 15, autosomal recessive MIM#270700 24367272;18394578;34057829 False 3 50;50;0 1.2304 True ENSG00000072121 ENSG00000072121 HGNC:20761 ZIC1 gene ZIC1 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Structural brain anomalies with impaired intellectual development and craniosynostosis, OMIM#618736 26340333, 30391508 False 3 100;0;0 1.2304 True ENSG00000152977 ENSG00000152977 HGNC:12872 ZIC2 gene ZIC2 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Holoprosencephaly 5, MIM# 609637;MONDO:0012322 9771712;11285244 False 3 100;0;0 1.2304 True ENSG00000043355 ENSG00000043355 HGNC:12873 ZIC3 gene ZIC3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Congenital heart defects, nonsyndromic, 1, X-linked (MIM#306955);Heterotaxy, visceral, 1, X-linked (MIM#306955);VACTERL association, X-linked, MIM# 314390 27406248;20452998 False 3 100;0;0 1.2304 True ENSG00000156925 ENSG00000156925 HGNC:12874 ZMIZ1 gene ZMIZ1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with dysmorphic facies and distal skeletal anomalies;OMIM #618659 30639322 False 3 100;0;0 1.2304 True ENSG00000108175 ENSG00000108175 HGNC:16493 ZMPSTE24 gene ZMPSTE24 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Mandibuloacral dysplasia with type B lipodystrophy, MIM# 608612;MONDO:0012074;Restrictive dermopathy, lethal, MIM# 275210;MONDO:0010143 11923874;22718200;29794150;29208544;12913070;27410998;27409638;15937076;16671095;22718200;29794150;24169522 False 3 100;0;0 1.2304 True ENSG00000084073 ENSG00000084073 HGNC:12877 ZMYM2 gene ZMYM2 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Congenital anomalies of kidney and urinary tract;Neurodevelopmental disorder 32891193 False 3 100;0;0 1.2304 True ENSG00000121741 ENSG00000121741 HGNC:12989 ZMYM3 gene ZMYM3 Expert Review Green;Literature Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Intellectual developmental disorder, X-linked 112, MIM# 301111 36586412;24721225 False 3 100;0;0 1.2304 True ENSG00000147130 ENSG00000147130 HGNC:13054 ZMYND10 gene ZMYND10 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Ciliary dyskinesia, primary, 22, MIM#615444 23891471;23891469 False 3 100;0;0 1.2304 True ENSG00000004838 ENSG00000004838 HGNC:19412 ZMYND11 gene ZMYND11 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 30, MIM# 616083 32097528;34216016 False 3 100;0;0 1.2304 True ENSG00000015171 ENSG00000015171 HGNC:16966 ZMYND15 gene ZMYND15 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Severe oligozoospermia 24431330;33169450;20675388 False 3 100;0;0 1.2304 True ENSG00000141497 ENSG00000141497 HGNC:20997 ZMYND8 gene ZMYND8 Expert Review;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, ZMYND8-related;Delayed speech and language development;Motor delay;Intellectual disability;Abnormality of cardiovascular system morphology;Hearing abnormality;Abnormality of vision;Abnormality of the face;Seizures 35916866;32530565 False 3 100;0;0 1.2304 True ENSG00000101040 ENSG00000101040 HGNC:9397 ZNF142 gene ZNF142 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with impaired speech and hyperkinetic movements, MIM#618425 31036918 False 3 100;0;0 1.2304 True ENSG00000115568 ENSG00000115568 HGNC:12927 ZNF148 gene ZNF148 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Global developmental delay, absent or hypoplastic corpus callosum, and dysmorphic facies;MIM#617260 PMID: 27964749 False 3 100;0;0 1.2304 True ENSG00000163848 ENSG00000163848 HGNC:12933 ZNF292 gene ZNF292 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Intellectual developmental disorder, autosomal dominant 64 MIM#619188" 31723249 False 3 100;0;0 1.2304 True ENSG00000188994 ENSG00000188994 HGNC:18410 ZNF335 gene ZNF335 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Microcephaly 10, primary, autosomal recessive (MIM#615095) 34982360;23178126;27540107;29652087 False 3 100;0;0 1.2304 True ENSG00000198026 ENSG00000198026 HGNC:15807 ZNF341 gene ZNF341 Expert list;Expert Review Green Mendeliome BIALLELIC, autosomal or pseudoautosomal Hyper-IgE recurrent infection syndrome 3, autosomal recessive, MIM# 618282;Mild facial dysmorphism;Early onset eczema;Recurrent bacterial skin infections, abscesses;Recurrent respiratory infections, lung abscesses and pneumothoraces;Hyperextensible joints, bone fractures, retention of primary teeth 29907691;29907690 False 3 100;0;0 1.2304 True ENSG00000131061 ENSG00000131061 HGNC:15992 ZNF408 gene ZNF408 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Exudative vitreoretinopathy 6, MIM# 616468;Retinitis pigmentosa 72, MIM# 616469 23716654;32530348;32097476;32238352;30998249;29982478;25882705;34259982;28095122 False 3 100;0;0 1.2304 True ENSG00000175213 ENSG00000175213 HGNC:20041 ZNF462 gene ZNF462 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Weiss-Kruszka syndrome, MIM#618619 28513610;31361404 False 3 100;0;0 1.2304 True ENSG00000148143 ENSG00000148143 HGNC:21684 ZNF469 gene ZNF469 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Brittle cornea syndrome 1, MIM# 229200 18452888;19661234;20938016;21664999;32671420 False 3 100;0;0 1.2304 True ENSG00000225614 ENSG00000225614 HGNC:23216 ZNF526 gene ZNF526 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal Dentici-Novelli neurodevelopmental syndrome, MIM# 619877 21937992;25558065;33397746 False 3 50;0;50 1.2304 True ENSG00000167625 ENSG00000167625 HGNC:29415 ZNF644 gene ZNF644 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myopia 21, autosomal dominant, MIM# 614167 21695231;30834109;31560770;24991186 False 3 100;0;0 1.2304 True ENSG00000122482 ENSG00000122482 HGNC:29222 ZNF687 gene ZNF687 Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Paget disease of bone 6, MIM#616833 26849110;29493781;32106343 False 3 50;50;0 1.2304 True ENSG00000143373 ENSG00000143373 HGNC:29277 ZNF699 gene ZNF699 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal DEGCAGS syndrome, MIM# 619488 33875846 False 3 100;0;0 1.2304 True ENSG00000196110 ENSG00000196110 HGNC:24750 ZNF711 gene ZNF711 Expert Review Green;Victorian Clinical Genetics Services Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Mental retardation, X-linked 97;OMIM #300803 27993705;19377476 False 3 100;0;0 1.2304 True ENSG00000147180 ENSG00000147180 HGNC:13128 ZNF808 gene ZNF808 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Pancreatic agenesis 3, MIM# 620991 PMID: 37308312 False 3 100;0;0 1.2304 True ENSG00000198482 ENSG00000198482 HGNC:33230 ZNFX1 gene ZNFX1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 91 and hyperinflammation, MIM# 619644 33872655;33876776;34708404 False 3 100;0;0 1.2304 True ENSG00000124201 ENSG00000124201 HGNC:29271 ZNHIT3 gene ZNHIT3 Expert Review Green;Victorian Clinical Genetics Services Mendeliome BIALLELIC, autosomal or pseudoautosomal PEHO syndrome, MIM# 260565 28335020;28335020;31048081 False 3 100;0;0 1.2304 True ENSG00000108278 ENSG00000273611 HGNC:12309 ZNRF3 gene ZNRF3 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted complex neurodevelopmental disorder MONDO:0100038 39168120 False 3 100;0;0 1.2304 True ENSG00000183579 ENSG00000183579 HGNC:18126 ZP1 gene ZP1 Expert list;Expert Review Green Mendeliome BOTH monoallelic and biallelic, autosomal or pseudoautosomal Oocyte maturation defect 1, MIM# 615774 24670168;30810869;32573113;33272616 False 3 100;0;0 1.2304 True ENSG00000149506 ENSG00000149506 HGNC:13187 ZP2 gene ZP2 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Oocyte maturation defect 6, MIM# 618353;Female infertility 30810869;29895852 False 3 100;0;0 1.2304 True ENSG00000103310 ENSG00000103310 HGNC:13188 ZP3 gene ZP3 Expert list;Expert Review Green Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Oocyte maturation defect 3, MIM# 617712 28886344;30810869;33272616;32573113 False 3 100;0;0 1.2304 True ENSG00000188372 ENSG00000188372 HGNC:13189 ZRSR2 gene ZRSR2 Expert Review;Expert Review Green Mendeliome X-LINKED: hemizygous mutation in males, biallelic mutations in females Orofaciodigital syndrome XXI, MIM# 301132 38158857 False 3 100;0;0 1.2304 True ENSG00000169249 ENSG00000169249 HGNC:23019 ZSCAN10 gene ZSCAN10 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Otofacial neurodevelopmental syndrome, MIM# 620910 PMID: 38386308 False 3 100;0;0 1.2304 True ENSG00000130182 ENSG00000130182 HGNC:12997 ZSWIM6 gene ZSWIM6 Expert Review;Expert Review Green;Victorian Clinical Genetics Services Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with movement abnormalities, abnormal gait, and autistic features, MIM# 617865;Acromelic frontonasal dysostosis, MIM# 603671 29198722;25105228;26706854 False 3 50;50;0 1.2304 True ENSG00000130449 ENSG00000130449 HGNC:29316 CANVAS str RFC1 Expert Review Green;Expert list Mendeliome BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575 30926972;32851396 False 3 100;0;0 1.2304 True ENSG00000035928 ENSG00000035928 HGNC:9969 4 39350045 39350103 39348425 39348483 AAGGG 0 400 CANVAS_ACAGG str RFC1 Expert Review Green;Literature Mendeliome BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome;fasciculations;elevated serum creatine kinase levels;denervation 33103729 False 3 100;0;0 1.2304 True ENSG00000035928 ENSG00000035928 HGNC:9969 4 39350045 39350103 39348425 39348483 ACAGG 0 400 DM1 str DMPK Expert Review Green;Expert list Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myotonic dystrophy 1 MIM#160900 20301344;29325606 False 3 100;0;0 1.2304 True ENSG00000104936 ENSG00000104936 HGNC:2933 19 46273463 46273522 45770205 45770264 CTG 34 50 DM2 str CNBP Expert Review Green;Expert list Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myotonic dystrophy 2 MIM#602668 20301639;29325606 False 3 100;0;0 1.2304 True ENSG00000169714 ENSG00000169714 HGNC:13164 3 128891420 128891499 129172577 129172656 CCTG 26 75 FAME1 str SAMD12 Expert Review Green;Expert list Mendeliome BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Epilepsy, familial adult myoclonic, 1 MIM#601068 30194086;29507423 False 3 100;0;0 1.2304 True ENSG00000177570 ENSG00000177570 HGNC:31750 8 119379055 119379157 118366816 118366918 TTTCA 0 100 FAME2 str STARD7 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epilepsy, familial adult myoclonic, 2 MIM#607876 11701600;24114805;31664034 False 3 100;0;0 1.2304 True ENSG00000084090 ENSG00000084090 HGNC:18063 2 96862805 96862859 96197067 96197121 ATTTC 0 661 HDL2 str JPH3 Expert Review Green;Expert list Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Huntington disease-like 2 MIM#606438 20301701 False 3 100;0;0 1.2304 True ENSG00000154118 ENSG00000154118 HGNC:14203 16 87637894 87637935 87604288 87604329 CTG 28 40 MRUPAV_PLIN4 str PLIN4 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted myopathy, distal, with rimmed vacuoles MONDO:0014945 32451610;37145156;36151849;35499779 False 3 100;0;0 1.2304 True ENSG00000167676 ENSG00000167676 HGNC:29393 19 4510975 4511073 4510963 4511061 ACTGAAGACAGTGTCCTTGGTACCCATAAGCACAGCCTTGGAGGCGTCCACGCCGGTCTGCACGGTTCCTTTGGCCACATTCACTGCCCCCGTGACTCC 31 39 NIID str NOTCH2NL Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuronal intranuclear inclusion disease MIM#603472;Oculopharyngodistal myopathy 3 MIM#619473;Tremor, hereditary essential, 6 MIM#618866 31178126;31332381;31819945;33887199;33943039;32250060;31332380;32852534;32989102;34333668 False 3 100;0;0 1.2304 True ENSG00000213240 ENSG00000264343 HGNC:31862 1 145209324 145209344 149390803 149390829 GGC 40 60 OPDM2 str GIPC1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Oculopharyngodistal myopathy 2 MIM#618940 32413282;33374016 False 3 100;0;0 1.2304 True ENSG00000123159 ENSG00000123159 HGNC:1226 19 14606854 14606886 14496042 14496074 CGG 32 70 OPDM4 str RILPL1 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Oculopharyngodistal myopathy MONDO:0025193 35148830 False 3 100;0;0 1.2304 True ENSG00000188026 ENSG00000188026 HGNC:26814 12 124018270 124018296 123533723 123533749 CGG 16 139 OPDM_ABCD3_GCC str ABCD3 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Oculopharyngodistal myopathy MONDO:0025193 39068203 False 3 100;0;0 1.2304 True ENSG00000117528 ENSG00000117528 HGNC:67 1 94883977 94883998 94418421 94418442 GCC 50 118 SCA1 str ATXN1 Expert Review Green;Expert list Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 1 MIM#164400 29325606;20301363 False 3 100;0;0 1.2304 True ENSG00000124788 ENSG00000124788 HGNC:10548 6 16327918 16327953 16327687 16327722 CAG 35 39 SCA10 str ATXN10 Expert Review Green;Expert list Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 10 MIM#603516 20301354 False 3 100;0;0 1.2304 True ENSG00000130638 ENSG00000130638 HGNC:10549 22 46191235 46191304 45795355 45795424 ATTCT 32 800 SCA12 str PPP2R2B Expert Review Green;Expert list Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 12 MIM#604326 27864267;33811808 False 3 100;0;0 1.2304 True ENSG00000156475 ENSG00000156475 HGNC:9305 5 146258292 146258321 146878729 146878758 CAG 32 51 SCA17 str TBP Expert Review Green;Expert list Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 17 MIM#607136 20301611;29325606 False 3 100;0;0 1.2304 True ENSG00000112592 ENSG00000112592 HGNC:11588 6 170870996 170871109 170561908 170562021 CAG 40 49 SCA2 str ATXN2 Expert Review Green;Expert list Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 2 MIM#183090 29325606;20301452 False 3 100;0;0 1.2304 True ENSG00000204842 ENSG00000204842 HGNC:10555 12 112036755 112036823 111598951 111599019 CAG 31 35 SCA3 str ATXN3 Expert Review Green;Expert list Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Machado-Joseph disease MIM#109150;Spinocerebellar ataxia type 3 20301375;29325606 False 3 100;0;0 1.2304 True ENSG00000066427 ENSG00000066427 HGNC:7106 14 92537355 92537396 92071011 92071052 CAG 44 60 SCA31 str BEAN1 Expert Review Green;Expert list Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 31 MIM#117210 19878914;31755042 False 3 100;0;0 1.2304 True ENSG00000166546 ENSG00000166546 HGNC:24160 16 66524301 66524302 66490398 66490399 TGGAA 22 80 SCA36 str NOP56 Expert Review Green;Expert list Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 36 MIM#614153 21683323 False 3 100;0;0 1.2304 True ENSG00000101361 ENSG00000101361 HGNC:15911 20 2633380 2633403 2652734 2652757 GGCCTG 14 650 SCA37 str DAB1 Expert Review Green;Expert list Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 37 MIM#615945 28686858;31145571 False 3 100;0;0 1.2304 True ENSG00000173406 ENSG00000173406 HGNC:2661 1 57832716 57832797 57367044 57367121 ATTTC 0 31 SCA4_ZFHX3_GGC str ZFHX3 Expert Review Green;Literature Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted spinocerebellar ataxia type 4 MONDO:0010847 38035881;38197134 False 3 100;0;0 1.2304 True ENSG00000140836 ENSG00000140836 HGNC:777 16 72821594 72821657 72787695 72787758 GGC 30 48 SCA7 str ATXN7 Expert Review Green;Expert list Mendeliome MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 7 MIM#164500 29325606;20301433 False 3 100;0;0 1.2304 True ENSG00000163635 ENSG00000163635 HGNC:10560 3 63898362 63898391 63912686 63912715 CAG 27 37